ID: 1103046052

View in Genome Browser
Species Human (GRCh38)
Location 12:117735372-117735394
Sequence GTGGCCAAGCGGAGAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103046040_1103046052 15 Left 1103046040 12:117735334-117735356 CCAAGTGACATTCCCTCCCAGAA 0: 1
1: 0
2: 0
3: 16
4: 219
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244
1103046044_1103046052 -1 Left 1103046044 12:117735350-117735372 CCCAGAAGCCTGGCGCCTGCCAG 0: 1
1: 0
2: 2
3: 27
4: 268
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244
1103046047_1103046052 -9 Left 1103046047 12:117735358-117735380 CCTGGCGCCTGCCAGTGGCCAAG 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244
1103046042_1103046052 3 Left 1103046042 12:117735346-117735368 CCCTCCCAGAAGCCTGGCGCCTG 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244
1103046043_1103046052 2 Left 1103046043 12:117735347-117735369 CCTCCCAGAAGCCTGGCGCCTGC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244
1103046045_1103046052 -2 Left 1103046045 12:117735351-117735373 CCAGAAGCCTGGCGCCTGCCAGT 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103046052 Original CRISPR GTGGCCAAGCGGAGAGAGAA GGG Intronic
900289527 1:1918003-1918025 ATGGCCAAGCCCAGAGAGGAAGG - Exonic
901098712 1:6702607-6702629 GTGGCCAAGAGAAAAGACAATGG - Intergenic
901207815 1:7507465-7507487 GTGCCAAAGATGAGAGAGAAAGG - Intronic
901628163 1:10635156-10635178 GGGGCCCAGGGGAGGGAGAATGG - Intergenic
902488529 1:16763999-16764021 GAGGCAAGGCAGAGAGAGAAAGG - Intronic
902929930 1:19723801-19723823 GTGGCCAATCTGTGAGAGGAGGG + Intronic
902982088 1:20131489-20131511 GTTGCCAAGGGCTGAGAGAAGGG - Intergenic
904334547 1:29788103-29788125 GTGGCCCAGAGAAGAGAGACAGG - Intergenic
905120625 1:35679190-35679212 GGGCCAAGGCGGAGAGAGAAGGG + Intergenic
905604368 1:39284375-39284397 CTGGCCAAGGAGAGAGAAAAAGG + Exonic
910437120 1:87216680-87216702 GGGGAGAAGGGGAGAGAGAATGG - Intergenic
912795412 1:112690061-112690083 GTGACCAATCGGATAGAGGAAGG + Exonic
913260212 1:116990899-116990921 GAGGCCAAGAGGAGAGTGAATGG - Intergenic
915259217 1:154664222-154664244 GGGGCCAAGGAGAGGGAGAAAGG - Intergenic
918621562 1:186611521-186611543 GTGGGCAAGGGGCTAGAGAATGG - Intergenic
918863356 1:189861041-189861063 GTGGCCCAGCATAGTGAGAAGGG - Intergenic
920730978 1:208484128-208484150 GTAGGGAAGGGGAGAGAGAAAGG + Intergenic
921377454 1:214489347-214489369 GTGGGCAAGGGGAGAGGGCATGG - Intronic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
922699812 1:227752393-227752415 GTGGGGAAGCGGGGAGAGAGTGG - Intronic
923531908 1:234818517-234818539 GAGGCAAGGCAGAGAGAGAAAGG + Intergenic
923627131 1:235623227-235623249 GGGGCAAAGCTGTGAGAGAAAGG + Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
1063227394 10:4028303-4028325 GTTCCCCAGCGGAGAGAGGAGGG - Intergenic
1067530906 10:47072053-47072075 GGGGCCATGGGGAGGGAGAAAGG - Intergenic
1067544900 10:47185412-47185434 GTGCCAAAGCGCAGAGAGGAAGG - Intergenic
