ID: 1103041711

View in Genome Browser
Species Human (GRCh38)
Location 12:117701219-117701241
Sequence GCATGCCCATAGTCTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103041711 Original CRISPR GCATGCCCATAGTCTCAGCT AGG (reversed) Intronic
902480623 1:16709758-16709780 GCATGCCCATATTGCCAGCCAGG - Intergenic
903461492 1:23524160-23524182 ACTTGCCCATAGTCTCAGAGTGG - Intronic
904111959 1:28133218-28133240 GCATGCCTATAGTCCCAGCTGGG - Intergenic
904643586 1:31948826-31948848 GCATGCCTGTAATCCCAGCTCGG - Intergenic
904747902 1:32722271-32722293 TCATGCCTATAGTCCCAGCGAGG + Intergenic
905073497 1:35248513-35248535 GCGCGCCCGTAGTCCCAGCTAGG - Intergenic
905218781 1:36429641-36429663 GCATGCCTATAGTCCCAGTTAGG - Intronic
906428583 1:45735582-45735604 GCTTGCATATAGTCCCAGCTAGG - Intronic
907055056 1:51358830-51358852 GCATGCCTGTAATCCCAGCTAGG - Intronic
907168806 1:52441403-52441425 GCACGCCTGTAGTCCCAGCTTGG - Intronic
909435771 1:75640238-75640260 ACATGTCTACAGTCTCAGCTTGG + Intergenic
912132790 1:106622314-106622336 GGGTGCCCATAATCCCAGCTGGG + Intergenic
914857663 1:151364410-151364432 ACATTGCCACAGTCTCAGCTTGG + Exonic
915553495 1:156648280-156648302 TCATGACCAAAGTCTCAGCCAGG + Intronic
915989944 1:160503903-160503925 ACATGCCTGTAGTCCCAGCTGGG + Intronic
916758420 1:167795402-167795424 GCATGCCTGTAATCCCAGCTTGG - Intergenic
917365265 1:174224357-174224379 TCCTGCCCAGATTCTCAGCTGGG - Intronic
917408242 1:174732071-174732093 GCGTGCCTGTAGTCCCAGCTTGG + Intronic
917544460 1:175949032-175949054 GTGTGCCCGTAGTCCCAGCTAGG + Intronic
917983749 1:180293868-180293890 GCATGCCTTTAGTCCCAGCTGGG - Intronic
918199769 1:182256102-182256124 GTGTGCCTATAGTCCCAGCTAGG + Intergenic
921052145 1:211518299-211518321 GTATGCCCAGAGGCTGAGCTTGG - Intergenic
921782341 1:219180123-219180145 ACATGCCTGTATTCTCAGCTAGG - Intronic
922618988 1:226979256-226979278 GAATGCCCAAAGCCTCAGCGTGG - Intronic
923170943 1:231416494-231416516 GCGAGCCCATGGTCTCAGGTGGG - Intronic
1066406061 10:35119697-35119719 GCATGTCTGTAGTCCCAGCTAGG - Intergenic
1068213566 10:53952988-53953010 CCAGGTCCACAGTCTCAGCTGGG + Intronic
1069003858 10:63296135-63296157 GCATGCCTGTAATCCCAGCTTGG - Intronic
1069423322 10:68266807-68266829 GCATGCCTGTAATCCCAGCTAGG + Intergenic
1071129283 10:82372720-82372742 GCATGCCTGTAATCTCAGCTAGG - Intronic
1072955373 10:99883532-99883554 GCATACCTGTAGTCCCAGCTAGG + Intronic
1073384010 10:103107546-103107568 GCATGCCTGTTGTCCCAGCTAGG + Intronic
1078316958 11:10302517-10302539 GCATGCCAAGACTCTCAGGTGGG + Intergenic
1079041959 11:17067492-17067514 GAATGTCTGTAGTCTCAGCTGGG + Intergenic
1082106372 11:48226139-48226161 GCATGCCTGTAGTCCCAGCTAGG - Intergenic
1086297105 11:85381951-85381973 TTATGACCATAGACTCAGCTGGG - Intronic
1087108346 11:94434582-94434604 TCATGCCCTTATTCTCAGCTGGG + Intronic
