ID: 1103049730

View in Genome Browser
Species Human (GRCh38)
Location 12:117768630-117768652
Sequence GGCTCCTGGAAGCATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103049723_1103049730 3 Left 1103049723 12:117768604-117768626 CCGGCAGCAGCAGGAGCCCAGCC 0: 1
1: 0
2: 19
3: 87
4: 595
Right 1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG 0: 1
1: 0
2: 8
3: 40
4: 265
1103049722_1103049730 4 Left 1103049722 12:117768603-117768625 CCCGGCAGCAGCAGGAGCCCAGC 0: 1
1: 0
2: 11
3: 125
4: 707
Right 1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG 0: 1
1: 0
2: 8
3: 40
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103049730 Original CRISPR GGCTCCTGGAAGCATCTGGA TGG Intronic
900083455 1:875796-875818 GGTTCCTGGAAGCAGCTGGGAGG + Intergenic
900330019 1:2129460-2129482 GGCTCCTGGAAGAGGCAGGATGG + Intronic
901182409 1:7350837-7350859 GGATCCTGGCAGAATGTGGAGGG - Intronic
901278423 1:8011247-8011269 GGCTCCTGGCAGCCTTTGGATGG - Intronic
901862197 1:12081457-12081479 GGCTCCTGGGAGCCTCTCCAGGG - Intronic
902075348 1:13780510-13780532 GGCTCCTGGTCCCATCTGCAGGG - Exonic
902378924 1:16043588-16043610 GGCTCCTGGGTGCTGCTGGACGG - Intergenic
902408294 1:16198528-16198550 GGCTCCTGGATGGTCCTGGAGGG - Exonic
902410970 1:16211406-16211428 GGGTTCTGGAAGCTCCTGGAGGG + Intronic
902752565 1:18527427-18527449 GGATTCTGGAAGCTTCTGGATGG + Intergenic
902957536 1:19935818-19935840 TTACCCTGGAAGCATCTGGAGGG + Intergenic
903766482 1:25738147-25738169 GGTTTCTTGAAGCCTCTGGAAGG - Intronic
903849461 1:26297345-26297367 GGCTCCTGGAAGCTTCACAATGG - Intronic
903869783 1:26425590-26425612 GGTCCCTGGCAGCATCTGGAAGG + Intronic
904141853 1:28359797-28359819 GGTTCCTGGAAGTACCTGGTGGG - Intergenic
904941840 1:34169218-34169240 GGACCCTGGAAACATCTGCAGGG + Intronic
907425287 1:54375641-54375663 GGCGACTGGAGGCTTCTGGAGGG - Intronic
907855506 1:58299883-58299905 GCCTCCAGGAAGCATGTGGAGGG - Intronic
912583235 1:110738384-110738406 GGCACCTGGCAGCCTCTGAAGGG + Intergenic
912957431 1:114165411-114165433 TGCTCCTGGAAGCACCTGACAGG + Intergenic
913182331 1:116334204-116334226 GGCAGCTGGAGGCAGCTGGATGG - Intergenic
915281960 1:154829050-154829072 AGCTCCTGGGAGCTCCTGGATGG - Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG + Intergenic
918566747 1:185943088-185943110 GGGTCTTGGAAGGATCTGGATGG + Intronic
920845100 1:209587119-209587141 GGCTTCAGGAAGCTTCTGGCTGG - Intronic
922254065 1:223876333-223876355 TGCTCCTTGAGGCATCTGGGTGG - Intergenic
923022845 1:230178304-230178326 GGCCCCTGGCAGTACCTGGAGGG - Exonic
924218539 1:241849802-241849824 GGCTCCTTGAAGCATGTGTCAGG + Intronic
924243615 1:242061713-242061735 AGCTCCTGGAAGCAGCTGGGAGG + Intergenic
1062763603 10:45589-45611 GGCTCCTGGAAGCAGCTGGGAGG - Intergenic
1065816326 10:29486427-29486449 GACTTCTGGAAGCTTCTGGGTGG - Exonic
