ID: 1103041686

View in Genome Browser
Species Human (GRCh38)
Location 12:117701045-117701067
Sequence CCTATTGTGCAGATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103041686 Original CRISPR CCTATTGTGCAGATGGAGGA TGG (reversed) Intronic
900371024 1:2332254-2332276 CCTGTTGTGCAGCTGCACGAAGG + Intronic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900938155 1:5780152-5780174 GCCATTGTGGAGGTGGAGGAGGG + Intergenic
903684445 1:25120518-25120540 CGCCTTGTGCAGAAGGAGGAGGG - Intergenic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
905115988 1:35641341-35641363 AATATTGTCCAGATGAAGGACGG - Exonic
905438191 1:37974074-37974096 CCTGTTGTGGGGTTGGAGGACGG + Intronic
905509215 1:38505298-38505320 CCTATAGTGCATGTGGAGGTTGG + Intergenic
906656984 1:47555533-47555555 CCTATTGTGCAAACAGAGGTGGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908443001 1:64173630-64173652 GCTATTTTACAGATGGAGAAAGG - Intronic
909685437 1:78343158-78343180 CCTGTTGTGGAGTTGGTGGAGGG - Intronic
909701664 1:78531234-78531256 CCTATTGTGCAGAGGATGCAGGG + Intronic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
914682899 1:149952197-149952219 CCTGTTGTGGAGTTGGGGGAGGG - Intronic
915802895 1:158813571-158813593 CCTATTGTGAATATAGAGGCTGG + Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
917053559 1:170952593-170952615 CCTGTTGTGGAGTTGGGGGAGGG + Intronic
920646715 1:207809121-207809143 CCTATGGTGGGGAGGGAGGAGGG - Intergenic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
1063688359 10:8259926-8259948 CTTATGGTTCAGCTGGAGGAGGG + Intergenic
1063735985 10:8755156-8755178 GCAATTGTGCAGATGGGGGTGGG - Intergenic
1063811849 10:9720240-9720262 ATTATTGTGAAGATGGAAGAAGG + Intergenic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1069046466 10:63748741-63748763 CCTGTTGTGGAGTTGGGGGAGGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070979921 10:80635946-80635968 CCTGTTGTGCGGTTGGGGGAAGG - Intronic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1073544677 10:104338207-104338229 CCTAGTGTGCTGAAGGAAGAAGG - Intronic
1073683910 10:105732229-105732251 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1075315256 10:121447978-121448000 CCTATGGAGGGGATGGAGGATGG - Intergenic
1076328404 10:129646150-129646172 CCCAGTGTTCAGATGGCGGAAGG + Intronic
1076823723 10:132956644-132956666 CCTGTTGTGGGGAGGGAGGAGGG + Intergenic
1077214776 11:1390709-1390731 CCCATTGTGCCGCGGGAGGAGGG + Intronic
1077354402 11:2108595-2108617 CCTATTGTGGGGAAGGAGGAGGG - Intergenic
1078014446 11:7601124-7601146 CCTCTTGTGCTCCTGGAGGAAGG - Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079499948 11:21091922-21091944 CCTAGTGTAAGGATGGAGGATGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079687507 11:23378474-23378496 CCAATTTTTCACATGGAGGATGG + Intergenic
1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG + Intergenic
1082808214 11:57463182-57463204 CCCAATTTGCAGATGAAGGAAGG - Intronic
1083119439 11:60496857-60496879 CCAACTGTGAAGTTGGAGGAAGG - Intronic
1085365646 11:75940768-75940790 CCCATTTTGCAGATGAAGCACGG + Intronic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1088952436 11:114585187-114585209 CCAGTTCTGCAGGTGGAGGATGG + Intronic