1087399303 11:97644479-97644501 TTATGCCTGTAGTCTCAGCTTGG + Intergenic
1087854995 11:103080881-103080903 ACACGCCCGTAGTCCCAGCTCGG + Intronic
1088313581 11:108485361-108485383 GCATGCCTATAGTCCCAGCTAGG + Intronic
1089392303 11:118110499-118110521 ACATGCCTATAGTCCCAGCTGGG - Intronic
1094157004 12:27347753-27347775 CCATGCCCTTAGGATCAGCTAGG + Intronic
1094168080 12:27463157-27463179 GCATCCTCATAGTCGCATCTTGG - Intergenic
1094323156 12:29207347-29207369 ACATTCCCATAGTATCAGCCAGG - Intronic
1094574308 12:31669978-31670000 GCATGCCTGTAATCCCAGCTGGG - Exonic
1094601791 12:31915411-31915433 GCATGCCTGTAGTCCCAGCTTGG - Intergenic
1094622334 12:32091866-32091888 CCATGCCCATAGCATCAGCTGGG + Intergenic
1094749378 12:33387869-33387891 ACATGCCTATAATCCCAGCTAGG - Intronic
1095663111 12:44761230-44761252 GCATGCCGGTAATCCCAGCTTGG + Intronic
1095761441 12:45842128-45842150 GCATGCGTGTAGTCCCAGCTTGG + Intronic
1096288464 12:50321115-50321137 GCATGCCTGTAATCCCAGCTAGG - Intergenic
1099203118 12:79698545-79698567 GCATGTCCATAGTCTTAACTAGG + Intergenic
1101526841 12:105538766-105538788 GCTGACCCATATTCTCAGCTGGG + Intergenic
1101780961 12:107834955-107834977 AGATGCCCATAGCCTCACCTTGG + Intergenic
1103041711 12:117701219-117701241 GCATGCCCATAGTCTCAGCTAGG - Intronic
1103087705 12:118074210-118074232 GCATGCCTGTAATCCCAGCTCGG - Intronic
1103492598 12:121334152-121334174 GCATGCCTGTAGTCACAGCTAGG + Intronic
1106858196 13:33875424-33875446 GCATGCCCAGAGACCCAGCAGGG + Intronic
1107455266 13:40549227-40549249 GCATGTCTATAGACACAGCTAGG - Intergenic
1108148711 13:47507909-47507931 CTAGGCCCATAGTCACAGCTAGG + Intergenic
1108964176 13:56275838-56275860 TCACCCCCATAGTCCCAGCTAGG + Intergenic
1109196552 13:59383933-59383955 GCATGCCTGTAGTCCCAGCATGG - Intergenic
1115225004 14:31093573-31093595 GCATGCCTGTAGTCCCAGCTCGG - Intronic
1115356306 14:32452144-32452166 GCATGCTTGTAGTCCCAGCTAGG - Intronic
1115785091 14:36816626-36816648 GCATGCCTGTAGTCCCAGCTCGG - Intronic
1116456983 14:45131501-45131523 GCATGCCTGTAGTCCCAGCTCGG + Intronic
1118197209 14:63638325-63638347 GCATGCCCATAGTCCCAGCTAGG + Intronic
1118598347 14:67453387-67453409 GCAGGCCCTCTGTCTCAGCTGGG - Intronic
1121110489 14:91309473-91309495 GCATGCCTGTGGTCCCAGCTAGG + Intronic
1121414979 14:93773284-93773306 ACATGGCCAGAGTCTGAGCTAGG + Intronic
1123939612 15:25210531-25210553 ACATGCACTGAGTCTCAGCTGGG - Intergenic
1125540760 15:40468704-40468726 GCATGCCTATAGTCTCAGTCAGG + Intergenic
1125870303 15:43094301-43094323 GCACGCCTGTAGTCCCAGCTCGG + Intronic
1126058758 15:44758054-44758076 TCATTCCTATAGTCTCACCTAGG - Intronic
1126738858 15:51757934-51757956 ACATACCTGTAGTCTCAGCTGGG + Intronic
1127405223 15:58637328-58637350 GAATGAACATAGTCTCAGTTCGG - Intronic
1127856791 15:62960136-62960158 GCACGGGCATAGTCCCAGCTTGG + Intergenic