1065863805 10:29895623-29895645 AGCCTCGGGAAGCATCTGGAGGG - Intergenic
1070540160 10:77409934-77409956 GGCTCCTGCAAGAATCAGGCAGG - Intronic
1070670877 10:78376434-78376456 GGGTCCTGGAAGCCAGTGGAGGG - Intergenic
1070766667 10:79060726-79060748 GTCTCCTGGCAGCATTTGGTCGG + Intergenic
1075048103 10:119162032-119162054 GGCTCCAGGAATCAGCTGCAGGG + Intronic
1076068710 10:127469119-127469141 ACCTCCTGGAAACAGCTGGAGGG - Intergenic
1076673912 10:132137844-132137866 GGCCCCTGGACGCATTTAGAAGG + Intronic
1076803342 10:132843252-132843274 TTCCCCTGGAAGCTTCTGGAAGG - Intronic
1077014458 11:393574-393596 CGCACCAGGAAGCATGTGGATGG - Intronic
1077021316 11:418339-418361 AGCTCCTGGTGGCCTCTGGACGG + Exonic
1077197328 11:1288039-1288061 AGCTCCTGGGGGCATCAGGAGGG - Intronic
1079281895 11:19095157-19095179 GGCCCATGGAAGGCTCTGGAGGG - Intergenic
1079907051 11:26261526-26261548 GACTCATGGAAGCCTCTGAAAGG - Intergenic
1080695525 11:34600306-34600328 GACTCCTGGAAGGTTCTGGATGG + Intergenic
1081655368 11:44853700-44853722 GGCTCCTGCAGGCCTGTGGATGG - Intronic
1083775731 11:64893593-64893615 GGGTCCAGGAAGCATCAGGCTGG + Intergenic
1083869394 11:65477590-65477612 GTCACCGGGAAGCATCTGGCTGG + Intergenic
1084412407 11:69012477-69012499 GGCTCCTGGAATGATCTGCAAGG - Intronic
1086634344 11:89063815-89063837 GACTCCTGGGTGAATCTGGATGG + Intronic
1089849775 11:121486231-121486253 TGCTCCTGGAAGAATGAGGAAGG - Intronic
1090036311 11:123252652-123252674 GGGTCCTGGAAGCTCCTGGAGGG + Intergenic
1090880965 11:130831092-130831114 GGCTCCTGAACTCCTCTGGACGG + Intergenic
1091973490 12:4807890-4807912 GGCTCCTGGATGTGTCGGGAAGG - Intronic
1092479529 12:8847568-8847590 TGCTCCTGGAAGCTGCTGGGAGG - Exonic
1094796802 12:33983382-33983404 GGCACCAGGAAACATTTGGAAGG + Intergenic
1094813466 12:34163328-34163350 GGCTCCTGGAAGCAGCTGGGAGG - Intergenic
1095103445 12:38205204-38205226 GGCTCCTGGAAGCAGCTAGGAGG + Intergenic
1095397136 12:41774162-41774184 GACACCTGGAAGAATCTGGCGGG + Intergenic
1096145799 12:49277727-49277749 GGCTCCTGGAGCCATCTGCCTGG - Intergenic
1096221120 12:49828537-49828559 GCGTCCTGGGAACATCTGGAGGG - Intronic
1098854233 12:75633918-75633940 GGCTCCTGGATCCATCGGTAGGG + Intergenic
1099019408 12:77384766-77384788 GGATTCTGGAAACATCTGGGGGG + Intergenic
1102148366 12:110671458-110671480 GGCTCCTGGACGCTTTGGGATGG - Intronic
1102239290 12:111313982-111314004 GGCTCCTGGCGGCAACTGGAGGG - Intronic
1102900552 12:116633268-116633290 GGCTGCTGCTAGCATCTAGAGGG - Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1104159963 12:126168594-126168616 GGCTCCAGGTAGCAGCTGGCGGG + Intergenic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1104789182 12:131471301-131471323 AGCTCCTGGGAACATCTAGAGGG + Intergenic
1106128447 13:26920377-26920399 GGCCCCTGGAGCCATCTGGGTGG + Intergenic
