ID: 1103050387

View in Genome Browser
Species Human (GRCh38)
Location 12:117774398-117774420
Sequence GCAGAACCCTGGGTCTCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050383_1103050387 1 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050387 12:117774398-117774420 GCAGAACCCTGGGTCTCGTTGGG 0: 1
1: 0
2: 2
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050387 Original CRISPR GCAGAACCCTGGGTCTCGTT GGG Intronic