1129203312 15:74019208-74019230 GGATGGCCATAGCCTCCGCTGGG - Intronic
1130086727 15:80783951-80783973 GCCTGTCCCTAGACTCAGCTTGG + Intronic
1131126091 15:89858310-89858332 GCACGCCTATAATCCCAGCTAGG + Intronic
1131530281 15:93185093-93185115 GCGTGCCTGTAGTCCCAGCTCGG - Intergenic
1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG + Intronic
1135740521 16:24971453-24971475 GCATGCCCATAATCACAGCAGGG - Intronic
1135747130 16:25026803-25026825 ACATGCATGTAGTCTCAGCTAGG + Intergenic
1136846016 16:33576739-33576761 GCATGCCTATAGTCCCAGGCAGG - Intergenic
1138414371 16:56862983-56863005 GTATACCCAAAGCCTCAGCTGGG + Intergenic
1138678528 16:58668896-58668918 GCATGCCTGTAGTCCTAGCTCGG - Intronic
1139757669 16:69157854-69157876 TCATGCCTATAATCTCAGCTGGG - Intronic
1140417594 16:74787246-74787268 GCAATCCCAGAGTCTCTGCTTGG + Intergenic
1141123556 16:81383059-81383081 TCATGCCTGTAGTCCCAGCTGGG - Exonic
1142203547 16:88772147-88772169 CCATGCCCAGAGTCTCAGGAGGG - Intronic
1203107724 16_KI270728v1_random:1425393-1425415 GCATGCCTATAGTCCCAGGCAGG - Intergenic
1144224511 17:13131862-13131884 ACATGGCCATAGTCTCAGGAAGG - Intergenic
1144630994 17:16872431-16872453 GCCTGCCCATCGTTGCAGCTGGG - Intergenic
1145071616 17:19814538-19814560 GCATACCTGTAGTCTCAGCTTGG - Intronic
1145719199 17:27052762-27052784 ACACGCCTGTAGTCTCAGCTAGG - Intergenic
1145751595 17:27358868-27358890 ACATGCCTGTAGTCTGAGCTGGG - Intergenic
1146773584 17:35591299-35591321 ACATGCCTGTAGTCCCAGCTGGG - Intronic
1148009378 17:44463509-44463531 ACATGCCTGTAGTCCCAGCTTGG - Intronic
1149291717 17:55224224-55224246 ACATGCCTGTAGTCCCAGCTGGG + Intergenic
1149569952 17:57665249-57665271 ACATGCCCTTAATCTCAGCCAGG - Intronic
1149661314 17:58335406-58335428 GCCTACCCACAGCCTCAGCTTGG - Intergenic
1150062417 17:62080115-62080137 GCGTGCCTGTAGTCCCAGCTAGG - Intergenic
1150630807 17:66879153-66879175 GAATGCCCTTAGACTCAGCTGGG + Intronic
1150726555 17:67655812-67655834 GCATGCCTGTAATCCCAGCTAGG + Intronic
1153547130 18:6219465-6219487 CCATGCCCACAGCCACAGCTTGG + Intronic
1153547139 18:6219504-6219526 CCATGCCCACAGCCACAGCTTGG - Intronic
1155032199 18:21994402-21994424 GCCTGCTCATATCCTCAGCTCGG - Intergenic
1155344334 18:24843651-24843673 GCGTGCCTGTAGTCCCAGCTGGG - Intergenic
1156319737 18:36007982-36008004 TCATGCTTATAGTCTCAGCCAGG + Intronic
1158133562 18:54181020-54181042 GCGTGCCTGTAGTCCCAGCTTGG - Intronic
1158227551 18:55216504-55216526 GCATGCTTGTAGTCCCAGCTAGG - Intergenic
1159483558 18:69023660-69023682 ACATGACCATAGTTACAGCTGGG + Intronic
1163759764 19:19129777-19129799 GCACACCCATAATCCCAGCTTGG + Intronic
1164524960 19:29006877-29006899 TCATGCCCATAATCTCAGCACGG - Intergenic
1164987653 19:32660412-32660434 GCATGCCTATAGTCCCAGCTTGG + Intronic
1165035120 19:33027381-33027403 GCATGCCTATAGTCCCAGGCAGG + Intronic
