ID: 1103050383

View in Genome Browser
Species Human (GRCh38)
Location 12:117774374-117774396
Sequence GAATGCCAAGCTCATTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050383_1103050385 -9 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050385 12:117774388-117774410 TTGGCATTCAGCAGAACCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 148
1103050383_1103050390 19 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050390 12:117774416-117774438 TTGGGCACTAGCCCCGCCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 118
1103050383_1103050392 30 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050392 12:117774427-117774449 CCCCGCCCCAGGATGTCCCCAGG 0: 1
1: 0
2: 5
3: 33
4: 291
1103050383_1103050387 1 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050387 12:117774398-117774420 GCAGAACCCTGGGTCTCGTTGGG 0: 1
1: 0
2: 2
3: 2
4: 93
1103050383_1103050384 -10 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050384 12:117774387-117774409 CTTGGCATTCAGCAGAACCCTGG 0: 1
1: 0
2: 5
3: 19
4: 186
1103050383_1103050386 0 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050386 12:117774397-117774419 AGCAGAACCCTGGGTCTCGTTGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050383 Original CRISPR GAATGCCAAGCTCATTAATG AGG (reversed) Intronic