1088952438 11:114585225-114585247 CCAATTCTGCAGGTGGAGGATGG - Intronic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089974386 11:122719840-122719862 CCAATGCTGCTGATGGAGGATGG - Intronic
1095639967 12:44476454-44476476 CCCATTGGGCAGTTGGAGGCTGG - Intergenic
1098907180 12:76173946-76173968 CAGATTGTGCAAGTGGAGGAAGG + Intergenic
1098920353 12:76296844-76296866 CCTTTCGTGAAGATTGAGGACGG - Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1101702795 12:107191034-107191056 CCTGTTGTGGAGTGGGAGGAGGG + Intergenic
1101920797 12:108931432-108931454 TCTATTGTGCAGCTGGAGGTGGG - Intronic
1102635041 12:114315956-114315978 CCTATTCTACAGATGAAGAAAGG - Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1106273815 13:28183442-28183464 CCGCTTGTCAAGATGGAGGAGGG + Intronic
1107041584 13:35954267-35954289 CGAATTGTGCAGAAAGAGGAAGG - Intronic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1109456923 13:62605219-62605241 CCTACTGTGCTGAAGCAGGAAGG + Intergenic
1110702024 13:78559988-78560010 CCTATTGGGCATATGGAGATAGG - Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1116184640 14:41582520-41582542 CCTGTTGTGGAGTTGGGGGAGGG - Intergenic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1117814445 14:59582622-59582644 CCCATTGTACAGATGAAGAATGG - Intergenic
1118075864 14:62298239-62298261 CTTATTCTTCAGATAGAGGAAGG - Intergenic
1118915709 14:70101836-70101858 CCTATTGTGGAGCAGGAAGATGG + Intronic
1119171859 14:72541665-72541687 GCTACTGTGCGGGTGGAGGATGG + Intronic
1119635478 14:76269852-76269874 CGCATTGTGGAGAGGGAGGAAGG - Intergenic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1121311841 14:92939538-92939560 CCAAGAGTGGAGATGGAGGATGG - Exonic
1121546106 14:94764840-94764862 CCTAGTTTGCACATGGAAGATGG - Intergenic
1125384386 15:39121894-39121916 GCAATTGTGCAGATGGAGACAGG + Intergenic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1125931501 15:43603380-43603402 CAAATTGTGCAGATGTACGAGGG - Exonic
1125944599 15:43702890-43702912 CAAATTGTGCAGATGTACGAGGG - Intergenic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1130304954 15:82707201-82707223 CCTTTTCTGAAGATTGAGGATGG - Intronic
1130873259 15:87989496-87989518 CCTGTTGTGGAGTTGGGGGAGGG + Intronic
1131935669 15:97501620-97501642 CCTATTGTACAGAAGCAGAAAGG - Intergenic
1131946762 15:97630320-97630342 CCTGTTGTGGGGATGGAGGGAGG - Intergenic
1133257450 16:4525858-4525880 CCCATTGTCCTGATGGAGGCAGG + Intronic
1133740023 16:8644378-8644400 GCTGTCGTGCAGATGTAGGAAGG + Intronic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134796898 16:17048665-17048687 CCTATTGTGGGGTTGGGGGAGGG - Intergenic
1135032034 16:19046148-19046170 CCTTTTGTGCTGATGGCAGAAGG - Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135644291 16:24147785-24147807 CCTATTTTACAGATGAAGAAGGG - Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1137674393 16:50297103-50297125 CCTATTGCACAGATGGGGAAAGG + Intronic
1139337233 16:66241293-66241315 CCCATTGTGCAAATGGGGGCAGG + Intergenic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141096433 16:81166195-81166217 CCCATTGGACAGATGGGGGATGG + Intergenic
1141143715 16:81514508-81514530 CCCATTTTGCAGATGAAGAATGG - Intronic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1142606028 17:1081486-1081508 CCCAGTGTGCAGAGAGAGGATGG - Intronic