1106621405 13:31374327-31374349 TGCTCCCAGAAGCACCTGGAGGG + Intergenic
1107961989 13:45566916-45566938 AGCTCATGAAAGCATCTGGGAGG + Intronic
1108233105 13:48370887-48370909 GCCCCTAGGAAGCATCTGGATGG - Intronic
1108507391 13:51124792-51124814 AGGTCATGGAAGCAGCTGGAAGG - Intergenic
1108695504 13:52899337-52899359 GGCTCTTGGTGCCATCTGGATGG + Intergenic
1108695681 13:52900559-52900581 GGCTCTTGGTGCCATCTGGATGG + Intergenic
1111869856 13:93817769-93817791 GGATCCTGGGAGCCCCTGGAGGG + Intronic
1112839988 13:103564112-103564134 AGCTCTTGAAAGCATCTGGGAGG - Intergenic
1117012136 14:51481813-51481835 CACTCCAGGAAGCATTTGGAGGG - Intergenic
1117105480 14:52393935-52393957 GGCTTCAGGAAGCATCTGTGGGG - Intergenic
1118005595 14:61562131-61562153 GGCTCCAGGAAGCACATGAAGGG + Intronic
1118082015 14:62371936-62371958 GGCCCATGGCAGCATCTGGGAGG + Intergenic
1119414394 14:74459947-74459969 GAATCCTAGAAGCATCTGGGAGG - Intergenic
1120067542 14:80061049-80061071 TGCTCCTGGATGTATCTGTAAGG + Intergenic
1120668337 14:87334317-87334339 GGCTTCTGCCAGCATTTGGAAGG - Intergenic
1121536842 14:94696917-94696939 GGCTCCTGCAGGCCTCTGGGTGG + Intergenic
1122578550 14:102756845-102756867 GGCTCTTGGTGGCATCTTGAAGG + Intergenic
1122885374 14:104708207-104708229 GGCTCACGGGAGCATGTGGAGGG - Intronic
1125361249 15:38866856-38866878 TGCACCTGGAGGCATCAGGAAGG - Intergenic
1128601649 15:69000108-69000130 GGCTCCTCCAACCATCTGAATGG - Intronic
1129543216 15:76368563-76368585 GGCTCCTGAAAGCTTCTGGGCGG - Intronic
1129748086 15:78038885-78038907 GGCCCCTGGGAGCATGTGAATGG + Intronic
1129786091 15:78311129-78311151 GGTTCCTGGCAGCCTCTGGAGGG - Intergenic
1131450845 15:92538559-92538581 TGCTCCTGGAAGGGCCTGGAGGG - Intergenic
1131745526 15:95443179-95443201 GGCTCCAGCATGCATCTAGAGGG - Intergenic
1132784049 16:1644662-1644684 GGGTCATGGAAGCCTCAGGAGGG + Intronic
1133231118 16:4367062-4367084 GGCTCCTGGAAGTGTGGGGAGGG - Intronic
1136866055 16:33755568-33755590 GGCTCCTGGAAGCTTGTGCCTGG + Intergenic
1137875674 16:51994512-51994534 TGATCCTGGGAACATCTGGAAGG + Intergenic
1138583848 16:57958138-57958160 GCCTCCTGGGAGCATCAAGAAGG - Intronic
1139695089 16:68668444-68668466 GGTGCCAGGAAGCATCTGGGAGG + Intronic
1140251869 16:73301481-73301503 GGTTCCAGTAGGCATCTGGAGGG - Intergenic
1141202044 16:81905548-81905570 GGCTCCAAGAAGCAGCTGCAAGG - Intronic
1141823511 16:86463678-86463700 GGCTCCAGGCAGCAGCTGGGAGG + Intergenic
1141832834 16:86519306-86519328 TGATGCTGGAAGCAGCTGGATGG - Intergenic
1142249499 16:88984609-88984631 GGCACCCGGAAGGATCCGGAAGG + Intergenic
1142315384 16:89341443-89341465 GCCTTCTGGAACCTTCTGGAAGG - Intronic
1142350684 16:89577966-89577988 GGGACCTGGCAGCAGCTGGATGG - Intronic
1203106099 16_KI270728v1_random:1360535-1360557 GGCTCCTGGAAGCTTGTGCCTGG - Intergenic
