ID: 1103043635

View in Genome Browser
Species Human (GRCh38)
Location 12:117717111-117717133
Sequence CCACTCTCCCAGCCCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103043631_1103043635 6 Left 1103043631 12:117717082-117717104 CCTGAAGTTCACCAAAGTTGGTG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG 0: 1
1: 0
2: 0
3: 30
4: 307
1103043632_1103043635 -5 Left 1103043632 12:117717093-117717115 CCAAAGTTGGTGTGTGATCCACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG 0: 1
1: 0
2: 0
3: 30
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103043635 Original CRISPR CCACTCTCCCAGCCCACCTT GGG Intronic
900432049 1:2607089-2607111 TCACTCTCCCAGCCTCCCTGTGG + Intronic
900592287 1:3465442-3465464 GGACTCCCCCAGCCCCCCTTCGG - Intronic
903795040 1:25922566-25922588 CTGCTCTCCCACCCCACCTGCGG + Intergenic
905313709 1:37067907-37067929 CCACTCTGCCAGGCCTTCTTCGG + Intergenic
906059028 1:42936438-42936460 CCAATCTCCCAGCTCACCCTGGG - Intronic
906258159 1:44366459-44366481 CCTCTATGCCAGCCCACCTCAGG - Intergenic
907272168 1:53297552-53297574 CCACCTTCCCATCCCACCTGGGG + Intronic
908257511 1:62315125-62315147 CCAATCTCCCAGACCAAGTTTGG - Intronic
911728433 1:101266774-101266796 CCACTCTCTCACCTCAACTTGGG + Intergenic
914747817 1:150512423-150512445 CCACCCTCCCAGCCCTACTCGGG + Exonic
914764310 1:150624511-150624533 CCACTTTCCCAGCCTACCTCTGG - Intronic
916498940 1:165369903-165369925 CCACTCTTCCAGCTGACCTCAGG + Intergenic
917054861 1:170969966-170969988 CTCCTCTCTCAGCCTACCTTGGG + Intronic
917724915 1:177819135-177819157 CCCCTCTCCCTACCCACCTAGGG - Intergenic
917785781 1:178456155-178456177 CCACTATCCCAGTCAATCTTGGG - Intronic
918092693 1:181311018-181311040 CCTCTCTAACAGCCCACCTGAGG - Intergenic
918341333 1:183570266-183570288 CACCTCTCCAAGCCCAGCTTGGG + Intronic
918532908 1:185542600-185542622 TCGCTGTCCCAGCCCACCCTTGG + Intergenic
919465662 1:197919867-197919889 CCGCTCTCCCTGCACACCCTGGG + Intronic
919567360 1:199205664-199205686 CTACTCTCCAAGGCCACCATAGG + Intergenic
920692247 1:208155721-208155743 CCACCCTCCCTGCCCAGCTCTGG + Intronic
921670514 1:217919165-217919187 CCCCTGTCCCACCCCACTTTGGG + Intergenic
922409926 1:225362763-225362785 CCACTCTACCAGTCCACAGTAGG + Intronic
923462079 1:234216306-234216328 GGAAACTCCCAGCCCACCTTAGG + Intronic
1064252782 10:13719520-13719542 CAACTCTGCCTGCCCGCCTTGGG - Intronic
1064605031 10:17030276-17030298 CCACCCTCCCACCCCACCCCCGG + Intronic
1065068314 10:21996581-21996603 CCACTTTCCCAGTTCAACTTAGG + Intronic
1068866930 10:61903898-61903920 CCACCCTCCCCGGCCAGCTTTGG + Intronic
1069610986 10:69772421-69772443 CACCTCTCCCAGCCTACCTCTGG + Intergenic
1071522006 10:86337292-86337314 CCACTCTCCCAGGCAGCCTTTGG - Intronic
1071530840 10:86389611-86389633 GCACTGGCCCCGCCCACCTTGGG - Intergenic
1072201297 10:93161274-93161296 TTACTCTCTCTGCCCACCTTTGG - Intergenic
1072623527 10:97096426-97096448 CCACTCTCTGAGCGCACCTCTGG + Intronic
1072809486 10:98447643-98447665 CACCCCTTCCAGCCCACCTTAGG + Intergenic