1069824730 10:71248034-71248056 TTGGCAAAGGGGAGAGAGAAGGG - Intronic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1070728360 10:78807887-78807909 GTCTCCAAGCGGAGAGAGCAGGG + Intergenic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072081707 10:92039433-92039455 GGGGTCCAGAGGAGAGAGAAGGG + Intergenic
1072276586 10:93829265-93829287 GTGGCCAAACAGATAGAGACAGG - Intergenic
1072487189 10:95866799-95866821 ATGGCAAACAGGAGAGAGAAAGG - Exonic
1072539557 10:96387952-96387974 GTGGCCTACCAGAGCGAGAAAGG + Intronic
1076612569 10:131735846-131735868 GTGGCCAAGAGGAGCTGGAAAGG + Intergenic
1077546914 11:3175904-3175926 GTGGCCAGGGGGAGGGAGAAGGG + Intergenic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1080094893 11:28394140-28394162 GTGGCAGAGCAGAGAGAGAGGGG + Intergenic
1080902238 11:36506372-36506394 GTTGTCAAGCGTAGAGAAAATGG - Intronic
1085547910 11:77337437-77337459 GTGGGCAGGGGGAGAAAGAAAGG + Intronic
1088579332 11:111300010-111300032 CTGGCCAGGCGGAGAAGGAAGGG + Intronic
1088653616 11:111978432-111978454 ATGGCCAAGTGGAGAGATAAAGG - Intronic
1091271564 11:134316128-134316150 GTTGCCAGGCGGTGGGAGAAGGG - Intronic
1092140894 12:6182679-6182701 GTGGCCTGGAGCAGAGAGAAGGG + Intergenic
1092580632 12:9837117-9837139 GAGGCTAAGGGGAGAGAGAATGG - Intronic
1092930945 12:13315148-13315170 TTGGCAAAGGGGAGAGAGAATGG - Intergenic
1093196184 12:16132044-16132066 TTGACCAAGCAGAGAGAGAATGG - Intergenic
1095543724 12:43341154-43341176 GTGCCCAGGAGGAGAGGGAAGGG + Intergenic
1096603879 12:52751083-52751105 GTGGCCAAGAGGAGAGTTATGGG - Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097492871 12:60292226-60292248 GGGGCCAACCTGAGGGAGAAGGG - Intergenic
1097710787 12:62914809-62914831 GTGCCCACACGGAGAAAGAAGGG + Intronic
1098150885 12:67545121-67545143 GTGGGAAAGGGGACAGAGAAGGG + Intergenic
1100258403 12:92907532-92907554 GTGGCCAAGGAGATGGAGAAAGG - Intronic
1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG + Intronic
1103355547 12:120317245-120317267 GTGGCCAAGCAGAGAGGCAAGGG - Intergenic
1104017307 12:124969559-124969581 GTGGCCAAGCAGAGAGGGTGAGG - Intronic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1109178936 13:59189827-59189849 GTGGACTAGAGGAGAGAGAGAGG - Intergenic
1112452506 13:99525106-99525128 ATAGCCAGGTGGAGAGAGAATGG + Intronic
1112503511 13:99959533-99959555 GTGGTCAAAAGGAGCGAGAAGGG + Intergenic
1115172276 14:30522915-30522937 TTGGTCAAGAGGAGTGAGAATGG + Intergenic
1115617947 14:35114069-35114091 ATAGCCGAGGGGAGAGAGAAGGG - Intronic
1115928100 14:38460138-38460160 GTGGCTGAGCAGAGAGAGCAAGG + Intergenic
1117841453 14:59864524-59864546 GGGGGCAAGGGGAGAGAGTAAGG - Intronic
1120762641 14:88299382-88299404 GGAGCAAAGCAGAGAGAGAATGG - Intronic
1121570981 14:94946442-94946464 GAGGCCAATCTGAGAGATAATGG + Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124664773 15:31582867-31582889 GTGACCAACTGGAGGGAGAAGGG + Intronic
1124859287 15:33422635-33422657 GTGGGCAAGCAGAGAGAGAGAGG + Intronic