1165605304 19:37098078-37098100 ACATGCCTGTAGTCTCAACTAGG - Intronic
1165948048 19:39457125-39457147 ACTTGCCCACAGACTCAGCTGGG - Intronic
1167177388 19:47874587-47874609 GCATGCCTATGGTCACAACTGGG - Intronic
1167470174 19:49671318-49671340 GCATGCCTGTAATCCCAGCTAGG + Intronic
1168080160 19:54004284-54004306 GCATGCCTGTAATCCCAGCTCGG - Intronic
1168155268 19:54470809-54470831 GCATGCCCGTAGTCTCCTATGGG - Intronic
1168443552 19:56392318-56392340 GCATGCACAAAGCCTCAGTTTGG - Intronic
1202714662 1_KI270714v1_random:35666-35688 GCATGCCCATATTGCCAGCCAGG - Intergenic
925685177 2:6463855-6463877 GCCTTCTCAAAGTCTCAGCTTGG - Intergenic
925874033 2:8296911-8296933 GCCTGGCCCTCGTCTCAGCTTGG - Intergenic
926620087 2:15039717-15039739 GCCTGGCCCCAGTCTCAGCTCGG + Intergenic
926734525 2:16062846-16062868 CCAAGCCCAAAGTCTCATCTGGG + Intergenic
927770325 2:25855538-25855560 GCATGCCTGTAATCTCAACTTGG + Intronic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
929800449 2:45095902-45095924 GTATACCCACAGCCTCAGCTAGG - Intergenic
935678463 2:105616692-105616714 GACTGCCCAGAGTCTCAGCCTGG + Intergenic
936237121 2:110752135-110752157 ACATGCCTGTAGTCCCAGCTAGG - Intronic
938588464 2:132714686-132714708 GCATGCCTCTAATCCCAGCTGGG + Intronic
941363714 2:164584109-164584131 GGATGCCTATAGTCCCAGCTTGG - Intronic
941801571 2:169665427-169665449 GCATGCCTGTAGTTCCAGCTTGG - Intronic
944080148 2:195778506-195778528 ACATGCCTATAGTCCCAGCTAGG + Intronic
945200135 2:207272903-207272925 GCAAACTCATAGTCTTAGCTAGG + Intergenic
945782386 2:214191583-214191605 GCATGCCCCTAATCACAGCTAGG + Intronic
946725808 2:222660097-222660119 GCACGCCTGTAGTCCCAGCTTGG + Intergenic
947196056 2:227568657-227568679 GCATGCCTGTAATCCCAGCTAGG + Intergenic
948889620 2:240900696-240900718 GCAGGCACAGAGTCTCAGCCTGG - Intergenic
1169656878 20:7934077-7934099 ACTTGCCCAAAGTCACAGCTAGG - Intronic
1172112572 20:32555928-32555950 GCATTCACAGGGTCTCAGCTTGG - Intronic
1172606701 20:36218997-36219019 CCATGCCCATATTCTCAGTGTGG - Intronic
1173729687 20:45319547-45319569 ACATGCCCATTGTCTCCTCTAGG + Intergenic
1174326787 20:49785558-49785580 GCATGCCTGTAATCCCAGCTTGG + Intergenic
1178578300 21:33814810-33814832 GCCTGCCCTAGGTCTCAGCTGGG - Intronic
1178855095 21:36244150-36244172 GCGTGCCCATAGTCCCAGCGTGG - Intronic
1180170154 21:46054339-46054361 TCATGCCTATAATCTCAGCACGG - Intergenic
1180564740 22:16653231-16653253 ACATGCCTATAGTCTCAATTAGG + Intergenic
1180792427 22:18583194-18583216 GCATGCCTGTAGTCCCAGCTGGG - Intergenic
1181176085 22:21036932-21036954 CCATCCCTAGAGTCTCAGCTGGG - Intergenic
1181229310 22:21412124-21412146 GCATGCCTGTAGTCCCAGCTGGG + Intergenic
1181249340 22:21522740-21522762 GCATGCCTGTAGTCCCAGCTGGG - Intergenic
1182444004 22:30379879-30379901 CCATGCCCCTCGCCTCAGCTGGG + Intronic