1072914712 10:99530816-99530838 CCACTTCCCCACCCCACCTCCGG - Intergenic
1074560316 10:114529736-114529758 CACCACGCCCAGCCCACCTTCGG - Intronic
1075277674 10:121109386-121109408 TCACCCTCCCCACCCACCTTGGG + Intergenic
1076096825 10:127739166-127739188 CCCCTCACCCAGGCGACCTTCGG + Exonic
1076103691 10:127803417-127803439 CCACCACCCCAGCCCACCTCTGG - Intergenic
1076482499 10:130793807-130793829 CCACTCTCCAGTTCCACCTTAGG + Intergenic
1077212932 11:1381891-1381913 TCACTCTGCAAGCCCTCCTTGGG + Intergenic
1078143410 11:8707532-8707554 CCCCTGTCACAGCCCACCCTGGG - Intronic
1080948228 11:36998844-36998866 CCACTGCCCCTGCCAACCTTTGG + Intergenic
1081576144 11:44319616-44319638 CCTCTCTCCCACCCCTCCTGAGG + Intergenic
1081711114 11:45216077-45216099 CCAACCTCCCAGCTGACCTTGGG - Intronic
1081925972 11:46828844-46828866 CCACACCCCCACCCCATCTTTGG - Intronic
1083540844 11:63510671-63510693 CCCCTCTCCAGGCCCAGCTTGGG + Intronic
1083663529 11:64262965-64262987 TCAGTCTCCCTGCCCTCCTTAGG + Intronic
1084238312 11:67802339-67802361 CCACCCACCCAGCCCATCCTAGG - Intergenic
1084661786 11:70550395-70550417 CCCCTGCCCCAGCCCACCTGGGG - Intronic
1084834100 11:71790493-71790515 CCACCCACCCAGCCCATCCTAGG + Intronic
1085024692 11:73229622-73229644 CCACCCTCCCAGGCCAGCTGGGG - Intronic
1085500878 11:77022385-77022407 CCAGTCTTACAGCTCACCTTGGG - Exonic
1085931157 11:81085626-81085648 CCACTCACCAAGTCCACTTTTGG + Intergenic
1086144083 11:83531977-83531999 CCACCCTCCCACCCCAACATAGG - Intronic
1088603529 11:111506476-111506498 CAACCCTCCCCACCCACCTTTGG - Intronic
1089443175 11:118532471-118532493 CCTATCTCCCTGCCCACCTCAGG - Intronic
1089462712 11:118662287-118662309 TCACCCACCCAGCCCACCCTGGG - Intronic
1089615240 11:119691394-119691416 CCACTTTCCCCGCCCACCTCAGG - Intronic
1090356534 11:126144245-126144267 CCTCTTTCCCAGCCCAGCTTTGG - Intergenic
1090744779 11:129696841-129696863 CCACTCTCCAATCCCACATTTGG + Intergenic
1091256058 11:134187090-134187112 CCAGCCTCCCAGCCCAGCTGAGG + Intronic
1091840873 12:3619671-3619693 CCCCTCATCCAGCACACCTTGGG - Intronic
1092408996 12:8239971-8239993 CCACCCACCCAGCCCATCCTAGG - Intergenic
1095214780 12:39535181-39535203 CCACTCTCCCTGACCACATTTGG + Intergenic
1096442191 12:51652696-51652718 CCACCCTACCAGCCCATCTGTGG + Intronic
1097999426 12:65924067-65924089 ACCCACCCCCAGCCCACCTTGGG + Intronic
1101606220 12:106248624-106248646 TCACTCTCCCAGCCCGCCATGGG + Intronic
1101708573 12:107243587-107243609 CGACACTCCCAGCCCAGCTGGGG + Intergenic
1101758940 12:107643499-107643521 CAACTCCCCAGGCCCACCTTGGG - Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG + Intronic
1103241058 12:119413766-119413788 CTGCTCCCCCAGCCCACCTTGGG + Intronic
1104894229 12:132153957-132153979 CCCCCCTCCCCGCCCTCCTTGGG + Intergenic
1104982649 12:132581191-132581213 CCTCCCTCCCTGCCCCCCTTGGG + Intronic
1105013666 12:132773105-132773127 TCACTCTCCCGGCCCTTCTTTGG + Exonic
1105303157 13:19152767-19152789 CCACCCCCACAGGCCACCTTGGG + Intergenic
1105303802 13:19155723-19155745 ACACCCACACAGCCCACCTTGGG + Intergenic
