ID: 1103050392

View in Genome Browser
Species Human (GRCh38)
Location 12:117774427-117774449
Sequence CCCCGCCCCAGGATGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050389_1103050392 -1 Left 1103050389 12:117774405-117774427 CCTGGGTCTCGTTGGGCACTAGC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1103050392 12:117774427-117774449 CCCCGCCCCAGGATGTCCCCAGG 0: 1
1: 0
2: 5
3: 33
4: 291
1103050383_1103050392 30 Left 1103050383 12:117774374-117774396 CCTCATTAATGAGCTTGGCATTC 0: 1
1: 0
2: 2
3: 9
4: 181
Right 1103050392 12:117774427-117774449 CCCCGCCCCAGGATGTCCCCAGG 0: 1
1: 0
2: 5
3: 33
4: 291
1103050388_1103050392 0 Left 1103050388 12:117774404-117774426 CCCTGGGTCTCGTTGGGCACTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103050392 12:117774427-117774449 CCCCGCCCCAGGATGTCCCCAGG 0: 1
1: 0
2: 5
3: 33
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050392 Original CRISPR CCCCGCCCCAGGATGTCCCC AGG Intronic