ID: 1103050958

View in Genome Browser
Species Human (GRCh38)
Location 12:117779060-117779082
Sequence CTGTCTTTGCAGAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 360}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103050958_1103050963 11 Left 1103050958 12:117779060-117779082 CCAATTTCCCTCTGCAAAGACAG 0: 1
1: 0
2: 1
3: 43
4: 360
Right 1103050963 12:117779094-117779116 CCTTCAGAGCCAGGTGTGCCAGG 0: 1
1: 0
2: 0
3: 34
4: 297
1103050958_1103050966 28 Left 1103050958 12:117779060-117779082 CCAATTTCCCTCTGCAAAGACAG 0: 1
1: 0
2: 1
3: 43
4: 360
Right 1103050966 12:117779111-117779133 GCCAGGAGGTCAATTTGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 101
1103050958_1103050961 2 Left 1103050958 12:117779060-117779082 CCAATTTCCCTCTGCAAAGACAG 0: 1
1: 0
2: 1
3: 43
4: 360
Right 1103050961 12:117779085-117779107 CTTATGAAGCCTTCAGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 179
1103050958_1103050964 14 Left 1103050958 12:117779060-117779082 CCAATTTCCCTCTGCAAAGACAG 0: 1
1: 0
2: 1
3: 43
4: 360
Right 1103050964 12:117779097-117779119 TCAGAGCCAGGTGTGCCAGGAGG 0: 1
1: 0
2: 5
3: 29
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103050958 Original CRISPR CTGTCTTTGCAGAGGGAAAT TGG (reversed) Intronic
900303371 1:1989187-1989209 CCGTCTTTGCAGACGGACAGCGG + Intronic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
901781476 1:11597604-11597626 TGGTCCTTGCAGAGGGAGATGGG + Intergenic
902661221 1:17905388-17905410 CTGTCTGTCCAGGGGAAAATAGG + Intergenic
902987826 1:20166209-20166231 CAGACTTTGCAGAGGGAGAGTGG - Intronic
903770129 1:25758580-25758602 CTGTCTTTTCAGTGGGAACTGGG + Exonic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904945677 1:34197152-34197174 GTGGCTTTGCAGAAGGACATAGG - Intronic
905826879 1:41032556-41032578 CTGGCTTTTCTGAGTGAAATAGG + Intronic
905992435 1:42350295-42350317 CTGGCTTTGAAGATGGAAGTGGG - Intergenic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
906789748 1:48648444-48648466 CTCTCTTGGAAGAGGGAAGTGGG - Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907542883 1:55232704-55232726 CTGTCTCTGTGGAGGAAAATGGG + Intergenic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
907961208 1:59283513-59283535 CTGCCTTTGCACTGGGATATAGG - Intergenic
908780846 1:67687936-67687958 ATGACTTTGCAGATGGAAAGAGG + Exonic
910364470 1:86449627-86449649 CTGCCTTTGCAGTGGGGAAGAGG + Intronic
910684793 1:89905222-89905244 ATGTCTTAGCACATGGAAATAGG - Intronic
911241032 1:95466950-95466972 CTGTCTTTGCAGAATGAGTTTGG + Intergenic
912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG + Intronic
912833081 1:112970811-112970833 CTATGTGTGCAGGGGGAAATGGG - Intergenic
912851596 1:113130367-113130389 ATCTCTTTTCATAGGGAAATGGG - Exonic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
913986885 1:143573534-143573556 CTGTCTTACCTCAGGGAAATTGG + Intergenic
914838521 1:151228449-151228471 CTGTCTTTGTGGAGGAAAAGGGG - Intronic
915214445 1:154330485-154330507 CTCTGTTTGGAGAGGGGAATGGG + Intronic
915280560 1:154819582-154819604 TTCTCTTGCCAGAGGGAAATGGG - Intronic
916807949 1:168278560-168278582 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
921082513 1:211754139-211754161 CTTACTCTGGAGAGGGAAATAGG - Intronic
924325737 1:242892461-242892483 CTTTCTTTGGAGACAGAAATTGG + Intergenic
924844171 1:247748912-247748934 CTGTATTTGTATAGGTAAATAGG - Intergenic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1063448560 10:6135830-6135852 CTTTCTTTGTAGGGGTAAATGGG - Intergenic