1106342971 13:28848784-28848806 CCACTCTCCCAGTGGACATTTGG + Intronic
1106503568 13:30352471-30352493 CCACTGTCCCTGCCCAGCCTCGG + Intergenic
1110576747 13:77065543-77065565 CCACACTCCCAGATCTCCTTTGG + Intronic
1111530838 13:89536183-89536205 CCATTCTTCATGCCCACCTTAGG + Intergenic
1112339962 13:98544590-98544612 CCACCCTCCAAGCCGACCTGAGG + Intronic
1112996375 13:105579297-105579319 CCCCTCTGACAGGCCACCTTGGG + Intergenic
1114069532 14:19096579-19096601 ACACACTCCCACCCTACCTTAGG - Intergenic
1114080928 14:19200949-19200971 CCACTCTGCCAGTCCCCCTGAGG - Intergenic
1114092730 14:19303424-19303446 ACACACTCCCACCCTACCTTAGG + Intergenic
1114189464 14:20429736-20429758 TTTCTCTCCCTGCCCACCTTAGG + Intronic
1114497475 14:23143002-23143024 ACACCCTCTCAGCCCAGCTTTGG - Intronic
1117344314 14:54817873-54817895 TCACTCTCCCAACCCATCTCAGG + Intergenic
1117434622 14:55704050-55704072 CGACTCTCCCTGCAGACCTTGGG + Intergenic
1117521187 14:56552859-56552881 CCTCTCTCCCTGCCATCCTTAGG + Intronic
1117911831 14:60644026-60644048 CCACTCTCCCAGCTCCGCCTGGG - Exonic
1118721972 14:68600756-68600778 TCACTCTCCCAGCCTCCTTTAGG + Intronic
1118722073 14:68601444-68601466 GCACTCTCCCAGCCCCCTTTAGG - Intronic
1118726331 14:68631662-68631684 CCACTGTCCCAGCTCTCCCTGGG + Intronic
1120299751 14:82691571-82691593 CCACTTTCCCAGCCTACCTCTGG - Intergenic
1121572973 14:94961601-94961623 ACACTCTCCCATTCCCCCTTAGG + Intergenic
1121935302 14:98013000-98013022 CCCCTCTCCCCACCCACTTTTGG + Intergenic
1123673926 15:22689842-22689864 CTGCTCTCCCATCCCACCCTTGG + Intergenic
1124071025 15:26393340-26393362 CCACACTCCCACCCCACCAGTGG - Intergenic
1124325932 15:28762830-28762852 CTGCTCTCCCATCCCACCTTTGG + Intergenic
1127475447 15:59328211-59328233 CCACTCTCACATTCTACCTTTGG - Intronic
1127768286 15:62209209-62209231 GCTCTCTCCAAGCCCACCTGTGG + Intergenic
1128382761 15:67125489-67125511 CCACTCTTGTAGCCCACCGTGGG + Intronic
1131131500 15:89903529-89903551 CGACTCTCCCACCATACCTTGGG - Intronic
1131880076 15:96852864-96852886 CCTCTTTCCCAGCCCAGCCTGGG - Intergenic
1132149321 15:99448154-99448176 CCACACTCCCCACCCAGCTTGGG + Intergenic
1133349966 16:5094781-5094803 CCACCCACCCAGCCCATCCTAGG - Intronic
1135296921 16:21287716-21287738 CCACCCTCCCAGCACACCGATGG - Intronic
1135336799 16:21608501-21608523 CCACTATCCCAGCCTAACTATGG - Intronic
1135565051 16:23505637-23505659 CCATTCACCCTCCCCACCTTTGG + Intronic
1135671512 16:24379670-24379692 CCCCACTCCAAGCCTACCTTAGG + Intergenic
1136654719 16:31703005-31703027 CCACAGTCCCAGCTCACCCTCGG - Intergenic
1137565136 16:49528065-49528087 CCTCTCTCCCTGCCCAGCTAGGG + Intronic
1138299692 16:55915655-55915677 TCACTCCCCCAGGCGACCTTGGG + Intronic
1138362862 16:56447060-56447082 CCCCTCACCCTCCCCACCTTTGG + Intronic
1140361998 16:74352415-74352437 CCACTCTCCCGTCCTACATTTGG - Intergenic
1140884335 16:79229538-79229560 CCCCGCTCACAGCCCATCTTCGG - Intergenic
1141619895 16:85231640-85231662 CCCCTCTCCCTGCCTTCCTTAGG + Intergenic
