ID: 1103050384

View in Genome Browser
Species Human (GRCh38)
Location 12:117774387-117774409
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050381_1103050384 29 Left 1103050381 12:117774335-117774357 CCAAAGTAATTCAACATTAGCAA 0: 1
1: 0
2: 1
3: 11
4: 244
Right 1103050384 12:117774387-117774409 CTTGGCATTCAGCAGAACCCTGG 0: 1
1: 0
2: 5
3: 19
4: 186
1103050383_1103050384 -10 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050384 12:117774387-117774409 CTTGGCATTCAGCAGAACCCTGG 0: 1
1: 0
2: 5
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type