1203127415 16_KI270728v1_random:1601833-1601855 GGCTCCTGGAAGCTTGTGCCTGG + Intergenic
1142473332 17:175647-175669 AGCTCCTGGGAGCACCTGGAGGG - Intronic
1142508705 17:381233-381255 GGTTCCGGGAAGCATGAGGAGGG - Intronic
1143140283 17:4738715-4738737 GGGTCCTGGAGGCACCTGCAAGG + Intronic
1143706050 17:8698331-8698353 GGCTCAAGGAAGCTTCTGGGAGG + Intergenic
1143875861 17:9990298-9990320 GGCTCCTGCCAGCATCCGTAGGG - Intronic
1144619227 17:16805837-16805859 GGCTTCTGGAAGCTTCTAGAAGG + Intergenic
1144893470 17:18509858-18509880 GGCTTCTGGAAGCTTCTAGAAGG - Intergenic
1145138754 17:20434416-20434438 GGCTTCTGGAAGCTTCTAGAAGG + Intergenic
1145269864 17:21399084-21399106 GCCTCCTGCCAGCATCTGCAGGG - Intronic
1147055955 17:37835307-37835329 GGCTTCTGGAAGCTTCTAGAAGG - Intergenic
1147676753 17:42211920-42211942 GACTCCTGAGAGCATCTGGTTGG + Intronic
1147934853 17:44005523-44005545 GGGTCCTGACAGCTTCTGGAAGG + Intronic
1148225601 17:45896215-45896237 GGCGCCGGGAAGCTTCTGAAGGG + Intronic
1149003883 17:51784277-51784299 GGCTCTGGGCAGCAGCTGGATGG - Intronic
1151432956 17:74076993-74077015 GGCTGCTGGAAGAGTTTGGAAGG - Intergenic
1152622524 17:81372425-81372447 GCCTCCTGGAAGCCTCAAGAAGG - Intergenic
1152810190 17:82378110-82378132 GGCTCCTGGGAGCCTCTGGAAGG - Intergenic
1152828161 17:82480429-82480451 GCCTCCTGGAAGAACCGGGAAGG - Intronic
1152956512 18:45920-45942 GGCTCCTGGAAGCAGCTGGGAGG - Intergenic
1153586629 18:6627860-6627882 GGCAGCTGGAAGCTTCTGGAAGG - Intergenic
1154982365 18:21513813-21513835 GGAACCTGGCAGCACCTGGAAGG - Exonic
1156209956 18:34928719-34928741 CGCTCATGAAAGCATTTGGAGGG - Intergenic
1159744454 18:72213699-72213721 GGCTCATGGTGGAATCTGGATGG - Intergenic
1159775619 18:72600576-72600598 GGGGCCTGGAAGGATATGGAAGG + Intronic
1160474617 18:79171755-79171777 GGCTGCTGGAAGCAGAGGGATGG - Intronic
1160527474 18:79546026-79546048 GAGTCCAGGAAGCATCTGGAAGG - Intergenic
1160827212 19:1086157-1086179 TGCTCCTGGAAGCCTCTGGGAGG - Exonic
1161509360 19:4662057-4662079 GGCCCCAGGAGGCATCAGGAGGG - Intronic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162139487 19:8577329-8577351 GGCTCCTGGAGGCTCCTGAATGG + Exonic
1162540672 19:11294057-11294079 AGCTCCTGGAAGGAACTGGCCGG - Intergenic
1162541009 19:11295944-11295966 GGGTCCTGGTGGCATCTGGAGGG + Intergenic
1163068484 19:14817544-14817566 GGCTCCTGGGCTCACCTGGATGG - Intronic
1163366406 19:16878250-16878272 AGCTCCTGGAAGCGGCTGGTGGG + Exonic
1163446262 19:17348197-17348219 GGCTCCTGGAATGCTCTGGAAGG + Intergenic
1164649118 19:29879447-29879469 GGCTGCTGGAAACTTCCGGAAGG + Intergenic
1164651273 19:29892583-29892605 GCCTCCTGGCACCATCAGGAAGG + Intergenic
1165361859 19:35341694-35341716 GCCTCCTGGGTGCATCTGCATGG - Exonic
1165544048 19:36518600-36518622 GGTTAGTGGAAGAATCTGGAAGG + Intronic
1165714406 19:38035105-38035127 GGCTCCTGGAAGCAGCTTTTGGG + Intronic