1128745281 15:70110099-70110121 GAGGCCAAACCCAGAGAGAATGG + Intergenic
1129404305 15:75304702-75304724 GTGACCCAGCAGAGAGAGAAAGG - Intergenic
1130049542 15:80472228-80472250 GTGGCCAAGCTGAAATAGAGTGG + Intronic
1130410817 15:83647049-83647071 ATTGCCAAGCGGAGAGCGTAAGG + Intergenic
1131022332 15:89109390-89109412 GTGGGCTAGCCGACAGAGAAGGG + Intronic
1131175968 15:90210041-90210063 GTGGCCTAGGTGAGAGAGGATGG + Intronic
1132079589 15:98852768-98852790 ATGGCCACGGTGAGAGAGAAGGG - Intronic
1133305249 16:4804323-4804345 GTGGCCTAACGGAAACAGAAAGG + Exonic
1133870298 16:9679703-9679725 GTGGCAAAGCGAAGAGTTAATGG - Intergenic
1136448695 16:30339999-30340021 GTGGCCAAGCCTAGTGACAATGG + Intergenic
1137687611 16:50397480-50397502 GTGAGCAAGCTGAGAGAGAGAGG - Intergenic
1137827047 16:51507378-51507400 GTGGCCAAGCCAAGAGCCAAGGG - Intergenic
1139365980 16:66433907-66433929 GTGGCTAAGGGGAGAGAGCCTGG - Intronic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1142047167 16:87932864-87932886 GTGGCCAAGCCTAGTGACAATGG - Intronic
1142871698 17:2825312-2825334 TTGGGCAAGAGGAGGGAGAAGGG + Intronic
1143125454 17:4638838-4638860 CTGGCCAAGGGGTGAGAGCAAGG - Exonic
1143186535 17:5013634-5013656 GAGTCTAAGCGGGGAGAGAAAGG - Exonic
1143338011 17:6188008-6188030 GAGGCCGAGCTGGGAGAGAAGGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144189023 17:12826232-12826254 GGGGCCAATCAGAGAGTGAAGGG - Intronic
1146055130 17:29577159-29577181 GAGGCCAAGCGGAGACAGCAGGG - Exonic
1146320984 17:31846197-31846219 GAGGGCACACGGAGAGAGAAGGG - Intergenic
1146545123 17:33731731-33731753 GTGGCCAAGGGCAGAGGAAAGGG - Intronic
1146815373 17:35937951-35937973 GGGACCAAGCTGAGTGAGAAGGG + Intronic
1147428396 17:40357029-40357051 GTGGTCAGGCAGAGGGAGAAAGG - Intronic
1148020178 17:44548183-44548205 GTGGCCCAGCCTAGAGAGAAAGG + Intergenic
1148331040 17:46814172-46814194 GGGGCCAAGAGGTGAGAGATGGG - Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1151154312 17:72114138-72114160 GGGGCCAAGAGGAAAGAGATGGG + Intergenic
1151507479 17:74539185-74539207 GAGGCCGAGCGGAGAGTGACAGG + Intergenic
1152637229 17:81435122-81435144 GTGGGCAGGAGGAGAGAGAGTGG - Intronic
1153569219 18:6451580-6451602 GGGGCCAAGAGAACAGAGAAAGG - Intergenic
1153742656 18:8145162-8145184 GTAGCCATTTGGAGAGAGAAGGG + Intronic
1155234906 18:23809620-23809642 GGGGCCAAGAGGAGAATGAATGG + Intronic
1156075661 18:33275688-33275710 GAGGGGAAGCGGGGAGAGAAGGG + Intronic
1156155526 18:34297467-34297489 GTGGCCAAGAGGGGAAAGGAAGG - Intergenic
1156964810 18:43078342-43078364 TTGCCCAAGCCTAGAGAGAAGGG + Intronic
1157619546 18:49008448-49008470 GTGGCCCTGAGGGGAGAGAATGG + Intergenic
1157804838 18:50650337-50650359 GAGGAAAAGAGGAGAGAGAAAGG - Intronic
1158436784 18:57439843-57439865 GGGGCCAAAATGAGAGAGAAAGG - Intronic
1158440561 18:57471034-57471056 CTCCCCAAGCTGAGAGAGAAGGG + Intronic
1159915932 18:74187686-74187708 GTGGCAAGGAGGAGAGAGGAAGG - Intergenic
