ID: 1103050390

View in Genome Browser
Species Human (GRCh38)
Location 12:117774416-117774438
Sequence TTGGGCACTAGCCCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050383_1103050390 19 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050390 12:117774416-117774438 TTGGGCACTAGCCCCGCCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050390 Original CRISPR TTGGGCACTAGCCCCGCCCC AGG Intronic