1142131615 16:88433895-88433917 CTGCCCCCCCAGCCCACCTTGGG - Exonic
1142178640 16:88656615-88656637 CCACCCTCAAAGCCCAGCTTGGG - Intronic
1142230815 16:88899500-88899522 CTCCACTCCCAGCCCGCCTTGGG - Intronic
1142557564 17:790196-790218 CCACTCTCCCAGCCCGCCCGTGG + Intronic
1142574951 17:900555-900577 CCACCCTCCCTTCCCACCCTGGG - Intronic
1143028956 17:3956839-3956861 CCTCTCACCCCGCCCACCTGGGG + Intronic
1143239325 17:5430551-5430573 CCCCTCTGCCAGCCCTCATTAGG - Intronic
1143579401 17:7816879-7816901 CCCCTCCCCCTGCACACCTTTGG + Intronic
1145999214 17:29121430-29121452 CCACTCTCACAGTTGACCTTGGG - Intronic
1146915061 17:36673108-36673130 CCACTCCTCCAGGCCACCCTGGG - Intergenic
1147358784 17:39918336-39918358 CCACTTCCCCATCCTACCTTTGG + Intronic
1147926324 17:43948218-43948240 CCTCTCTCCCTGTCCGCCTTGGG + Intergenic
1148611008 17:48964612-48964634 CCACTCCCCCACCCCACCCCAGG + Intronic
1148809118 17:50279124-50279146 CCACTCCCCCATCCCAGCTGAGG - Intronic
1148862598 17:50612461-50612483 CCACTCTCCTTGGCCACCTGTGG + Intronic
1151578486 17:74964428-74964450 CCACCCTCCCAGCCCACAGCAGG - Intronic
1151810938 17:76441446-76441468 CCCCTCCTGCAGCCCACCTTTGG + Intronic
1152244010 17:79175916-79175938 CCACTCTCTCTGACCACCTGGGG + Intronic
1152260328 17:79263274-79263296 CCTCTCTCCCGGCCCAGCATTGG + Intronic
1152531102 17:80919767-80919789 CCACTCCCCAAGCCAACCTTCGG - Intronic
1152741001 17:82018287-82018309 CCACGCCCCCTGCCCACCCTTGG - Intergenic
1153140920 18:1971649-1971671 CCACTGTCCCAGGCCAACTGGGG + Intergenic
1153748224 18:8202258-8202280 CCATTTTCCCAGCCCTCCCTTGG + Intronic
1155054533 18:22171936-22171958 CTACTCTCCCAGCCCGCCCATGG + Exonic
1155235083 18:23810971-23810993 CCTCTCTCCCTGCCCTCCTCTGG + Intronic
1155500472 18:26482396-26482418 CCTCTTTCCCATCCCTCCTTAGG - Intronic
1157438601 18:47692374-47692396 CCCCTTTCCCAGCCAACCTGGGG + Intergenic
1160973386 19:1780282-1780304 CCTCCCTCCCAGCCCACTTTCGG + Exonic
1161209895 19:3061143-3061165 CCAGTCCCCCAGCTCACCTGTGG + Exonic
1161219290 19:3110644-3110666 CCACTCGCCCAGGTCGCCTTGGG + Intronic
1161609247 19:5231782-5231804 CCACCCGCCCATCCCACCTTTGG - Intronic
1162531362 19:11238105-11238127 CCACTCTCCCAGGTCATCTTTGG - Exonic
1162644153 19:12036198-12036220 CCACCCCCCCAGCCCACCGCCGG - Intronic
1163127234 19:15250919-15250941 CCACTCTCCCACCACCCCTAGGG - Intronic
1163374751 19:16923163-16923185 CCACACTCCCAGCCCAGCCTTGG - Intronic
1163406492 19:17126232-17126254 CTTCTCACCCAGCCCTCCTTGGG + Intronic
1163864680 19:19762856-19762878 CACCTCTCCCAGCCTACCCTTGG - Intergenic
1164721837 19:30438244-30438266 CCTCTCTCCCTCCCCACTTTTGG + Intronic
1165780825 19:38433522-38433544 TCTCTCTCCCACCCCACCTCCGG + Intergenic
1166301437 19:41913907-41913929 CCACCCTCACACCCCACCTCTGG + Intronic
1167127196 19:47557978-47558000 CCACTCCCCCTGCCCATTTTGGG - Intergenic
1167349235 19:48964498-48964520 CCAAAGTCCCAGCCCATCTTTGG + Intergenic
1167419320 19:49394004-49394026 CCGGTCTCCCAGCCCACCCTGGG - Intronic
1168102733 19:54149581-54149603 CCACGCCCCCAGCCCCCGTTGGG - Exonic