1144236029 17:13261492-13261514 CCTATTGTCCAGGTGGAGGCAGG + Intergenic
1144297362 17:13888880-13888902 CCACTTGTGGAGATGGAGGGAGG + Intergenic
1144781043 17:17808766-17808788 CCTATCATGGAGATTGAGGATGG - Intronic
1145287996 17:21520872-21520894 CCTATTGCTGAGAGGGAGGAGGG + Intergenic
1145389644 17:22445572-22445594 CCTATTGCTGAGAGGGAGGAGGG - Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147421160 17:40322790-40322812 CCCACTGTGCAGATCAAGGAGGG + Intronic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1151956497 17:77382797-77382819 AGTACTGTGCAGAGGGAGGAGGG + Intronic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1152909268 17:82989335-82989357 CCTGTTGTGGAGGTGGGGGAAGG + Intronic
1153580597 18:6569835-6569857 CCTAATCTGCAGTTGCAGGAAGG + Intronic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1159384369 18:67704216-67704238 GCTAGTGTGCAGATGTAAGAGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1161406135 19:4092157-4092179 CCTCTTTTGCAGCTGGAGGCAGG + Intronic
1161711148 19:5848853-5848875 ACTGTTGGGCAGATGGAGGAGGG - Intronic
1164859089 19:31548166-31548188 CCCATGGTGGACATGGAGGAGGG + Intergenic
1166702933 19:44892510-44892532 CCGAGTGTGCAGATGCAGGGAGG - Intronic
1167917719 19:52755653-52755675 CCTTTTCTGAAGATTGAGGACGG - Intergenic
925472354 2:4175890-4175912 CCCATTGGGCAGCTGGAGGCTGG + Intergenic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
932112300 2:69012687-69012709 ACCATTGTGCAGATGAAGTAGGG - Intergenic
934737679 2:96698243-96698265 CTCATTGTGAAGATGGAGCAGGG + Intergenic
936266846 2:111017445-111017467 CCTACTGTGCTGCTGGAGGCAGG - Intronic
937346742 2:121130647-121130669 CCAAATGTGCAGATGGAGTCAGG - Intergenic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943942119 2:194011580-194011602 CCTATTGTGGGGTTGGGGGAGGG + Intergenic
944033403 2:195264635-195264657 CCTGTTGTGGAGTTGGGGGAGGG - Intergenic
945039436 2:205731733-205731755 GCTATTGGCCAGATCGAGGATGG + Intronic
945272498 2:207955949-207955971 ACTATTGTGGAGATCGAGGAAGG + Intronic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946437059 2:219664210-219664232 TCTGTTGTGCAAAAGGAGGAGGG + Intergenic
946623808 2:221589752-221589774 CCTAGTGTCCAGATGGAGAGAGG + Intergenic
947141949 2:227027470-227027492 CCTGTTGTGGAGTGGGAGGAGGG + Intronic
947907968 2:233779533-233779555 TCCACTGTGCAGATGGAGAAAGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
948780400 2:240318134-240318156 CCTATGGTACCAATGGAGGATGG + Intergenic
1170595169 20:17799887-17799909 GCTAGTGTGAAGGTGGAGGAAGG + Intergenic
1172176601 20:32976270-32976292 CCCATGGTGCTGTTGGAGGAGGG + Intergenic
1172502352 20:35436453-35436475 CCTAGTGTGAAGAGGGAGGTGGG - Intronic
1172931382 20:38588560-38588582 CCCATTGAACAGATGGAAGAGGG - Intergenic
1175585527 20:60136441-60136463 CCCATTTTGCAGATGAAGAATGG + Intergenic
1177392638 21:20496054-20496076 CCTGTTGTGCTGTTGGGGGAGGG - Intergenic
1178362377 21:31959210-31959232 TGTTTTGTGCAGAAGGAGGAAGG - Intronic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
1183198244 22:36368146-36368168 CCCATTGTACAGATGAAGAAAGG - Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184746268 22:46458037-46458059 CATCTAGTGCAGAGGGAGGAAGG + Intronic