1064244161 10:13656357-13656379 CTGTCTTTACAAGGAGAAATGGG + Intronic
1064583278 10:16815316-16815338 ATGTCTTGGCAGAAGGAAAAGGG - Intronic
1065403378 10:25332572-25332594 CTGTATTTGCAGAGGCATTTGGG + Intronic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1071297751 10:84234441-84234463 CTGTCCTTCCAGAGGGGAAGGGG - Intronic
1072042765 10:91625225-91625247 TAGTCTCTGCACAGGGAAATGGG - Intergenic
1072240752 10:93493452-93493474 TTGTGTTTGCATTGGGAAATAGG + Intergenic
1072737701 10:97889965-97889987 CTGTCCTTCCAGAGGGGACTGGG + Intronic
1072763267 10:98075794-98075816 TTATCTTTGGAGAGGGAAGTGGG + Intergenic
1073725423 10:106224624-106224646 CTGCTTTTGCAGAAAGAAATAGG - Intergenic
1075674756 10:124288675-124288697 TTGTCTGTGCTGCGGGAAATAGG + Intergenic
1076291849 10:129351560-129351582 CTGACTTTGCAGATGTAATTCGG + Intergenic
1076493548 10:130880898-130880920 ATGTGTTTACCGAGGGAAATTGG - Intergenic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1078349864 11:10583724-10583746 CAGTCTTTGCAAAAGGAAATAGG + Intronic
1078619899 11:12897629-12897651 CTGTCTTTGCCAAAGGAAACTGG - Intronic
1079193765 11:18305701-18305723 CTATCTTTTCAGAGTGAAGTTGG - Intronic
1079457311 11:20648047-20648069 CTGTGTTTGCAGTGTGAAGTGGG - Intronic
1079535734 11:21513000-21513022 CTGGCTTTGATTAGGGAAATAGG - Intronic
1080432922 11:32215249-32215271 CTGACTGTGCAGAGGGGAACGGG - Intergenic
1081334167 11:41843265-41843287 ATGTCTTTGCTGTGGTAAATAGG - Intergenic
1082844215 11:57714172-57714194 GTGTCTGTGGAGAGAGAAATCGG + Intronic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083638120 11:64131165-64131187 CAGGCACTGCAGAGGGAAATGGG + Intronic
1083724564 11:64621469-64621491 CTTTCTTTGCAGAGAGGAAGTGG + Intronic
1085564133 11:77497548-77497570 CTGGCTTAGGAGAGGGACATGGG + Intergenic
1086887351 11:92221655-92221677 CTTTCCTTGCAGATGGAAAGAGG + Intergenic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1087195713 11:95302533-95302555 ATGGATTTGGAGAGGGAAATTGG + Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1088992096 11:114962542-114962564 CTGTCTTTACTGAGGGAGAAGGG - Intergenic
1089047284 11:115513267-115513289 ATGTTTTTGCAGAGGGCAAGAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090711029 11:129385392-129385414 CTGTCCTTTCAGAAGGAAAAAGG + Intronic
1090816754 11:130303881-130303903 CTGTCTTGCAAGAGTGAAATGGG - Intronic
1091184565 11:133636121-133636143 CTGACTTTGCAGAGTGAAGCTGG - Intergenic
1091826817 12:3519120-3519142 CCGTCTTTGCAGACGGACAGAGG + Intronic
1092662909 12:10758181-10758203 CTGTCTTTGTGGAGAGAAATGGG + Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1094694304 12:32802402-32802424 CTTTCTCTGCAGAATGAAATTGG - Exonic
1096158122 12:49353205-49353227 CTCACTTTGCAGAGGAAGATTGG + Exonic
1096475875 12:51908331-51908353 CTGTCCTTGGAGAAGGAAAGAGG - Intronic
1096985087 12:55750883-55750905 CTCTCTTGGCTGAGGGAATTTGG - Exonic
1097952121 12:65443014-65443036 CTGCCTTCACAAAGGGAAATAGG + Intronic
1098391824 12:69977645-69977667 ATGTCTTTGCAGTGGGGAAAGGG - Intergenic
1098747926 12:74264343-74264365 CTTTCTTTGGAGACAGAAATTGG - Intergenic
1098881711 12:75924210-75924232 CTTTCTGTGCAGAGAGCAATGGG - Intergenic
1099727747 12:86455269-86455291 CTGTCTTTCCAAAAGGCAATGGG + Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1101559585 12:105843744-105843766 CTGTCCTTGCAAATGGAAAAAGG - Intergenic
1102376139 12:112422682-112422704 GTGTCTTTGCAGTGGAAACTGGG + Intronic