1161258730 19:3323762-3323784 CTAGCCAAACTGAGAGAGAAAGG - Intergenic
1163110843 19:15160368-15160390 GAGGCCAGAAGGAGAGAGAAAGG + Exonic
1163440500 19:17320360-17320382 GTCACCAAGAGGAGTGAGAAGGG + Exonic
1166297826 19:41897384-41897406 GTGGCCATGGGGAGAGGGGAGGG - Intronic
1166700088 19:44877408-44877430 GTGGGGAGGCGGAGAGAGAGAGG - Intronic
1166784537 19:45359675-45359697 GTGGCCATGGGGAGAGAGAAAGG - Intronic
1167497871 19:49830050-49830072 ATGGCCAACCCCAGAGAGAAGGG - Intronic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
1202702669 1_KI270713v1_random:241-263 GAGGCAAGGCAGAGAGAGAAAGG + Intergenic
926351006 2:11994297-11994319 GTGGTCCAGAGGACAGAGAATGG + Intergenic
926609019 2:14926767-14926789 GGGGCTGAGGGGAGAGAGAATGG - Intergenic
931595323 2:63935990-63936012 GAAGCCAAGAGGAAAGAGAAAGG + Intronic
931717641 2:65041822-65041844 ATGGCCATGGGGAGAGAGAAAGG - Intergenic
932330121 2:70894026-70894048 GTGGCTGAGGGGAGGGAGAAAGG + Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
933994482 2:87657839-87657861 GTGACCAGGTGGAGAGAGGAAGG + Intergenic
936299376 2:111293074-111293096 GTGACCAGGTGGAGAGAGGAAGG - Intergenic
936372923 2:111918054-111918076 GTGGCTAAGGGGAGAGGGAATGG - Intronic
936999293 2:118450105-118450127 GTTGCCAAGGGGAGAGAGGGAGG - Intergenic
937098892 2:119253746-119253768 GTGGCAAGGTGGGGAGAGAAGGG + Intronic
938164300 2:129012666-129012688 GTGGGCAAACGGGGAGAGCAGGG - Intergenic
938593105 2:132758663-132758685 GATGCCAAGAGGAGAGAGAGAGG - Intronic
939350628 2:141033222-141033244 GTGGCTAGGCAGAGAGAGCAAGG + Intronic
939528047 2:143321357-143321379 GTGGACAAGAGGAGAGCAAAGGG - Intronic
939874525 2:147562541-147562563 GGGGCCAAGGGGAGAGGGGAAGG - Intergenic
943010181 2:182438495-182438517 GAGGCAAAGAGGGGAGAGAAAGG + Intronic
945832154 2:214800366-214800388 TGAGCCAAGCTGAGAGAGAAGGG + Intronic
946334944 2:219030213-219030235 GTGGCCAAGCAGAAGGACAAAGG + Intronic
946761549 2:222998863-222998885 GTGGCCAAGTGGTTAGATAACGG + Intergenic
947164789 2:227250826-227250848 TTGGCCAAAATGAGAGAGAAAGG + Intronic
948001043 2:234567688-234567710 GGGGGCAATAGGAGAGAGAATGG - Intergenic
1168836514 20:881319-881341 GTGGGCAAGGAAAGAGAGAAGGG + Intronic
1169901532 20:10557672-10557694 GTGGCAAAGCCGAAAGGGAATGG - Intronic
1170341137 20:15328284-15328306 GTGGCCAGAGGGAGAGAGGAGGG + Intronic
1172199180 20:33113261-33113283 GTGGCCCAGGGGAGAGATGATGG - Intergenic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG + Intronic
1180832949 22:18915284-18915306 GGGGCCAAGAGGAGAGAGCCCGG + Intronic
1181066871 22:20310968-20310990 GGGGCCAAGAGGAGAGAGCCCGG - Intergenic
1181092921 22:20486524-20486546 ATGGGCAAGGGTAGAGAGAAGGG - Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1184037720 22:41926449-41926471 GTGGACAAGGGGAGGGAGAGAGG + Intronic
1184263116 22:43330940-43330962 GAGGCTCAGCGGGGAGAGAAGGG - Intronic
1203283033 22_KI270734v1_random:140588-140610 GGGGCCAAGAGGAGAGAGCCCGG + Intergenic