925076347 2:1019456-1019478 CCACATTCCCAGCACACCTATGG - Intronic
925173827 2:1768562-1768584 CCACTGTGCCCGCCCACCCTGGG - Intergenic
927491370 2:23523218-23523240 CCTCTGCCCCAGCCCACCCTGGG - Intronic
929084465 2:38154753-38154775 CCTCTTGCCCAGCCCAGCTTGGG - Intergenic
929218997 2:39444043-39444065 CCACCCTCCCAGCCAAACCTTGG - Intergenic
929488760 2:42378149-42378171 CCATTTTCCCAGCCCCCCTTAGG + Intronic
931580833 2:63771695-63771717 TCACTCTCCCTGCCCTCTTTTGG + Intronic
932624917 2:73289937-73289959 CCACTCTTTCTGGCCACCTTGGG - Intergenic
933836686 2:86251547-86251569 CGACTCTCCCAGTGCACCCTAGG + Intronic
934686393 2:96325184-96325206 CCACTCTCCCAGCAAACCCACGG + Intergenic
935889612 2:107662105-107662127 CCACCCTCCCACCCCTCTTTGGG - Intergenic
938140832 2:128793570-128793592 CCACTGTCTCAGCCCAGCGTGGG + Intergenic
938498699 2:131818540-131818562 CCACTCTGCCAGTCCCCCTGAGG + Intergenic
938695356 2:133830186-133830208 GCACTCTCCCACGCCTCCTTGGG - Intergenic
941810505 2:169751107-169751129 CCAGCCACCCAGGCCACCTTTGG - Exonic
942317564 2:174709652-174709674 CCCCCCTCCCCGCCCACCATGGG - Intergenic
942838985 2:180336945-180336967 CCACTCTCCCCTCCCAGCTGGGG + Intergenic
947584782 2:231347824-231347846 CCTCTCTCCCTGCCTGCCTTTGG + Intronic
948615178 2:239193764-239193786 CCACTCGGCCAGCCAACCTTGGG - Intronic
949021954 2:241745951-241745973 CCTCTCTCCTGGCCCCCCTTGGG + Intronic
1168831405 20:847050-847072 CCCCTCTCCACGCCCACCGTGGG - Intronic
1170759779 20:19239405-19239427 CCCATCTCCTAGCCCACCTGTGG - Intronic
1170801852 20:19596906-19596928 CCCCTTTCCCCGCCCATCTTAGG + Intronic
1170833972 20:19868082-19868104 CCACACTCACAGGCCTCCTTGGG - Intergenic
1171243204 20:23587814-23587836 CCACCCTCCCAGCACATCTATGG - Intergenic
1172113921 20:32562876-32562898 CCACCCTCCCTGCCCTCCTTAGG - Intronic
1172119274 20:32588277-32588299 CCACTCTCCCAGGAGCCCTTGGG - Intronic
1172846440 20:37932249-37932271 CCAGGCTCCCAGCACACCCTTGG + Intronic
1173564159 20:44027441-44027463 CCACTGCCCCATCCCAGCTTAGG + Intronic
1175486903 20:59353401-59353423 CCACTCTCCCCACCCAGCTGTGG + Intergenic
1175794060 20:61760368-61760390 CCCCTCTCCCCGCGCACCTGTGG - Intronic
1176100537 20:63362411-63362433 CCCCCCTCCCTGCCCACCTCTGG + Intronic
1177492751 21:21848634-21848656 CATCTCTCCCAGCCCCACTTGGG - Intergenic
1178495198 21:33080456-33080478 CCACTGTCCCTGCACACCCTTGG + Intergenic
1179106761 21:38408196-38408218 CCACTCTCCCAGACCCACTCCGG + Intronic
1180102341 21:45594796-45594818 CCAAGCTCCCACCCCACCCTGGG + Intergenic
1180487999 22:15819142-15819164 ACACACTCCCACCCTACCTTAGG - Intergenic
1180499844 22:15921736-15921758 CCACTCTGCCAGTCCCCCTGAGG + Intergenic
1180626817 22:17199168-17199190 CCCGTCCCCCAGCCAACCTTTGG - Intronic
1181038615 22:20181644-20181666 CCACTGCCCATGCCCACCTTGGG + Intergenic
1181749275 22:24977561-24977583 CACCTCCCCCAGCCCACCCTGGG + Intronic
1183006898 22:34911050-34911072 CCACTCTCACCACCCACCTAAGG + Intergenic
1183400532 22:37601270-37601292 CATCTCCCCCAACCCACCTTTGG + Intergenic
