ID: 1103050381

View in Genome Browser
Species Human (GRCh38)
Location 12:117774335-117774357
Sequence TTGCTAATGTTGAATTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050381_1103050385 30 Left 1103050381 12:117774335-117774357 CCAAAGTAATTCAACATTAGCAA 0: 1
1: 0
2: 1
3: 11
4: 244
Right 1103050385 12:117774388-117774410 TTGGCATTCAGCAGAACCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 148
1103050381_1103050384 29 Left 1103050381 12:117774335-117774357 CCAAAGTAATTCAACATTAGCAA 0: 1
1: 0
2: 1
3: 11
4: 244
Right 1103050384 12:117774387-117774409 CTTGGCATTCAGCAGAACCCTGG 0: 1
1: 0
2: 5
3: 19
4: 186
1103050381_1103050382 11 Left 1103050381 12:117774335-117774357 CCAAAGTAATTCAACATTAGCAA 0: 1
1: 0
2: 1
3: 11
4: 244
Right 1103050382 12:117774369-117774391 TAAGACCTCATTAATGAGCTTGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050381 Original CRISPR TTGCTAATGTTGAATTACTT TGG (reversed) Intronic