949509153 3:4753419-4753441 ATGGCCAAGCGGTTAGAGCAGGG - Intronic
949840168 3:8311696-8311718 TTGTCCAAGGGGAGAGAAAAGGG - Intergenic
950032387 3:9861642-9861664 TTGGCCAAGGGGACAGATAAAGG - Intergenic
950158578 3:10742408-10742430 CTGGCAGAGCGGTGAGAGAAAGG - Intergenic
950406764 3:12809858-12809880 GAGAGAAAGCGGAGAGAGAAAGG - Intronic
951547113 3:23837902-23837924 GTGGACAAGCAGAAAGAAAAGGG - Intronic
952445071 3:33373190-33373212 ATAGCCACGGGGAGAGAGAAGGG + Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952957376 3:38565525-38565547 GTAGCCAAGCAGAGAGAAACGGG - Intronic
953665963 3:44926744-44926766 CTGGCCCAGCCTAGAGAGAAGGG + Exonic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
954869749 3:53758805-53758827 TAGGCCAAGAGGAGAGAGCAGGG + Intronic
957418724 3:79940034-79940056 GTGGGCAAGTAGAGAAAGAAAGG - Intergenic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
960870904 3:122248780-122248802 GAGGCCAAGAGGTGAGAGTAGGG + Intronic
961377975 3:126479576-126479598 GTGGCCAAGTGCAGAGAGCTAGG + Intergenic
961533833 3:127557160-127557182 TTGGCCTAGAGGAGAGGGAATGG + Intergenic
964808188 3:160634524-160634546 GAGGGCAAGCTGGGAGAGAAGGG - Intergenic
965121285 3:164560999-164561021 GTGGCGGGGGGGAGAGAGAAAGG + Intergenic
966583563 3:181596042-181596064 GTGTTCAAGCAGAGAAAGAAAGG + Intergenic
969435018 4:7184180-7184202 GTGGCCAAGTGGAGACAGCTGGG + Intergenic
970725299 4:19036799-19036821 GTGGGAAAGTGGAAAGAGAAAGG - Intergenic
970912475 4:21293365-21293387 GTGGCTGAGTGGAGAGAGTATGG - Intronic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
973820372 4:54657688-54657710 GTGGAAAGGTGGAGAGAGAAAGG + Intergenic
976460036 4:85300586-85300608 GTGGAAAGGTGGAGAGAGAAAGG - Intergenic
978721177 4:111911451-111911473 GGGGGCCTGCGGAGAGAGAAGGG + Intergenic
981315677 4:143337372-143337394 GGGGCCAAGGGGAAAGAGACCGG - Intronic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
984237887 4:177183035-177183057 GGGCCCAAGTGGAGAGAGATGGG - Intergenic
984899921 4:184576896-184576918 TGTGCCAAGAGGAGAGAGAATGG + Intergenic
986698229 5:10376918-10376940 GTGGCCTATCGGAGGGAGAATGG - Intronic
992216690 5:74531481-74531503 GTGACCAAGCAGGGAGGGAAAGG + Intergenic
993542621 5:89171404-89171426 AAGGCCAAGATGAGAGAGAAGGG + Intergenic
994279658 5:97886186-97886208 GAGGCGAAGCGGAAAGTGAAGGG - Intergenic
995752946 5:115472722-115472744 GAGGCCAAGAGGAGAGAGGGAGG + Intergenic
998107476 5:139477550-139477572 GGGGCCAGGCGGATGGAGAATGG + Intronic
998418273 5:141960907-141960929 GTGGCCAAAGGCAGAGAAAACGG + Intronic
999135172 5:149313937-149313959 ATGGCTAAGCTCAGAGAGAAAGG + Intronic
1000007447 5:157200278-157200300 GTGGCCAAGAAAAGAGACAAGGG + Intronic
1000288310 5:159846831-159846853 GTGACCATGAGGAGGGAGAAGGG - Intergenic
1001466112 5:171968018-171968040 GTGGCTCAGAGGAGAGGGAATGG - Intronic
1001816101 5:174670755-174670777 GTGACCCTGCGGGGAGAGAATGG - Intergenic
1002098209 5:176844442-176844464 GTGTCCCAGCTGAGCGAGAAGGG + Intronic