1183618990 22:38961847-38961869 CCACTCTCCCTGCCCTCCCTGGG - Intronic
1184117580 22:42431251-42431273 CCACCCTCACAGCACCCCTTGGG - Intronic
1184649530 22:45913220-45913242 CCCCTCCCCCTGCCCGCCTTGGG - Intergenic
1185063053 22:48616992-48617014 CCACGCTCCCAGCCCAGCCCTGG - Intronic
950565674 3:13768298-13768320 CCCCTCCCCCAGCCCAGCTGGGG - Intergenic
950613439 3:14140433-14140455 CAACTCTCCCCACCCACCCTGGG - Intronic
951203951 3:19905916-19905938 CCAGTCTCCCAGCTCACATGGGG - Intronic
953734189 3:45477312-45477334 GCACTCTCCAAGTCCCCCTTCGG - Intronic
954764134 3:52898375-52898397 CCATTCTCCCAGCCCAATCTGGG + Intergenic
954764150 3:52898495-52898517 CCATTCTCCCAGCCCAATCTGGG + Intergenic
954764166 3:52898615-52898637 CCATTCTCCCAGCCCAATCTGGG + Intergenic
957054266 3:75432137-75432159 CCACCCACCCAGCCCATCCTAGG - Intergenic
958846345 3:99269540-99269562 CCACTCTCCCATCCCAGCTCTGG - Intergenic
961887927 3:130108512-130108534 CCACCCACCCAGCCCATCCTAGG - Intronic
962425975 3:135269806-135269828 CCACCCCTCCAGTCCACCTTAGG - Intergenic
962732994 3:138300066-138300088 CCAGACTCACAGCCCACCATGGG - Intronic
964621444 3:158723641-158723663 CCTCTCTCTCAGCCAACCCTGGG + Intronic
965432358 3:168605380-168605402 GACCTCTCCCAGTCCACCTTTGG - Intergenic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
968657824 4:1786193-1786215 CCACCCTCCCTGACCACCTGTGG - Intergenic
968683472 4:1938573-1938595 CCACCCACCCAGCCCAGCCTGGG - Intronic
969040010 4:4288853-4288875 CCACTCAAACAGCCCACCTGAGG + Intronic
969111926 4:4849665-4849687 CCACTCCCACAGCCCAGCTCTGG + Intergenic
969176416 4:5402365-5402387 CTTCTCTCCTTGCCCACCTTTGG - Intronic
969298372 4:6282646-6282668 CCCTGCTCCCAGCCCACTTTGGG + Intronic
969533538 4:7742067-7742089 CCACCCTACCTGCCCACCTGGGG + Exonic
969689098 4:8694525-8694547 CCACTCTTCCTGCTCACCTGGGG - Intergenic
969816904 4:9693810-9693832 CCACCCACCCAGCCCATCCTAGG + Intergenic
969845839 4:9919491-9919513 ACACCCTCCCTGCCCGCCTTGGG + Intronic
972624619 4:40784624-40784646 TCATTCTCCCAGCCCATCTCAGG - Intronic
972762127 4:42117165-42117187 ACACTACCCCAGCCTACCTTGGG + Exonic
973257747 4:48129966-48129988 CCACACTCCCTGCCCACCGAGGG - Intronic
973314621 4:48747081-48747103 CCAATCTCCCAGCCCATTGTAGG - Intronic
976356722 4:84127204-84127226 CCCCTCCCCCAGCCCTCCTGGGG - Intergenic
976524925 4:86075980-86076002 CCCCTCCCCCAGCCCTCCTGGGG + Intronic
978247298 4:106589312-106589334 CCACTCCCCAACCCCACCTCTGG - Intergenic
978522578 4:109631969-109631991 CCCCTTTCACAGCCCACCTCTGG + Intronic
979638660 4:122986118-122986140 GCACTCTCTCAGACCACCATGGG - Intronic
980969751 4:139557014-139557036 CCCCACTCCCCGCCCTCCTTCGG + Intronic
981966859 4:150614217-150614239 CAACTCTCCCAGCTCAGCTTAGG + Intronic
982746763 4:159111984-159112006 TCACTCCCCCACCCCACCTCTGG + Intronic
983539961 4:168898709-168898731 TCCATCTCCCAGCTCACCTTTGG - Exonic
985517875 5:356400-356422 CCACCCTCCCAGAACTCCTTGGG + Intronic
985744139 5:1637036-1637058 CCACTCTTCCAGCCAAGCCTTGG + Intergenic
985851454 5:2391726-2391748 CCAGTCTCCCAGCCCGCCCCAGG + Intergenic