1102413371 12:112739522-112739544 CTGTCATTCCATATGGAAATGGG - Intronic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1104245299 12:127034521-127034543 CTTTCTTTTCAGAGAGAAAAGGG - Intergenic
1104651984 12:130541632-130541654 ATTTCTTTGCCAAGGGAAATTGG + Intronic
1104908547 12:132228452-132228474 CTGTCTTGCCAGAGGCAAAGAGG - Intronic
1106674129 13:31939768-31939790 GTGTCTTTAGAGAGGGAAATGGG + Intergenic
1107158030 13:37192570-37192592 CTGCCTTTGCAGTGGGGAATTGG + Intergenic
1109388439 13:61664382-61664404 TTGTCTTTACTGAGGGAAATTGG - Intergenic
1110768534 13:79307883-79307905 CTGTCTTTGCAGACAGACAGAGG + Intergenic
1111131186 13:83977833-83977855 CTCTCTTCCCACAGGGAAATAGG + Intergenic
1111324708 13:86678631-86678653 TTGTCTTTGCAGATGTAATTAGG - Intergenic
1111693004 13:91588670-91588692 CTGACTTTGCAAAGGAAAAGAGG - Intronic
1111878514 13:93925862-93925884 CTGTCTTTGGGGACTGAAATGGG + Intronic
1114352287 14:21866355-21866377 CTCTCTTTGTAAAGTGAAATTGG - Intergenic
1114951983 14:27766120-27766142 CTGCCTTTGAAGACGGAAAAGGG + Intergenic
1116654221 14:47631017-47631039 CTATCTTTTCAGAGGAAAAAAGG - Intronic
1118487089 14:66224524-66224546 CTGTCTTTGAAGAGGCAGAGGGG + Intergenic
1118883960 14:69851411-69851433 CAGTCTTGGCAGAGAGGAATGGG - Intergenic
1118887234 14:69877870-69877892 CTTTCTTGTCAGAGGGCAATGGG + Intronic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1120383310 14:83810686-83810708 CTGGCTTTGAAGATGGAATTAGG - Intergenic
1120504560 14:85338675-85338697 GTGTCTTTGCAGAGTGAGGTGGG + Intergenic
1120996358 14:90421276-90421298 CAGTGTTTGAAGAGGGAGATTGG - Intergenic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1123883414 15:24697116-24697138 CCGTCTTTGCAGACGGACAGAGG - Intergenic
1124378230 15:29141954-29141976 CTGTAATTGCATAAGGAAATAGG + Intronic
1124823345 15:33069129-33069151 CTGTTTTTGTTGAGGCAAATTGG - Intronic
1124881341 15:33645712-33645734 TTGTGTGTGGAGAGGGAAATGGG - Intronic
1125161302 15:36647645-36647667 CTGTCTGTGCTAAGGTAAATTGG + Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1126449449 15:48789720-48789742 CTGGCTTTGAAGATGGAAATGGG + Intronic
1126452718 15:48827011-48827033 CTGTCTATGCATAGGGTACTAGG - Intronic
1126533130 15:49732452-49732474 CTTTCTTTGCAGGCAGAAATTGG + Intergenic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1127151087 15:56076146-56076168 CTGTCTTCGGATGGGGAAATGGG - Intergenic
1127917605 15:63468084-63468106 CTTTCTTTTAAGAAGGAAATAGG - Intergenic
1128698799 15:69788971-69788993 CTCCCTTTGCAGATGGAAAGAGG - Intergenic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129341907 15:74891713-74891735 CTGGCTTTGCAGAGCTAAATTGG - Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1129627580 15:77218838-77218860 CAGTCTGTGCAGTGTGAAATGGG - Intronic
1129658063 15:77537697-77537719 CTCTCTGTGCAATGGGAAATTGG + Intergenic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133678127 16:8095188-8095210 CTGCCTTTGAACTGGGAAATTGG - Intergenic
1134883998 16:17773776-17773798 CTGACTGTGCAGGGGGAAATGGG + Intergenic
1135308298 16:21385793-21385815 CTGTCTTTGAACAGGGAGTTTGG + Intergenic
1136156787 16:28388473-28388495 CAGTCATGGCAGAGGGGAATGGG - Intronic
1136206299 16:28726808-28726830 CAGTCATGGCAGAGGGGAATGGG + Intronic
1136305042 16:29364920-29364942 CTGTCTTTGAACAGGGAGTTTGG + Intergenic
1137836109 16:51594137-51594159 TTGTCTTTGCAGAGGGATCATGG + Intergenic
1138807997 16:60114420-60114442 CTGTCTTTACAAAATGAAATTGG + Intergenic
1139198409 16:64948448-64948470 CTTCCTTTGCAAAGAGAAATTGG - Intronic