1165858341 19:38893652-38893674 GGCTCCTGGAGGCCGCTGGCTGG - Intronic
1166765893 19:45251909-45251931 GGCTCCTGGAAGCAGGGGAAGGG - Intronic
1167579336 19:50332607-50332629 GGCTTCTGGAAGCTTCATGAGGG + Intronic
1168059523 19:53883213-53883235 GGCTCCTGGGACCCTCAGGAGGG + Intronic
926157839 2:10467487-10467509 GTCTCCTGGAAGCAGCGGGACGG + Intergenic
926611863 2:14955318-14955340 GGCTCATGAAAGCAGCTGGGAGG - Intergenic
927088985 2:19696192-19696214 GGTTCCTGGATCCATCTAGAAGG - Intergenic
928324896 2:30311454-30311476 GGTTCCTGGAAGCCTCTGGTGGG + Intronic
928454959 2:31412074-31412096 GGCACCTGGAAGAATCTGGGAGG - Intronic
929588787 2:43132241-43132263 GGCTCCTGGCAGAACCAGGACGG - Intergenic
930156377 2:48111625-48111647 CGCCCCGGGAAGCATCTGGCCGG - Intergenic
930691970 2:54373551-54373573 AGCTCCTAGAAGCATTTGCAGGG - Intronic
932067133 2:68576359-68576381 AGCTCCTGTAAACATCTTGAGGG - Intronic
932401522 2:71483854-71483876 GGCTCCTGGAAGCCCCAGGATGG + Intronic
933573090 2:84036376-84036398 GGCTCCTGTAGGAAACTGGAGGG - Intergenic
936113702 2:109685550-109685572 GGGTGCTGCAAGCATGTGGAAGG + Intergenic
936613292 2:114022970-114022992 GGCTCCTAGGAGGATGTGGATGG - Intergenic
937885404 2:126896297-126896319 GTCTCCTGGAATCTTCTGGGAGG - Intergenic
938304357 2:130241212-130241234 GGCTCCTAGGAGCAAGTGGAAGG - Intergenic
938760187 2:134418339-134418361 GGCTGGTGGAATCATCTGAAGGG - Intronic
939777539 2:146405486-146405508 AGATCCTGGGAGCAACTGGAAGG - Intergenic
940282273 2:152000535-152000557 GGATCCGGGATGCATCTAGATGG - Intronic
941896691 2:170636439-170636461 GGCTCCAGGCACCATCTGGAAGG - Intronic
943014676 2:182496601-182496623 GGGGCCTGAAAGCATTTGGAAGG + Intronic
945974307 2:216258786-216258808 GGCTCCTGGGCTCATTTGGATGG - Exonic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
948124678 2:235556078-235556100 GGCTTCTGGAAGCCTCCAGAAGG + Intronic
948677238 2:239603981-239604003 GGCTCCAGGTCGCCTCTGGAAGG + Intergenic
1168753996 20:303181-303203 AGCTCGTGGGAGCATCTGGTAGG + Intergenic
1170152129 20:13236895-13236917 AGCCCCTGAAAGCAGCTGGAGGG - Intronic
1176019735 20:62956532-62956554 GGCTCCTGGGAGCAACTGAGTGG - Intronic
1176059624 20:63166798-63166820 GGCACCTGGATGCACCAGGAGGG + Intergenic
1176300826 21:5098202-5098224 GGGTGCTGGCAGCATCTGGCTGG - Intergenic
1177975526 21:27845100-27845122 GCCTCCTGGAAGCTTCTTGAGGG + Intergenic
1179028376 21:37699247-37699269 GGCACATGGAAGGTTCTGGAAGG + Intronic
1179385533 21:40938392-40938414 GGCTTCCGGCAGCAACTGGAAGG - Intergenic
1182513008 22:30832545-30832567 AGCTCCTGCCAGCATTTGGAAGG - Intronic
1184209147 22:43025038-43025060 GGGTCCTGGCAGCCTCTGGGTGG + Intergenic
949647507 3:6113475-6113497 GTATCCTGGAAGCCACTGGAGGG + Intergenic
949924619 3:9031401-9031423 GGCCCATGGATGCATCAGGAAGG - Intronic
950684332 3:14605664-14605686 GGGGGCTGGAATCATCTGGAGGG + Intergenic