986643204 5:9891983-9892005 CCTCCCTCATAGCCCACCTTAGG + Intergenic
994243144 5:97447815-97447837 TCACTCACCCAGGCCACCTCTGG + Intergenic
994479976 5:100322440-100322462 TCAACCTCCCAGCCCACCTCTGG + Intergenic
996711437 5:126547303-126547325 ACTCCCTCCCTGCCCACCTTGGG - Intronic
998377727 5:141702389-141702411 CCACTCCCCGCCCCCACCTTTGG + Intergenic
999153834 5:149443979-149444001 GCCCTCTCACAGCCCGCCTTGGG - Intergenic
999621998 5:153483175-153483197 CCACTCACACAGCCGAGCTTGGG + Intergenic
999771906 5:154782443-154782465 CCACTCTCCCCGCCCAGATGTGG - Intronic
1001669732 5:173463710-173463732 CCACAAGCCCACCCCACCTTGGG + Intergenic
1002695493 5:181085710-181085732 CTGGTCTCCCAGCCCACCTCAGG + Intergenic
1003577909 6:7314559-7314581 CCACTCTGCCAGGCCACCAGTGG + Intronic
1006930621 6:37685865-37685887 CCACTCTGCCAGCCTAGCTCAGG - Intronic
1007418347 6:41705184-41705206 CCACACTCCCAGGCCTCCTGCGG - Intronic
1011253739 6:85400436-85400458 CCACTCACACAGCCCACATCCGG + Intergenic
1015856995 6:137635501-137635523 CCACACCCCGAGCCCACCCTGGG - Intergenic
1019383829 7:742107-742129 CCACGCCGCCGGCCCACCTTGGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020005861 7:4783523-4783545 CCACACTCCCAACCCACCATGGG - Intronic
1020255670 7:6501972-6501994 CCACCCACCCAGCATACCTTTGG + Exonic
1021921606 7:25490823-25490845 TCATTCTCTCAGCCTACCTTCGG + Intergenic
1022452373 7:30526474-30526496 CCACTGTCCCTGCCCACTCTGGG + Intronic
1023986728 7:45101404-45101426 CCACTCTCCCAGCCCCTCGGAGG + Intronic
1024084288 7:45880865-45880887 CCACTCACCCAGCCCATAATAGG - Intergenic
1026178280 7:68016660-68016682 CCAATCTCCCACCCAACTTTTGG + Intergenic
1026824366 7:73572159-73572181 CCACTGTGCCAAGCCACCTTTGG - Intronic
1028422890 7:90653188-90653210 CCACTCCCCCAGCCCCACTTAGG + Intronic
1028563868 7:92206023-92206045 CTTCTCTCCAAGCCCACCTCTGG - Intronic
1032989894 7:137381968-137381990 CCACTCTCCCCACCCATCATTGG - Intronic
1033639357 7:143246304-143246326 CCACTCTCACTGCCAGCCTTAGG + Intronic
1034244358 7:149633469-149633491 TCACTCTCCCAGCCCCTTTTAGG + Intergenic
1034732334 7:153398986-153399008 TACCTCTCCCAGCCCACCATGGG - Intergenic
1036380172 8:8231550-8231572 CCACCCACCCAGCCCATCCTAGG + Intergenic
1036849389 8:12191112-12191134 CCACCCACCCAGCCCATCCTAGG - Intronic
1036870749 8:12433385-12433407 CCACCCACCCAGCCCATCCTAGG - Intronic
1037457964 8:19082682-19082704 CCACTCTCCCCTCCCGCCTTCGG - Intronic
1039050021 8:33484664-33484686 CCACTCCCCACGCCCACGTTGGG - Intronic
1041094525 8:54335852-54335874 CCTCTCTCCCAGTCCACTCTTGG - Intergenic
1041696854 8:60744928-60744950 CCACTCCCTCAGCCCAGCTTAGG - Intronic
1044447955 8:92300409-92300431 GCACTCACCCTGCCCTCCTTTGG + Intergenic
1045035442 8:98173198-98173220 CCACTTTCCAAGACCTCCTTTGG - Intergenic
1046496198 8:115017263-115017285 CCTCTCTGCCAGCTCACTTTTGG + Intergenic
1047201335 8:122770198-122770220 CCACTGTCCCACCCCTCCTAAGG - Intergenic
1049180132 8:141217962-141217984 CCGCTCTCTCTGCCCACCTGCGG - Intronic