1141205270 16:81928581-81928603 GTCTCTTTGCAGAGGAATATTGG + Exonic
1141462882 16:84188289-84188311 CTGGCTTTGAAGATGGAAAGGGG - Intergenic
1141536224 16:84682180-84682202 CTGTCTTTGAGGTGGGACATTGG + Intergenic
1145001890 17:19311194-19311216 CTGTCCCTGCAGTGGGAAACAGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151550311 17:74818918-74818940 CCTTCTTTGCAAAGGAAAATGGG - Intronic
1152174628 17:78779682-78779704 CTGGCTTTGAAGATGGAAAGGGG + Intronic
1153830811 18:8920938-8920960 CTTTCTTTGGAGGGAGAAATTGG - Intergenic
1153852438 18:9108332-9108354 CTGTATTTTCAGATAGAAATAGG - Intronic
1155505001 18:26524726-26524748 CTGTCTCTAAAGAGGAAAATGGG + Intronic
1155745260 18:29348601-29348623 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
1157047364 18:44118545-44118567 CTTTCTTTTCAGAGGGCACTTGG - Intergenic
1157383512 18:47243126-47243148 CTGTCTTGGTAGAGAGGAATGGG + Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158252597 18:55506289-55506311 CTCTCTTTGCAGAGAGGATTAGG + Intronic
1159174811 18:64818863-64818885 CTGGCATTTGAGAGGGAAATGGG - Intergenic
1159370961 18:67527219-67527241 CTGTCCTTGGAGACAGAAATTGG + Intergenic
1159935538 18:74363945-74363967 CTGTCTTGGCAGTGTGAAACTGG + Intergenic
1160504757 18:79420770-79420792 ATGTCGTTGCAGAGGGCAAGAGG + Intronic
1161759658 19:6161699-6161721 TGGCCTTTGCAAAGGGAAATGGG + Intronic
1161842738 19:6692806-6692828 CAATCTTTGCAAAGGGAATTGGG + Intronic
1163148818 19:15399436-15399458 CTGTCCTGGCAGAGCCAAATTGG - Intronic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1163589545 19:18184461-18184483 CTGCCTCTGCAGATGCAAATTGG - Intergenic
1164453687 19:28388880-28388902 CAGTCATGGCAGAGGGAAAGGGG - Intergenic
1165598761 19:37034944-37034966 TTCACTTTGCTGAGGGAAATAGG + Intronic
1166403380 19:42501001-42501023 CTGTCCTTGAAGAGGAAATTGGG + Intergenic
1166653138 19:44590511-44590533 CTTTCTTTGGAGGGAGAAATTGG - Intergenic
1168219984 19:54953644-54953666 CTTTCTTTGGAGGTGGAAATTGG + Intronic
925329055 2:3044076-3044098 CTGTGTTTGGAGAGGGATTTAGG + Intergenic
926828451 2:16933742-16933764 CTCTCTTTTCTGAGGGAAAGAGG - Intergenic
926944636 2:18173739-18173761 CTGACCTAGCAGAGGCAAATGGG + Intronic
927010312 2:18897252-18897274 CTGTCATTGCAGATGGGACTTGG + Intergenic
927031995 2:19130455-19130477 GAGTCTCTGCAGAGGGACATGGG - Intergenic
927189968 2:20510846-20510868 GGGTCTTTGCAGAGGTAATTAGG - Intergenic
927968960 2:27292003-27292025 CTGTCTTGGGAGAGAGAAATCGG - Intronic
928550543 2:32366406-32366428 CTGTCTTTTCAGTGGGATCTTGG + Intronic
928664966 2:33541140-33541162 CTAATTTTGCAGAGGGCAATGGG + Intronic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929795740 2:45057007-45057029 CTGACTTTGAAGAGGGACATTGG + Intergenic
929909774 2:46079799-46079821 CTGTCTTTGAAGAGAAAACTAGG - Intronic
930467783 2:51776104-51776126 CTGTCTTTTCAGGGTCAAATTGG - Intergenic
931059667 2:58512968-58512990 CTGTCATTGGAGAGTGAAATGGG - Intergenic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
934952638 2:98588521-98588543 CTGTCTTTTCAAAGATAAATTGG - Exonic
935072039 2:99703243-99703265 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935082389 2:99810870-99810892 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935612002 2:105035538-105035560 CTTTCTTTGGAGGGAGAAATGGG + Intergenic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
935869296 2:107427690-107427712 CTTTGTTTGGAGAGAGAAATGGG - Intergenic
937519737 2:122697741-122697763 CTGGCTTTGAAGATGGAGATAGG - Intergenic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