953955195 3:47226663-47226685 GACTCCTGGAAGCATCAGTCAGG + Intergenic
954094514 3:48314514-48314536 GCAGCCTGGCAGCATCTGGAGGG + Intronic
955132875 3:56188234-56188256 GGCTCCTGAGGGCAACTGGATGG - Intronic
958056868 3:88423993-88424015 GGCTCCTGTCACCATCTTGATGG + Intergenic
959605707 3:108239394-108239416 GACTCCAGAAAGCATCTGGTTGG + Intergenic
960902207 3:122564378-122564400 GGCTCCGGGAGGCAGCTGGGCGG - Exonic
962004005 3:131330030-131330052 GGCTCCTGAAAGAATCAGGTGGG + Intronic
962325401 3:134428103-134428125 GGGTCCTGGCAGGATCTGGAGGG + Intergenic
962377977 3:134874632-134874654 GGCTCCTGGAGGCAGCAGGCTGG + Intronic
963393542 3:144701859-144701881 TGCTCCTAGAAAAATCTGGAAGG + Intergenic
964429840 3:156593940-156593962 GGGCCCTGGAAGCCTCTGAAAGG - Intergenic
965610179 3:170535539-170535561 GGCTGCTGGGTGGATCTGGAAGG - Intronic
966216721 3:177511034-177511056 GGCATCTGGAACCATCTGGAGGG + Intergenic
966928369 3:184660028-184660050 GGCTTCTGGAGGCATCCGGGCGG - Intronic
967045881 3:185736264-185736286 GGCCCTTGGAAGGAGCTGGAAGG - Intronic
967186429 3:186948454-186948476 TGCTCCGGGAAGGATCAGGATGG + Intronic
967458433 3:189717462-189717484 TGCTTCCAGAAGCATCTGGATGG + Intronic
967915305 3:194573909-194573931 GGCTGCTAGGAGCAGCTGGAGGG + Intergenic
968054971 3:195684288-195684310 GCCAACTGGAAGCATCTGCAGGG + Intergenic
968100942 3:195964988-195965010 GCCAACTGGAAGCATCTGCAGGG - Intergenic
968357826 3:198122310-198122332 GGCTCCTGGAAGCAGCTGGGAGG + Intergenic
969333974 4:6495927-6495949 GTCTCCCTGAAGCTTCTGGAAGG - Intronic
969623768 4:8292262-8292284 GGCTCCAGGAAGCCTCAGGCGGG + Intronic
969848081 4:9935416-9935438 GGCTCCTGGAAGCAGGTGTTCGG - Intronic
975579055 4:75890797-75890819 GGCAGCTGGAAGCTGCTGGAAGG - Intronic
975665630 4:76732281-76732303 GGAGGCTGGAAGCTTCTGGAAGG + Intronic
979524311 4:121701592-121701614 GGCACCAGGAAGCATCAGGTTGG - Intergenic
984279214 4:177648147-177648169 GGTACCTGGAAGGACCTGGATGG + Intergenic
985440748 4:189981037-189981059 GGCTCCTGGAAGCAGCTGGGAGG - Intergenic
985655633 5:1130199-1130221 GGCTTCTGGAAGATTCTGGAGGG - Intergenic
985724040 5:1506390-1506412 GGGTCATAGAAGCTTCTGGAAGG - Intronic
985734875 5:1573740-1573762 GCCAACTGGAAGCATCTGCAGGG - Intergenic
986105466 5:4655650-4655672 AGCCCATGAAAGCATCTGGACGG - Intergenic
986220309 5:5763170-5763192 AGATGCTGGAAGCATCAGGAGGG - Intergenic
986777642 5:11032603-11032625 GACCTCTGGAAACATCTGGAAGG + Intronic
988768868 5:34410907-34410929 GGCTCCCGCAATCATCTGAATGG - Intergenic
994905701 5:105839116-105839138 AGCTCCTGAAAGCAGCTGGGAGG - Intergenic
996553205 5:124751211-124751233 GTCTCCTGGAAGAACCTGGGAGG - Intergenic
996879280 5:128276523-128276545 GGCTCCTTTAAGCATCTTGTGGG + Intronic
998493685 5:142568478-142568500 GGCCTTTGGAAGCCTCTGGAAGG - Intergenic
998815827 5:146013326-146013348 GGCTGCTGGGAGCACCAGGAAGG + Intronic
999450857 5:151676981-151677003 AACACATGGAAGCATCTGGATGG - Intronic
1001298191 5:170514058-170514080 GGCTCCTGCCTGCAGCTGGAGGG + Intronic
1003500243 6:6697118-6697140 GGCTTCTGGAAGCAGCGCGAGGG + Intergenic
1003960170 6:11201462-11201484 GGTTGCTGGAAGCACATGGAAGG - Intronic
1004202126 6:13558674-13558696 AGCACCTGGCAGCACCTGGAAGG - Intergenic
1006797588 6:36741496-36741518 GGCCCTGGGAAGCCTCTGGAGGG + Exonic
1006878788 6:37321303-37321325 AGCTCCAGGAAGCATCTGGCAGG - Intronic
1007544722 6:42684824-42684846 GGCTGCTGTAATCCTCTGGAAGG - Exonic
1008586727 6:52957482-52957504 GGCTGCTGGCTGCAGCTGGAGGG - Intergenic
1008664930 6:53706745-53706767 GGCTAATGGAAGCACCTGCAGGG - Intergenic
1011162654 6:84409392-84409414 ATCTCCTGGTAGCATCTGGCAGG + Intergenic
1011979242 6:93351482-93351504 CGCTCTGGAAAGCATCTGGAAGG - Intronic
1016349900 6:143155779-143155801 GGTCCCTGGAAGAAACTGGAAGG + Intronic
1016495846 6:144660898-144660920 GGCTCCTGGCACAATCTAGATGG + Intronic
1017334125 6:153235094-153235116 TGCTTGTGGAAGTATCTGGAAGG - Intergenic
1017643596 6:156517862-156517884 GCCTCATGGGAGCAGCTGGATGG + Intergenic
1018207616 6:161450249-161450271 GGGTCCTGCATGCCTCTGGATGG - Intronic
1018889345 6:167972128-167972150 GGATCAAGGAAGCATCAGGAAGG - Intergenic
1019333787 7:473193-473215 GGCTCCTGGGAGCATCTTCCCGG - Intergenic
1019658441 7:2210393-2210415 GGCTCCTAGAATCACCGGGAGGG - Intronic
1019698318 7:2460243-2460265 GGCTCCTGGCAGCCCCAGGAAGG - Intergenic
1020162630 7:5783851-5783873 AGATCCTGGAATCACCTGGAAGG + Intergenic
1021924204 7:25519226-25519248 TGCTGCTGGAAGTACCTGGAGGG - Intergenic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1029184863 7:98731339-98731361 GGCTCCCGGGACCAGCTGGAGGG + Intergenic
1029330228 7:99847298-99847320 GCCTCCTGTAAGCATATGGAAGG - Intronic
1029567026 7:101345775-101345797 AGTTCCTGGAGGCATCTGGAGGG - Intergenic
1029582952 7:101449375-101449397 GGCCCCTGGCAGGATCTAGATGG - Intronic
1029630326 7:101746262-101746284 GCTTCCTGGAAGGGTCTGGAAGG - Intergenic
1030190869 7:106808909-106808931 GCCTCCTGCAACCATCTGAATGG - Intergenic
1031803243 7:126275534-126275556 GGCTCATGAAAGCAGCGGGAGGG - Intergenic
1032159687 7:129501230-129501252 GGGTCCTGGAAGGCTCTGCAAGG - Intergenic
1033147555 7:138884156-138884178 GGGTCCAGGGAGCTTCTGGAAGG + Intronic
1034487115 7:151372964-151372986 GGCTGCTGGAAACATCTCCAGGG - Intronic
1035304847 7:157925398-157925420 GGATTCTGGAAGATTCTGGAGGG - Intronic
1039886521 8:41657115-41657137 TGCTCCAGGAAGGATCAGGAAGG - Intronic
1040291309 8:46126732-46126754 TGCTCCTGAAACCAGCTGGAGGG - Intergenic
1042175990 8:66037306-66037328 GGCTCCTAAAAGGCTCTGGAAGG + Intronic
1043438590 8:80257273-80257295 GGCTCCTGGAATCATAGGAAGGG + Intergenic
1044945114 8:97382254-97382276 GGATCCTGGATGCCTCAGGATGG + Intergenic
1046680900 8:117169115-117169137 GGCTCCTAGAAGCAGATGAAAGG - Intronic
1047201642 8:122772358-122772380 GGAGGCTGGAATCATCTGGAGGG + Intergenic
1048863332 8:138740126-138740148 ATCCCCTGGAAGCAACTGGAGGG - Intronic
1049247820 8:141572048-141572070 GTCTCCTGGAACCAGATGGAGGG + Intergenic
1050905154 9:10994155-10994177 AGCTCGTGAAAGCAGCTGGAAGG + Intergenic
1051057499 9:13004998-13005020 GGAAGCTGGAATCATCTGGAGGG + Intergenic
1051966700 9:22836578-22836600 GTCTCCTGAAAGCAGATGGAAGG + Intergenic
1052828852 9:33198360-33198382 GGCTCCTGGCAGCAGCTGGCTGG + Intergenic
1053045971 9:34917624-34917646 GGCCCCGGGAAGCCACTGGAAGG - Intergenic
1054779991 9:69157134-69157156 GGCCCCTGCAACCATCTGAATGG - Intronic
1055319555 9:75068810-75068832 GGCTCTTGTCAGCTTCTGGATGG - Intronic
1055829437 9:80360659-80360681 GGAGCCTGGCAGGATCTGGATGG - Intergenic
1056808772 9:89748038-89748060 GGGTCTTGGAAGGGTCTGGAGGG + Intergenic
1057441157 9:95084748-95084770 AACCCCTGGATGCATCTGGAGGG - Intronic
1057600356 9:96451177-96451199 GCCTCCTGGAAGCTACCGGACGG - Intronic
1058917978 9:109585996-109586018 GGAGCCTGGCAGCATGTGGAAGG + Intergenic
1059353726 9:113684084-113684106 GGCACCAGAAAGCAGCTGGATGG + Intergenic
1060812120 9:126615758-126615780 GGGTCCTGGGAGCCTCCGGACGG + Intronic
1062102017 9:134733379-134733401 GGCCTATGGAAGCGTCTGGATGG + Intronic
1062206277 9:135339237-135339259 GGCACCTGGAAACGTCTGGAAGG + Intergenic
1062426163 9:136507209-136507231 GGTTCCTGGATGCCTCTGGCCGG + Intronic
1062584920 9:137244924-137244946 GGCTCCTGGAAGCAGCTGGGAGG + Intronic
1062682421 9:137788905-137788927 GGGTCCAGGATGCAGCTGGATGG + Intronic
1062697416 9:137882579-137882601 GGCTCCTTGGAGAATCTGCAGGG + Intronic
1062741667 9:138178790-138178812 GGCTCCTGGAAGCAGCTGGGAGG + Intergenic
1203484156 Un_GL000224v1:36876-36898 GTGTCCTGGAATCATATGGAAGG + Intergenic
1186553124 X:10527886-10527908 TGATCCAGGAAGCACCTGGAGGG - Intronic
1189334744 X:40164234-40164256 GGAGGCTGGAAGCATCCGGAGGG - Intronic
1190604701 X:52128640-52128662 GCCTCCTGCAACCATCTGAATGG + Intergenic
1192694289 X:73398497-73398519 GAAACCTGGGAGCATCTGGAGGG + Intergenic
1194021338 X:88695264-88695286 AGCTCCTGGTGGCATCTGGCAGG + Intergenic
1195716709 X:107825783-107825805 GGCTGCTGGAATCAGCTGGTAGG + Intronic
1196289501 X:113922659-113922681 GGATTCTGGAAGATTCTGGAAGG - Intergenic
1196733454 X:118963797-118963819 TGCTCCTGGAAGCCACGGGAGGG + Intergenic
1199928479 X:152494357-152494379 GGCCCGTGGAAACATCTGGGAGG + Intergenic
1201286875 Y:12386965-12386987 GCCAGGTGGAAGCATCTGGAAGG + Intergenic
1201758577 Y:17515352-17515374 GGCTCCTGGAAGCAGCTAGGAGG - Intergenic
1201842978 Y:18390638-18390660 GGCTCCTGGAAGCAGCTAGGAGG + Intergenic
1202585928 Y:26427024-26427046 GGCTCCTGGAAGCTTGTGCCTGG - Intergenic