ID: 1103050381 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:117774335-117774357 |
Sequence | TTGCTAATGTTGAATTACTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 257 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 244} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103050381_1103050385 | 30 | Left | 1103050381 | 12:117774335-117774357 | CCAAAGTAATTCAACATTAGCAA | 0: 1 1: 0 2: 1 3: 11 4: 244 |
||
Right | 1103050385 | 12:117774388-117774410 | TTGGCATTCAGCAGAACCCTGGG | 0: 1 1: 0 2: 0 3: 12 4: 148 |
||||
1103050381_1103050384 | 29 | Left | 1103050381 | 12:117774335-117774357 | CCAAAGTAATTCAACATTAGCAA | 0: 1 1: 0 2: 1 3: 11 4: 244 |
||
Right | 1103050384 | 12:117774387-117774409 | CTTGGCATTCAGCAGAACCCTGG | 0: 1 1: 0 2: 5 3: 19 4: 186 |
||||
1103050381_1103050382 | 11 | Left | 1103050381 | 12:117774335-117774357 | CCAAAGTAATTCAACATTAGCAA | 0: 1 1: 0 2: 1 3: 11 4: 244 |
||
Right | 1103050382 | 12:117774369-117774391 | TAAGACCTCATTAATGAGCTTGG | 0: 1 1: 0 2: 1 3: 9 4: 119 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103050381 | Original CRISPR | TTGCTAATGTTGAATTACTT TGG (reversed) | Intronic | ||