938883924 2:135623977-135623999 CTGTCTATACAGAGAGACATGGG + Intronic
938949526 2:136244013-136244035 CTGTCCCTGCAGAGAGAAAGGGG + Intergenic
939669198 2:144988817-144988839 CTGTCTTTGTTGGAGGAAATGGG + Intergenic
940138458 2:150465488-150465510 CTGTCTTTGAAGACAGAAAAAGG - Intergenic
943838859 2:192552128-192552150 CTGCCTTTTCAGAAGGACATAGG + Intergenic
943898241 2:193396787-193396809 GAGTCTATGCAGAGGAAAATGGG + Intergenic
944352362 2:198743998-198744020 CTGTCTCTGTAGAGGTGAATAGG - Intergenic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
947406680 2:229785304-229785326 CTGATTTTGCAAAGTGAAATGGG + Intronic
947815071 2:233031562-233031584 CAGCCTTTGCAGAGGGCAAGTGG - Intergenic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
948600389 2:239104600-239104622 CCGTCTGTCCAGAGGGAACTTGG - Intronic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1171097628 20:22347027-22347049 TTGTCTGTCCAGAGGGAAATAGG - Intergenic
1171567202 20:26206246-26206268 CTGTCTTTCCAGAGAGTACTTGG - Intergenic
1171964478 20:31518995-31519017 CTGCCTCTGAGGAGGGAAATAGG - Intronic
1172066555 20:32224791-32224813 CTGTCTAGCAAGAGGGAAATAGG + Intronic
1172225051 20:33299901-33299923 CGGTCAATGCTGAGGGAAATGGG - Exonic
1173051940 20:39571739-39571761 CCTTCTTTGCAGAGGGATCTGGG + Intergenic
1173987957 20:47277368-47277390 GGGTCTTTGCAGAGCAAAATTGG - Intronic
1174269057 20:49353735-49353757 TTGCCTCTGCAGAGGGAAACTGG + Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175164518 20:57033811-57033833 CTGCCTTTGCTAAGGGAAAGAGG + Intergenic
1175644883 20:60662722-60662744 CTGTTTTGGCAGATGCAAATTGG - Intergenic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1176663925 21:9666625-9666647 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178409964 21:32355214-32355236 TTGTTTTTGCATAGGGGAATAGG - Intronic
1179224656 21:39443038-39443060 CAGTGTTTGTAGAGTGAAATGGG + Intronic
1179467678 21:41588546-41588568 CTTTCTTTGGAGGCGGAAATTGG - Intergenic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1181473752 22:23156378-23156400 CTGTCTTAGCAGAGGGGGCTGGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1183236220 22:36620250-36620272 ATCTGTTTGCAGAGGGAAAGTGG + Intronic
1203293748 22_KI270736v1_random:20676-20698 CTATCTTTGTACAGGGATATTGG + Intergenic
949096746 3:95433-95455 CTGGCTTTGCAGAAGGAAAGGGG - Intergenic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
949793264 3:7816936-7816958 CTGTCATGTCAGAGGGAACTGGG + Intergenic
949855925 3:8461046-8461068 CTTTCTTTTCAGTGGGAAAATGG + Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951335853 3:21420889-21420911 CAGACAATGCAGAGGGAAATAGG + Exonic
951551487 3:23879495-23879517 ATTTATTTGCAGTGGGAAATTGG - Intronic
952793731 3:37220549-37220571 CAGTCCCTGCAAAGGGAAATGGG - Intergenic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
956146272 3:66194364-66194386 CTGTCATTGGAGAGATAAATGGG - Intronic
956259503 3:67323066-67323088 CTGTCCTTACTGAGAGAAATAGG + Intergenic
956915421 3:73866073-73866095 CTGTGTTTGCAGATTGACATAGG - Intergenic
958794647 3:98693854-98693876 GTGTCTTAGCAGAGTGACATTGG + Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
962482208 3:135807646-135807668 CTGGCTTTGGAGCCGGAAATGGG - Intergenic
963110911 3:141687097-141687119 CTGGATTTGCAGTGGGGAATTGG + Intergenic
963959959 3:151298685-151298707 CTGTCTTTGCCGGGGGGAATAGG + Intronic
964364705 3:155937415-155937437 CTATCCCTGCAGAGGGGAATAGG + Intronic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