1184829597 22:46975860-46975882 CCTGTTGTGCGGTTGGAGAATGG + Intronic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
950614648 3:14148938-14148960 CCTCTGGTGCAGATGGTGAAAGG - Exonic
950799822 3:15541340-15541362 CCCATGGTGCAGATGGTGGGAGG - Intergenic
951630979 3:24719952-24719974 ACTATGGTGAATATGGAGGAGGG - Intergenic
953018748 3:39100653-39100675 TCTATGGTGGAGATGGAGGAGGG - Intronic
954331018 3:49890331-49890353 CCTCTTGGGCAGATGTAAGATGG - Intronic
957499350 3:81033839-81033861 CCTTTTGCCCAGATGGATGATGG - Intergenic
959256173 3:104017469-104017491 ACTATTGTGCAGAAAGAGTAAGG + Intergenic
959804269 3:110532167-110532189 TCCATTATGCAGATGGAGGAAGG - Intergenic
960085904 3:113591103-113591125 TATACTTTGCAGATGGAGGAAGG + Intronic
960433831 3:117601708-117601730 CATATAGTGCAGATGAACGAAGG + Intergenic
962127807 3:132640696-132640718 CCCATTTTGCAGATGAAGAAAGG - Intronic
962456000 3:135566327-135566349 GCTTTGGTGGAGATGGAGGAAGG + Intergenic
962904088 3:139786344-139786366 CATCTTTTGAAGATGGAGGAAGG + Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
966067268 3:175832992-175833014 CATTTTGTGAAGATTGAGGATGG - Intergenic
966627063 3:182028823-182028845 CCTATTTTGCAGATGAAATAGGG + Intergenic
967110587 3:186289988-186290010 CCTATTGTCCATCTGGATGATGG - Intronic
969258590 4:6019849-6019871 CCTAGTGTTCAGTGGGAGGAAGG + Intergenic
971864841 4:32156298-32156320 CCTGTTGTGGGGAGGGAGGAGGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
972086204 4:35219918-35219940 CATAATGTGGACATGGAGGATGG - Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
976286843 4:83378791-83378813 ACTATCTTGCAGATGGATGAGGG + Intergenic
976672285 4:87666647-87666669 CCTCTGGGGCAGATGTAGGAGGG + Intergenic
977298337 4:95236426-95236448 CCTGTTGAGCAGTTGGGGGAGGG + Intronic
979087977 4:116439277-116439299 GCTATTGTTCAGAGGAAGGAAGG + Intergenic
979634287 4:122939779-122939801 CCTGTTGTGGAGTTGGGGGAGGG - Intronic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
983461192 4:168027565-168027587 CCAATGGTGCAGTTGGAGGAAGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984398848 4:179235666-179235688 TCTATTTTGCAGATGGAAAATGG + Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
991718019 5:69469903-69469925 CCTATTCTGGAGAGGGATGAAGG - Intergenic
994182974 5:96787750-96787772 CCTTTTGGGAAGATGGGGGAGGG + Intronic
995060482 5:107807479-107807501 TCTATTTTGAAGATAGAGGATGG + Intergenic
995417434 5:111926251-111926273 CCAACAGTGCAGTTGGAGGAGGG + Intronic
996358286 5:122620110-122620132 CCTTTCCTGAAGATGGAGGACGG + Intergenic
996574623 5:124967579-124967601 CCTTTCCTGAAGATGGAGGACGG + Intergenic
997228181 5:132225278-132225300 ACTATTATGCAGATGGAAGTTGG - Intronic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999655415 5:153805944-153805966 CCTTTTCTGCAGTTGGAAGATGG - Intronic
1000334880 5:160234820-160234842 GCCACTGTGCAGATGGAGGGCGG + Exonic
1000530331 5:162411254-162411276 TCTATTGGGCATATTGAGGAAGG - Intergenic
1003427489 6:6007343-6007365 TCTGTGGTGCTGATGGAGGAGGG - Intronic
1003505045 6:6733895-6733917 CCTATTGTGCAGGATGACGAGGG - Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1006801297 6:36761308-36761330 GCTATTGTGAAGATGGAGTGTGG - Intronic
1008128558 6:47695064-47695086 CATGTGGTGCTGATGGAGGAGGG + Intronic
1008351379 6:50495113-50495135 CCTATTTTGCATATGGATGAAGG + Intergenic