1049310566 8:141931679-141931701 CCACCTTCCCTGCCCACCATTGG + Intergenic
1049425268 8:142535358-142535380 CCTCTGTCCCCGCCCACCATAGG - Intronic
1049725597 8:144144271-144144293 CCTCTGGCTCAGCCCACCTTAGG - Intergenic
1049761964 8:144335857-144335879 ACACTCTCCCTGCCCAGCCTTGG + Intronic
1049812833 8:144583150-144583172 CCTCCCTCCCAGCCCACAGTGGG + Intronic
1050141765 9:2523503-2523525 CCTCTCTCCCTCCCCACTTTTGG + Intergenic
1052337891 9:27338279-27338301 CCTCTTTCCCAGCCCTGCTTGGG + Intronic
1052371806 9:27674133-27674155 TCTCTCTCCCTGCCCTCCTTTGG + Intergenic
1052391286 9:27881418-27881440 CCACTCTCTTAGAGCACCTTGGG + Intergenic
1052443801 9:28533059-28533081 TGCCTCTCCCAGTCCACCTTTGG - Intronic
1052497236 9:29242817-29242839 CCTCTCTCCCACCCCATCTAGGG - Intergenic
1053055681 9:34991878-34991900 CCATTGTCCCTGCCCACCTAGGG + Intronic
1053452481 9:38204559-38204581 CCACTCTCCCCACCCACCCCTGG + Intergenic
1053852840 9:42307239-42307261 TGACTCTCCCAGCACACCTCTGG + Intergenic
1054571198 9:66812763-66812785 TGACTCTCCCAGCACACCTCTGG - Intergenic
1056280757 9:85039086-85039108 CCACCCTCCCACCCAACCCTTGG - Intergenic
1056327368 9:85490982-85491004 TCATTCTCCAAGCCCACCTGGGG + Intergenic
1058259688 9:102813534-102813556 ACACTCTCCCAGCTCATCTCAGG + Intergenic
1058263817 9:102872983-102873005 CCACTCTCCAATCACACTTTAGG - Intergenic
1058721619 9:107769457-107769479 CTACTCTCCCAGCCTCCTTTTGG + Intergenic
1059336045 9:113569063-113569085 CCCCTCTCCCTGCCCTCCATGGG + Intronic
1060896595 9:127222409-127222431 CTACTCTCTCATTCCACCTTTGG - Exonic
1061043822 9:128153854-128153876 CCCCTCTGCCAGCCCACTGTGGG + Intergenic
1061065679 9:128276202-128276224 CCGCTGTCCCCGCCCACCTCGGG + Exonic
1061090223 9:128421805-128421827 CCACCCCCCCAGCCCAACTGTGG - Intronic
1061431530 9:130534346-130534368 CCTCTCTCTCTGCCCACCTGGGG + Intergenic
1062145889 9:134989470-134989492 CCACCCTCCCAGCCCAGTTCCGG - Intergenic
1062322435 9:135996968-135996990 CCACTCGACCCGCCCATCTTGGG + Intergenic
1062556419 9:137115062-137115084 CCACTCTCCCGGCCCTGCCTTGG - Intronic
1186240298 X:7558367-7558389 CTTCACTCCCAGCTCACCTTTGG - Intergenic
1189537873 X:41955229-41955251 CCAGGATCCCACCCCACCTTGGG - Intergenic
1189836502 X:45028778-45028800 TCACTCTGCCTGCCCAACTTTGG + Intronic
1190258971 X:48786383-48786405 CCACCCTCCCTGCCCACCCTGGG - Intergenic
1190322882 X:49188748-49188770 CTCCTCTCCAAGACCACCTTGGG + Exonic
1190717325 X:53115222-53115244 CCAGGCTCCAGGCCCACCTTAGG - Intergenic
1194168308 X:90550305-90550327 GCACTCTCTCAGCCCACAGTGGG + Intergenic
1198518090 X:137428295-137428317 CCACCCTCTCAGCCCACTTCTGG + Intergenic
1199794028 X:151178126-151178148 CCACCCTCTCAGACCCCCTTCGG - Intronic
1200002529 X:153069387-153069409 CCTCTCCCCCACCCCACTTTTGG - Intergenic
1200005195 X:153080623-153080645 CCTCTCCCCCACCCCACTTTTGG + Intergenic
1200135207 X:153871437-153871459 CAGCTCTCCCTGCCCACCCTAGG + Intronic
1200514555 Y:4128085-4128107 GCACTCTCTCAGCCCACAGTGGG + Intergenic
1201345769 Y:12982963-12982985 CCACTCTCACTGCAGACCTTTGG - Intergenic