1182550725 22:31099502-31099524 GCATGACCATAGCCTTAGCTGGG + Intronic
1183003281 22:34879423-34879445 GCATGCCTATAGTCCCAGCTAGG - Intergenic
1183515996 22:38266436-38266458 GCTTGCCCAAGGTCACAGCTGGG + Intronic
949429493 3:3959388-3959410 GCATGCCTGTAATCTCAGCTAGG - Intronic
950180001 3:10904734-10904756 GTAGGCCTGTAGTCTCAGCTGGG - Intronic
950472664 3:13196193-13196215 GCCAGCCCATAGTCTCAGCTAGG + Intergenic
954195854 3:48996840-48996862 GCCTGCCCGGAGACTCAGCTTGG + Intronic
954718715 3:52541570-52541592 GCAAGCCCAGAGTCACAGCTGGG + Exonic
955131856 3:56177726-56177748 GCATACCCAAAGTCTCAGGCTGG - Intronic
957019402 3:75108255-75108277 ACATGCCTGTAGTCTCAGCTAGG + Intergenic
960631912 3:119740978-119741000 GCATGCCTGTAGTCCCAGCTTGG - Intronic
962114981 3:132495305-132495327 ACATGCCCATAGTTTCTGCATGG + Intronic
962954223 3:140249336-140249358 GACTGCTCATACTCTCAGCTGGG - Intronic
966181434 3:177192255-177192277 GCATGCCTATAATCCCAGCTAGG + Intronic
966838272 3:184066702-184066724 ACATGCCTGTAATCTCAGCTGGG - Intergenic
968379168 4:74179-74201 GCATACCTGTAGTCCCAGCTGGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968790609 4:2658646-2658668 GCATGCCCGTGGTCTCCTCTGGG + Intronic
969288096 4:6220803-6220825 GCATGCCTGTAGTACCAGCTTGG - Intergenic
969649339 4:8454830-8454852 GCATGCCCTTGATCTCAGCATGG + Intronic
969856503 4:10003985-10004007 GCATGCCAATGGTGTGAGCTTGG - Intronic
972404885 4:38736064-38736086 GCATGCCAATAGGCTCTTCTAGG - Intergenic
973637327 4:52872042-52872064 GCATGCCCGTAATCCCAGGTAGG - Intergenic
976279293 4:83311178-83311200 GCATGCCTGTAGTCTCAGCTTGG + Intronic
980530559 4:134047105-134047127 GCATGGCCATGCTTTCAGCTGGG - Intergenic
981689852 4:147495746-147495768 GCTAGCCCATAGTTTCAGCTGGG + Intronic
983455165 4:167953805-167953827 CCATGTCCAAAGTCTCATCTGGG - Intergenic
983561943 4:169110239-169110261 TCATGCCTTTAGTCCCAGCTGGG + Intronic
986832639 5:11597823-11597845 TCATGCCCATAGTCTCAGTACGG - Intronic
987326702 5:16818560-16818582 ACATGCCTGTAGTCCCAGCTCGG - Intronic
991582130 5:68167291-68167313 GCAGGCTCAAAGTCTGAGCTGGG + Intergenic
991687221 5:69192649-69192671 ACATACCTATAGTCCCAGCTGGG + Intronic
992393128 5:76347568-76347590 GCATGCCTGTAGTCCCAGCTCGG - Intronic
995663025 5:114507148-114507170 GCATGCCTATAATCCCAGCTAGG + Intergenic
996858049 5:128031868-128031890 GGATGCCTGTAGTCCCAGCTAGG + Intergenic
997712269 5:136015669-136015691 GCATGCTCATTCTCTCACCTGGG - Intergenic
998230014 5:140355464-140355486 ACATGCCTGTAGTCTCAGCTAGG - Intergenic
999170052 5:149586385-149586407 GCATGCCTGTAGTCCCAGCTCGG - Intronic
1001706993 5:173748684-173748706 GCATTCCCACAGCCTCAGGTGGG + Intergenic
1003087567 6:3072972-3072994 GAATGCCAACATTCTCAGCTGGG - Intronic
1003195733 6:3912581-3912603 GCATCTCCATAGTCACAGCGAGG + Intergenic
1005831387 6:29673624-29673646 TCCTGTCCATAGTCCCAGCTGGG + Exonic