1009270203 6:61604995-61605017 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1011972512 6:93245387-93245409 CCTTTTGTTCAGTTGGAGAATGG - Exonic
1012040354 6:94197115-94197137 GGTGTTGTGCAGATGTAGGATGG + Intergenic
1014049433 6:116934998-116935020 CCTATTTTGGAAATGGAGGGGGG + Intergenic
1014533352 6:122587174-122587196 CCTATTGTGGAGTGGGAGGACGG - Intronic
1014552660 6:122807068-122807090 CCTATTGTAGAGATGGGGGGGGG + Intronic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1016887109 6:148968838-148968860 CCTATTCTTCAAATGGAGGATGG - Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1018882097 6:167894246-167894268 CCTATTCTACAGATGAAGGGAGG - Intronic
1020581428 7:10008037-10008059 CCTACTGTGCAGATAAATGATGG + Intergenic
1021067892 7:16198939-16198961 CCTATTCTGCTGATGGAGTTTGG - Intronic
1022149741 7:27589551-27589573 CCTATTTTACAGATGTAGAAAGG + Intronic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1024816952 7:53282548-53282570 CCTATTGTGGGGTTGGGGGATGG - Intergenic
1026622207 7:71959701-71959723 CCTCTTGTGCTGATGGAGTTGGG - Intronic
1027158285 7:75783982-75784004 CCTATTGTGCGGTTTGAGGCTGG - Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1027623419 7:80520572-80520594 CTTATTGTGCACCTGGTGGAAGG + Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1033464601 7:141579286-141579308 CCTTTTCTGAAGATTGAGGAAGG + Intronic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1036189252 8:6655290-6655312 CCTGTTGTGCGGTTGGGGGAGGG + Intergenic
1040397544 8:47013954-47013976 CCGATTGGGCAGTTGGAGGCTGG + Intergenic
1041088971 8:54284133-54284155 CATATTGTGGAGATGGACGGTGG - Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1043028005 8:75095347-75095369 CCTATTGTTCCTATGAAGGAAGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044846790 8:96389732-96389754 CCTAATGTGAAGATGGGGAAGGG - Intergenic
1044892813 8:96855316-96855338 CCTGTTGTCTAGATGCAGGAAGG - Intronic
1048939011 8:139380634-139380656 CCCATTGTACTGATGGAAGAGGG - Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050463751 9:5898843-5898865 CCCTTTGTGCTGATGCAGGAAGG - Intronic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1055317775 9:75051239-75051261 CCTATTTTACAAATGGTGGATGG - Intergenic
1056363283 9:85880121-85880143 CCTTTTCTGAAGATTGAGGACGG + Intergenic
1056806416 9:89732415-89732437 TTTACTGTGCAGGTGGAGGAAGG + Intergenic
1058428812 9:104900049-104900071 CCCATTGTGCAGACTGAGGGGGG - Intronic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1185859794 X:3566929-3566951 CTTATTGTGCTGACTGAGGAGGG + Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186430222 X:9498742-9498764 CCCATTGGGGACATGGAGGAGGG + Intronic
1189144114 X:38638126-38638148 CCTAACGTGCAGTTGTAGGAAGG - Intronic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1191066358 X:56352328-56352350 CCTATTGTGGGGTGGGAGGAGGG - Intergenic
1191947126 X:66547015-66547037 ACTGTTGTGCAGTTGGGGGAGGG - Intergenic
1193348196 X:80428916-80428938 ACGATTGTGCAGTGGGAGGAAGG + Intronic
1195326443 X:103762342-103762364 CCTTTTCTGAAGATTGAGGATGG + Intergenic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1197450892 X:126615960-126615982 CCTGTTGTGGAGTTGGGGGAGGG + Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic