ID: 1103049953

View in Genome Browser
Species Human (GRCh38)
Location 12:117770437-117770459
Sequence GTCTGAAATCGGGTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103049953_1103049958 0 Left 1103049953 12:117770437-117770459 CCTGCCAACACCCGATTTCAGAC 0: 1
1: 1
2: 6
3: 28
4: 115
Right 1103049958 12:117770460-117770482 TTTCAAGCCCCTAGAACTGTGGG 0: 2
1: 0
2: 7
3: 57
4: 398
1103049953_1103049962 18 Left 1103049953 12:117770437-117770459 CCTGCCAACACCCGATTTCAGAC 0: 1
1: 1
2: 6
3: 28
4: 115
Right 1103049962 12:117770478-117770500 GTGGGAAAGTATGTTTCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 146
1103049953_1103049957 -1 Left 1103049953 12:117770437-117770459 CCTGCCAACACCCGATTTCAGAC 0: 1
1: 1
2: 6
3: 28
4: 115
Right 1103049957 12:117770459-117770481 CTTTCAAGCCCCTAGAACTGTGG 0: 1
1: 2
2: 4
3: 39
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103049953 Original CRISPR GTCTGAAATCGGGTGTTGGC AGG (reversed) Intronic
900790718 1:4678404-4678426 GGCTGAAACCAGATGTTGGCCGG + Intronic
903322267 1:22550298-22550320 GTCTGAAACTGAGTGGTGGCTGG - Intergenic
904805741 1:33130588-33130610 GGCTGCAATCAGGTGTTGGCTGG - Intergenic
905773205 1:40651438-40651460 GTCTAAAATCAGGTGTTGGCAGG - Intronic
909794002 1:79710605-79710627 GTCCAAAATAAGGTGTTGGCAGG - Intergenic
918435736 1:184510911-184510933 GTCTGAACCAAGGTGTTGGCAGG + Intronic
920508534 1:206534044-206534066 GCTTGAAATCAAGTGTTGGCTGG - Intronic
1076346316 10:129781143-129781165 GTTTGTAATCAGGTGCTGGCGGG - Intergenic
1077577878 11:3398217-3398239 GTCTGAATGCAGGTGTTGGCAGG - Intergenic
1079459002 11:20663449-20663471 ATCTGAAATCAAGGGTTGGCAGG + Intergenic
1081481501 11:43493836-43493858 GTCTGGATTCGGTTCTTGGCTGG - Exonic
1081657812 11:44868800-44868822 GTCTGAAATAGGCCGCTGGCTGG + Intronic
1084231827 11:67759118-67759140 GTCTGAATGCAGTTGTTGGCAGG - Intergenic
1088775439 11:113078115-113078137 GTCTAAAATCAAGTGTCGGCAGG + Intronic
1088838346 11:113599076-113599098 ATCTGAAATAAGGTGTTGGCAGG - Intergenic
1090693841 11:129216099-129216121 GTCTGAAATAAGGTGTGGGCAGG - Intronic
1091324417 11:134675212-134675234 GTCTGACATTGTGTGTTAGCTGG + Intergenic
1094574626 12:31673960-31673982 GGCTAAAATCAGGTGTGGGCAGG + Intronic
1097660680 12:62427371-62427393 GTCTGAAACCAGGTGTTGGCAGG + Intergenic
1098705193 12:73678174-73678196 GTCAGAAATGGGGTCTTGGGTGG - Intergenic
1099686997 12:85902887-85902909 GTCCAAGATCAGGTGTTGGCAGG - Intergenic
1103036430 12:117660576-117660598 TTTGGAAATAGGGTGTTGGCAGG - Intronic
1103049953 12:117770437-117770459 GTCTGAAATCGGGTGTTGGCAGG - Intronic
1103599783 12:122047225-122047247 GTTTGAAATGGGGTCTTGGCCGG + Intronic
1104141033 12:125985711-125985733 GTGTGAGCTCAGGTGTTGGCAGG - Intergenic
1109397916 13:61785013-61785035 GTAAGAAAACAGGTGTTGGCCGG + Intergenic
1113140058 13:107137790-107137812 GGCTGCAATCAAGTGTTGGCTGG + Intergenic
1113627576 13:111858002-111858024 GTCTGAGGCCGGGTGTGGGCAGG + Intergenic
1114976315 14:28105102-28105124 GTTTGAAATCAGGTGTTAGCAGG + Intergenic
1115837460 14:37424516-37424538 GTCTGGAATCAGGTGTCGGCTGG - Intronic
1118919388 14:70136280-70136302 TTCCAAAATCGGGTGCTGGCAGG - Intronic
1120583988 14:86287793-86287815 GTTTGAAATAAGGAGTTGGCAGG + Intergenic
1121403277 14:93701688-93701710 TTCTGAAATAGGGTGATGGCTGG + Intronic
1122082797 14:99277922-99277944 ATCTGAAACAAGGTGTTGGCTGG - Intergenic
1122909509 14:104820350-104820372 GTCTGAAAAGGGGTGTCAGCAGG + Intergenic
1127833122 15:62768244-62768266 GTCTAAAATCAGGTGGTGGCAGG + Intronic
1128516244 15:68343860-68343882 GGCTTAAATGGGGTGTGGGCAGG + Intronic
1129897715 15:79121034-79121056 TTGGGAAATAGGGTGTTGGCTGG + Intergenic
1132099109 15:99010390-99010412 TTCAGAAATCGTGTGCTGGCTGG - Intergenic
1135332790 16:21574628-21574650 GACTGAACTCGTGTGTTGGTGGG - Intergenic
1136006489 16:27333787-27333809 GTCAGAAGTGGGGTGTTCGCAGG + Intronic
1141140100 16:81491733-81491755 GTCTGAACTCGGGAGCTGGATGG + Intronic
1142013510 16:87730248-87730270 ATCTAAAATGGGGTTTTGGCTGG - Intronic
1142905680 17:3040137-3040159 TTGTGGAATCGGTTGTTGGCAGG + Intergenic
1143691281 17:8568232-8568254 GTCTGAAGCAAGGTGTTGGCAGG - Intronic
1144334756 17:14258709-14258731 GACTGTGATCAGGTGTTGGCTGG + Intergenic
1149670344 17:58402807-58402829 GCCTGAACTCAGGTCTTGGCAGG - Intronic
1151313777 17:73310128-73310150 CCCAGAAATCGGGAGTTGGCTGG - Intronic
1151379263 17:73713569-73713591 GTCTGAAATTGGCTGCTGGGAGG + Intergenic
1151896102 17:76981992-76982014 GTCTGAACTGGGGTGTGGGTGGG - Intergenic
1153127769 18:1816724-1816746 GTCTGAAATTAGGTGTTGGCAGG - Intergenic
1160764131 19:799570-799592 GTCTGGAATCTGGAGTTGGGCGG + Intronic
1162379262 19:10322343-10322365 GCCTGAAACTGGGTGTGGGCTGG - Intronic
1163466891 19:17473166-17473188 GGCTGAAATTGGGTGATCGCTGG - Intronic
1165705867 19:37975806-37975828 TTCAGAAATGGGGGGTTGGCCGG + Intronic
1165761772 19:38325883-38325905 GACTGAACTCAGGTGTTGGCAGG + Intronic
1167264393 19:48476432-48476454 ATCTGGACTGGGGTGTTGGCTGG - Intronic
1168078784 19:53994250-53994272 GTCTGCCCTCGGGTGTTGGGAGG - Intronic
926123228 2:10256041-10256063 GTCAGAAAACGAGTGTTGGGAGG + Intergenic
927816520 2:26222262-26222284 GTCTAAGATCAGGTGTTAGCAGG - Intronic
928094053 2:28393287-28393309 GTCTGAAATCGGGGGTCCCCAGG + Exonic
937534006 2:122863864-122863886 GGCTGAAATTGGGTTTTGGCAGG + Intergenic
937855815 2:126671381-126671403 TTCTGAACTTGGGTGTTAGCTGG - Intronic
938102401 2:128506066-128506088 GGCTGAGAAAGGGTGTTGGCAGG - Intergenic
942330720 2:174821183-174821205 GGCTAAAATCAGGTGTTAGCGGG + Intronic
944022306 2:195120817-195120839 TTCTCAAATGGGGTGTTGACTGG - Intergenic
945010547 2:205458111-205458133 GTCTGTGAGCGTGTGTTGGCAGG + Intronic
946127065 2:217572265-217572287 CTCTGAAATCCAGTGGTGGCTGG - Intronic
947352502 2:229261203-229261225 GTCTGAAATCAGATGCTGGCAGG - Intronic
948039085 2:234884928-234884950 GTCTGAAATCAAGTGTGAGCAGG - Intergenic
948784572 2:240345683-240345705 GTCAGAATTGGGGTGTGGGCAGG + Intergenic
1169382343 20:5119346-5119368 GTCACAAAGCGGGTGGTGGCGGG - Intronic
1170608317 20:17890558-17890580 GGCTGCAGTCAGGTGTTGGCTGG - Intergenic
1172294356 20:33798083-33798105 GACTAAAATCAAGTGTTGGCAGG + Intergenic
1178422166 21:32451623-32451645 GTCTGAATCCAGGTGTTGGCAGG + Intronic
1179385523 21:40938316-40938338 GTCTGAAGTCAGGGGTTGGCAGG + Intergenic
1179553995 21:42160769-42160791 ACCTGAAAACGGGGGTTGGCAGG - Intergenic
949284523 3:2385543-2385565 GTCCAAAATCAGGTGTTGGTAGG + Intronic
949436500 3:4035266-4035288 GTCTGAAATCAAGTGTTGGTAGG + Intronic
949754548 3:7393475-7393497 GTCTCAAATCGGTTTCTGGCTGG + Intronic
950109735 3:10411321-10411343 GTCAGAAATCAGGTGTCAGCAGG - Intronic
950971528 3:17193430-17193452 TTTTGAAGTCAGGTGTTGGCAGG + Intronic
952368420 3:32696017-32696039 ATTTGAAATGGGGTCTTGGCCGG + Intronic
955315841 3:57938272-57938294 GGCTTAAATCGGGGGTTGGGGGG + Intergenic
956788242 3:72660567-72660589 GGCTGAAATCAGGTGGTAGCTGG + Intergenic
957048457 3:75394421-75394443 GTCTGAATGCAGGTGTTGGCAGG - Intergenic
957813963 3:85267261-85267283 GTCTGAAATGTGGTTTTGTCTGG + Intronic
959872592 3:111345538-111345560 GGCTAAAATCAGGTGTTGGTAGG - Intronic
960049817 3:113228750-113228772 GTATGAAATAGGGTGTTGTAGGG + Intronic
961880537 3:130058534-130058556 GGCTGAATGCAGGTGTTGGCAGG - Intergenic
962307191 3:134299380-134299402 CTCTGAAATTGGGTGTGTGCAGG + Intergenic
965917967 3:173874065-173874087 GTCCAAGATCAGGTGTTGGCAGG - Intronic
966462411 3:180191338-180191360 GTCTTAAATCAAGTGTTGGCAGG - Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968936842 4:3615616-3615638 GTCTGAGATCAGGGGTTGTCAGG + Intergenic
968992929 4:3926878-3926900 GTCTGAATCCAGGTGTTGGCAGG - Intergenic
969286072 4:6202556-6202578 GTCTGAAATCAGGTGTCAGCTGG - Intergenic
969822545 4:9731483-9731505 GTCTGAATCCAGGTGTTGGCAGG + Intergenic
971368313 4:25995097-25995119 GTCTGAGATCAGGTGTTGACTGG - Intergenic
974361783 4:60890261-60890283 GTCTGAGATGAGGTGTTGGCAGG - Intergenic
975517891 4:75267173-75267195 GGCTGAAATCAGGTGATTGCTGG - Intergenic
978523951 4:109645591-109645613 GTCTGAAATAGAGGGTTGGGAGG - Intronic
981066906 4:140495331-140495353 ATATGATATCAGGTGTTGGCAGG - Intronic
982323746 4:154108205-154108227 GTCTGAAATTCAGTGTTGACAGG - Intergenic
984740661 4:183158377-183158399 GTCTGAGACCGGGTGTAGGCAGG + Intronic
986584271 5:9298387-9298409 ATCTAAAATCAAGTGTTGGCAGG - Intronic
987221367 5:15793273-15793295 GTCTGAAATCAGGTGTCAGCAGG + Intronic
987565436 5:19578084-19578106 GTCTGGAATCAGGAGTTGGTGGG - Intronic
990906263 5:60806660-60806682 GTCTAAAATCAAGTGTTGGTAGG + Intronic
995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG + Intergenic
1003741713 6:8948085-8948107 GCCTGAGATCAAGTGTTGGCAGG + Intergenic
1004558129 6:16719901-16719923 GTCTGAAATCAGGTGTCAGCCGG - Intronic
1007170168 6:39857072-39857094 GTCTGAAAGCTGGTCTGGGCGGG - Intronic
1010308964 6:74360165-74360187 GTCTGAAATAGGGTGCCAGCAGG + Intergenic
1010599575 6:77807262-77807284 GCCTGAAATAGGGTGATGGCAGG + Intronic
1013052484 6:106549637-106549659 TTCTGAAATCGGGGGATGGGGGG + Intronic
1020315571 7:6903227-6903249 GTCTGAATGCAGATGTTGGCAGG - Intergenic
1020898909 7:13977694-13977716 GTCAGAAATAGGATGATGGCAGG + Intronic
1022586483 7:31618227-31618249 GGCAGAAATTGGGTGGTGGCTGG - Intronic
1029191455 7:98775050-98775072 GTCTGACATCAGGTGTCAGCAGG - Intergenic
1029869792 7:103678466-103678488 GTCCGAAATCCGGTGTTGATAGG - Intronic
1030295109 7:107916930-107916952 GTTTGAAATCTGGTATTGACTGG - Exonic
1031172221 7:118306810-118306832 GTCTGAAATCAAGAGCTGGCAGG + Intergenic
1033612991 7:142984077-142984099 GTCTGGTGTGGGGTGTTGGCTGG + Intergenic
1035050085 7:155993713-155993735 GTCTGATATCAGGTGTGGGCAGG + Intergenic
1035153713 7:156895286-156895308 GTGGGAAAGAGGGTGTTGGCTGG - Intergenic
1035469121 7:159098428-159098450 GCCTGAAAGCTGGTCTTGGCAGG + Intronic
1036212733 8:6855276-6855298 GTCTGAAATCTGGTGTTGGCCGG + Intergenic
1040860945 8:51998897-51998919 GTCTGACTTAGGGTGTTGGGTGG + Intergenic
1042126375 8:65541300-65541322 GTCTGAAATTAGGTCTTGACTGG - Intergenic
1042537914 8:69877603-69877625 GTCTAAAATCAGGTGTCAGCAGG + Intergenic
1043030405 8:75127439-75127461 GGCTGAAATTCAGTGTTGGCAGG - Intergenic
1044345848 8:91103312-91103334 CTTTGAAATGGAGTGTTGGCAGG + Intronic
1046686632 8:117234935-117234957 GTTTGTAGTCGGATGTTGGCTGG - Intergenic
1047299276 8:123599130-123599152 GTCTAAAATCTGGAGTGGGCCGG + Intergenic
1048206812 8:132422096-132422118 AGGTGAAATCTGGTGTTGGCAGG - Intronic
1048291091 8:133182311-133182333 ATCAGAAATTGGGTGTTGTCTGG - Intergenic
1048590563 8:135817245-135817267 GTCTGAAATAGGTTGTTAGCAGG - Intergenic
1052605962 9:30701031-30701053 GTCAGAAATCGGGTGATTGTAGG + Intergenic
1052674696 9:31605320-31605342 GTCTGAAATCAGGTGTTGGTGGG - Intergenic
1056772914 9:89492643-89492665 GTCTTGGATCGGGTGTTGGAAGG - Intronic
1059621707 9:116012984-116013006 GTCTGAAATCAGGTATTGGCAGG + Intergenic
1185610075 X:1389140-1389162 GTCTGAGATAAGGTGTGGGCAGG - Intronic
1186496745 X:10016559-10016581 GTCTGACATCAGGTTTTGGATGG - Intronic
1188981704 X:36732791-36732813 GTCTGAAATCAAGTGTTGGCAGG - Intergenic
1192359208 X:70427778-70427800 GTCTGAAAAAGGGTGTTTCCAGG + Intronic
1193725036 X:85028176-85028198 GTCTAAAACAAGGTGTTGGCAGG + Intronic
1194008753 X:88531814-88531836 GTCTGAAAACGGGATTTGACAGG + Intergenic
1195404800 X:104501239-104501261 GTCTAAAGATGGGTGTTGGCTGG + Intergenic
1198187171 X:134264801-134264823 GACTGCAATCAAGTGTTGGCTGG + Intergenic
1201254873 Y:12097407-12097429 GGCTGAAATCATGTGTTGTCAGG - Intergenic