1002368979 5:178734716-178734738 GAGGCCTATCGGAGGGAGAAGGG - Intergenic
1002665426 5:180820343-180820365 GTGGCCAGGCAGAGAGAGAGAGG + Intergenic
1004867750 6:19870625-19870647 GGAGCTAAGGGGAGAGAGAAGGG + Intergenic
1006972846 6:38064740-38064762 GTCACCAAGAAGAGAGAGAAAGG - Intronic
1007386433 6:41523323-41523345 GTGGCCAAGCGGCAAGATTAGGG + Intergenic
1008378997 6:50821802-50821824 GTAGGCAAGCGGAGGGAGGAAGG + Intronic
1008447388 6:51609202-51609224 GGGGCAAAGGGGAAAGAGAAGGG - Intergenic
1008621907 6:53279030-53279052 GTAGCCAAGGGGAAAGAGCATGG + Intronic
1012726154 6:102813533-102813555 TTGGCCAAGAGAAGAGTGAAAGG + Intergenic
1014502136 6:122204486-122204508 GGGTTAAAGCGGAGAGAGAATGG - Intergenic
1015218262 6:130775263-130775285 ATGGCAAAGAGGAGACAGAATGG - Intergenic
1016369370 6:143356621-143356643 GGGACCAAGGGGAAAGAGAAGGG - Intergenic
1018228779 6:161655584-161655606 TTTGCCAAACCGAGAGAGAAAGG + Intronic
1018748384 6:166780352-166780374 CTGGCCATGGGGAGAGAGATGGG + Intronic
1018862155 6:167719004-167719026 GTGACCAAGAGGACAGATAAAGG - Intergenic
1018953746 6:168394586-168394608 GTGGCCATGGAGAGAGAGATGGG + Intergenic
1019078382 6:169410228-169410250 GTGGACAGGCAGAGAGGGAAGGG - Intergenic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1022610002 7:31861458-31861480 GAGGCCAAGCAGAAAGAAAAAGG - Intronic
1022857560 7:34330369-34330391 ATTGCCATGCGAAGAGAGAAAGG + Intergenic
1022973762 7:35538888-35538910 GTGACCAGGCGGACAGAGGAGGG - Intergenic
1023855703 7:44182361-44182383 GTAGCCAAGCAGGTAGAGAAAGG + Intronic
1024017509 7:45330944-45330966 GTGGCCAAGGGCAGATAGAAAGG - Intergenic
1026541316 7:71282397-71282419 GTAGCAATGCAGAGAGAGAAGGG + Intronic
1027478308 7:78661592-78661614 GAGCCCTAGAGGAGAGAGAATGG - Intronic
1027585499 7:80053266-80053288 GCAGCCAAGCGGAGAGAACAAGG - Intergenic
1029467713 7:100736686-100736708 GTGGCTAGATGGAGAGAGAAGGG + Intronic
1032152347 7:129440126-129440148 ATGGCCAGGAGGAGAGGGAAGGG + Intronic
1034068150 7:148156468-148156490 GTGGTCAAGCGGAGGAAGGAGGG - Intronic
1034434081 7:151054883-151054905 GAGGGCAAGGGGAGAGAGCAGGG - Intronic
1035046894 7:155973732-155973754 GTGGCCGAGTGAAGAGTGAAGGG - Intergenic
1035676594 8:1461046-1461068 GTGGCCAGGAGGAGAGAGAAGGG + Intergenic
1035676612 8:1461129-1461151 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676630 8:1461211-1461233 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676648 8:1461293-1461315 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676667 8:1461376-1461398 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676683 8:1461458-1461480 GTGACCAGGAGGAGGGAGAAGGG + Intergenic
1035676702 8:1461541-1461563 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676721 8:1461624-1461646 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676738 8:1461706-1461728 GTGACCAGGAGGAGGGAGAAGGG + Intergenic
1035676757 8:1461789-1461811 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676773 8:1461871-1461893 GTGACCAGGAGGAGGGAGAAGGG + Intergenic
1035676792 8:1461954-1461976 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676811 8:1462037-1462059 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676847 8:1462202-1462224 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676877 8:1462366-1462388 GTGACCAGGAGGAGGGAGAAGGG + Intergenic
1035676894 8:1462448-1462470 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035676913 8:1462531-1462553 GTGGCCAGGAGGAGGGAGAAGGG + Intergenic
1035754561 8:2022008-2022030 GAGGCCAAGCCGAGAGAGCCTGG + Intergenic
1037220245 8:16510308-16510330 GGGGCCAAGCAAAGAGAAAATGG + Intronic
1037915408 8:22769988-22770010 GTGGACAAGAGGAGAGAGTCAGG - Intronic
1038423807 8:27451714-27451736 GTGGCCACTGAGAGAGAGAAGGG - Intronic
1038689308 8:29746631-29746653 GTGGCCCAGGGGAAATAGAATGG + Intergenic
1038821120 8:30952675-30952697 ATTTCCAAGCGGAGAGGGAAGGG + Intergenic
1039882303 8:41632521-41632543 GTAGCAAAGGGAAGAGAGAAAGG + Intergenic
1042301883 8:67292216-67292238 ATTTCCAAGCGTAGAGAGAATGG - Intronic
1043517289 8:81006371-81006393 GTGCCCACACAGAGAGAGAAGGG - Intronic
1044908689 8:97033042-97033064 GTGATCAAGAGGGGAGAGAAGGG + Intronic
1047368409 8:124234250-124234272 GTGGCCCAGTGGAGAGAGCGTGG + Intergenic
1048230759 8:132638620-132638642 GTCACCTAGCAGAGAGAGAATGG + Intronic
1049264409 8:141659759-141659781 GTTGACAAGCGGGGAGAGAGAGG - Intergenic
1049323708 8:142010932-142010954 AAGGGCAAGCGGAGAGAGAAGGG - Intergenic
1050156759 9:2675582-2675604 GTGGGAAAGAGGTGAGAGAAGGG + Intergenic
1050331443 9:4550061-4550083 GTGGCCTGGGGGAGAGAGGAGGG - Intronic
1053560288 9:39185647-39185669 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1053824392 9:42005890-42005912 GTGGCCAAGCAGAAAGTGACAGG + Intronic
1054136830 9:61433308-61433330 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1054606179 9:67181473-67181495 GTGGCCAAGCAGAAAGTGACAGG - Intergenic
1055418832 9:76114237-76114259 GAGGCCTAGCGGACAGAGAAGGG + Intronic
1059835294 9:118145321-118145343 GAGGCCTATTGGAGAGAGAAGGG - Intergenic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1059962213 9:119576615-119576637 GTGACCATGTGGAGAGAGAGTGG + Intergenic
1060662242 9:125411208-125411230 GTGGCCAGGGGGAGAGGGAAGGG - Intergenic
1061200373 9:129134884-129134906 GTGTTCAATCGGTGAGAGAAAGG + Exonic
1185621433 X:1453264-1453286 GTGGCCTGGCGGAGAGGGCAAGG - Intronic
1186290828 X:8096770-8096792 GTGGCCAAGAGGAGATAACAAGG - Intergenic
1186785815 X:12955186-12955208 CTGCCCTAGGGGAGAGAGAATGG - Intergenic
1188820010 X:34763624-34763646 GTAGCTAAGAGGAGAGAGAAAGG - Intergenic
1189370118 X:40421227-40421249 GAGGCCATGTGGAGGGAGAAAGG - Intergenic
1190329459 X:49226697-49226719 GTGGCCCTGCAGGGAGAGAAAGG + Exonic
1193267410 X:79488562-79488584 GGGGCCAACTTGAGAGAGAAGGG - Intergenic
1201263829 Y:12186825-12186847 GTGGTCATGGGGAGAGGGAAGGG + Intergenic