1006027172 6:31154591-31154613 GCAGGCCCTCAGCCTCAGCTCGG + Exonic
1006518801 6:34559706-34559728 TCATGCCCAAGGTCACAGCTGGG + Intergenic
1008703764 6:54132712-54132734 CAATGTCTATAGTCTCAGCTGGG - Intronic
1009523961 6:64719773-64719795 GCATGCCTATAGTCCCAGAACGG + Intronic
1014451608 6:121588004-121588026 GCATGCCTGTGGTCCCAGCTAGG - Intergenic
1015078637 6:129195532-129195554 AAATTCCCACAGTCTCAGCTAGG + Intronic
1024260178 7:47568393-47568415 GCTTGCCCACCATCTCAGCTTGG - Intronic
1027262883 7:76477586-76477608 GCGTGCCTGTAGTCTCAGCTGGG + Intronic
1027314265 7:76975695-76975717 GCGTGCCTGTAGTCTCAGCTGGG + Intergenic
1027663555 7:81016796-81016818 GCATGCCTGTAGTCCCAGCTCGG - Intergenic
1028544359 7:91981732-91981754 ACATGCCTGTAGTCCCAGCTTGG - Intronic
1029733514 7:102452923-102452945 GCATGCCTGTAGTCCCAGCTTGG - Exonic
1029961549 7:104693267-104693289 CCAAGTCCATAGTCTCATCTGGG - Intronic
1034182495 7:149149038-149149060 GCACGCCTGTAGTCCCAGCTAGG + Intronic
1034557280 7:151858184-151858206 GCTGCCCCACAGTCTCAGCTAGG - Intronic
1038440348 8:27567072-27567094 ACATGCCTGTAGTCCCAGCTTGG + Intergenic
1042849651 8:73203794-73203816 ACATGCCTATAGTCCCAGCTTGG + Intergenic
1043651566 8:82600574-82600596 GCATGTACACAGACTCAGCTGGG - Intergenic
1046683853 8:117202617-117202639 GCATGGCAATAGTAACAGCTAGG + Intergenic
1046689493 8:117267091-117267113 CCATGTCCAAAGTCTCACCTGGG + Intergenic
1048988864 8:139749848-139749870 CCTTGCCCAGAGTCTCAGCAGGG - Intronic
1053431203 9:38042898-38042920 GCATGGCCAGAGACTTAGCTGGG - Intronic
1053480321 9:38412024-38412046 GCATTCCCAATCTCTCAGCTGGG + Intronic
1055545537 9:77369003-77369025 GCATGCCTGTAGTCCCAGCTTGG + Intronic
1055647778 9:78377179-78377201 GTATGCCTGTAGTCCCAGCTAGG + Intergenic
1056713972 9:89013489-89013511 GCCTGCCCATTGTCTCTGCAGGG - Exonic
1059131714 9:111758465-111758487 GCACGCCTGTAGTCTCAGCAAGG + Intronic
1059180287 9:112205888-112205910 GAATGCCCAGAGTCTGGGCTTGG - Intergenic
1060207452 9:121690587-121690609 GCATTCCCAAGGTCTCAGCTTGG - Intronic
1060571135 9:124641569-124641591 GCATGCCTGTAGTCCCAGCTTGG + Intronic
1062692939 9:137854101-137854123 GCATACCCATAGTCCCAGGGAGG - Intronic
1185989145 X:4873411-4873433 GCATGCCTGTAATCCCAGCTCGG - Intergenic
1187289965 X:17943421-17943443 GCATGCCCGTTGTCTCACCATGG - Intergenic
1187907905 X:24084444-24084466 GCATGCCTGTAGTCCCAGCTTGG + Intergenic
1189505514 X:41609685-41609707 GCATGCCTGTAGTCCCAGTTAGG - Intronic
1193128267 X:77892666-77892688 ACATGCCTGTAGTCCCAGCTGGG + Intronic
1194732147 X:97467756-97467778 GTATCCCCATGGTCTCTGCTAGG - Intronic
1198442166 X:136673716-136673738 GCATGCCCAAAGCCACAGCCAGG + Intronic
1198920651 X:141722225-141722247 ACATGGCCATAGTCACAGGTGGG + Intergenic
1201255986 Y:12108707-12108729 GGATGCCCAGAGTCCCACCTGGG - Intergenic