964760130 3:160127593-160127615 CTCACTTTGCAGAGGGTAGTGGG + Intergenic
964940125 3:162149143-162149165 CTCTCTTTTCAAAGGGAATTGGG - Intergenic
967684736 3:192407136-192407158 CTCTACTTGCAAAGGGAAATTGG - Intronic
968024401 3:195427132-195427154 CTGGCTTTGGAGATGGAAAGGGG + Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
970310562 4:14778082-14778104 CTCCATTTTCAGAGGGAAATGGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
972223399 4:36983115-36983137 GTGTCTTTGCAGATGTAATTAGG - Intergenic
973146981 4:46839416-46839438 CTGTCTTTGGAAAGCCAAATTGG - Intronic
973980093 4:56301113-56301135 CATTCTTTGAGGAGGGAAATGGG + Intronic
974476797 4:62392448-62392470 CTGGCTTTGAAGACGGAAACAGG + Intergenic
976310065 4:83602572-83602594 CTGCCATTGCAAAGGGGAATTGG + Intronic
976836888 4:89384970-89384992 GTCACTTTGCAGAGGAAAATGGG - Intergenic
976853663 4:89577818-89577840 CAGTCTTTGCAGAGAGGAAGGGG - Intergenic
978358995 4:107908197-107908219 CTTTCTTTCCAGTGGGAAAGTGG + Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
979438390 4:120721972-120721994 CCGTCTTTGCAGAGGGACAGAGG + Intronic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
980088801 4:128419818-128419840 CTAGCTTTGCAGAGGAGAATGGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
981698767 4:147585248-147585270 CTGTCTTTGAACTGGGACATTGG - Intergenic
981726060 4:147848408-147848430 CTGGCTTTGCAGCAGGAGATCGG + Intronic
982174976 4:152697360-152697382 CTGTCCTTGCACAGGGATTTAGG + Intronic
984360863 4:178730063-178730085 ATTTCTATGCAGAGAGAAATAGG + Intergenic
984694478 4:182765905-182765927 CTGTTTTAGCAGAGGAAATTTGG - Intronic
985409382 4:189667307-189667329 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
987112782 5:14702400-14702422 CTGTATTTGGAGCTGGAAATAGG + Intergenic
988653411 5:33179447-33179469 CAGCCTTTGGAGAGGGAATTTGG - Intergenic
989456484 5:41650045-41650067 CTATCTTTGCAGATGGACAGAGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990503853 5:56425109-56425131 CTTTCTTGGCAGTGGGGAATTGG - Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
992516219 5:77495450-77495472 CTGACTTTGCAGAGAGAAAAGGG + Intronic
992779504 5:80115050-80115072 CTGTCTTTGATTAGGGAAAGTGG + Intronic
993575336 5:89592534-89592556 CTTGCTCTGCAGAGGGAAATAGG - Intergenic
993731555 5:91428837-91428859 CTGGCTTTGAAGATGGAAAAAGG + Intergenic
993899009 5:93571957-93571979 CTGACTGAGCAAAGGGAAATCGG + Intergenic
994218459 5:97166016-97166038 CTGTCTTTGAACTGGGACATGGG + Intronic
994429552 5:99640094-99640116 ATGTCTTTGCAGAGAGATTTGGG + Intergenic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
995840658 5:116440479-116440501 ATGTGTTTGCAGAGGGGAATGGG + Intergenic
997422175 5:133778465-133778487 CTTTCTTTGCAGAGGCAAAGTGG + Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998136828 5:139678465-139678487 CCTTCCTAGCAGAGGGAAATGGG - Intronic
999854952 5:155584152-155584174 CTGTCTTTGCACAAGAAAACAGG + Intergenic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
999914612 5:156243666-156243688 CTGTCTTTGCTGAAAGAACTAGG + Intronic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1003708228 6:8559416-8559438 CAGTCGTCGCGGAGGGAAATGGG + Intergenic
1008903937 6:56655653-56655675 CTGTTTTTGTACTGGGAAATGGG - Intronic
1010161158 6:72857428-72857450 CAGTCTTTGCACAGTAAAATGGG - Intronic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1012123068 6:95391129-95391151 CTGTCACTGGAGAGGAAAATAGG + Intergenic
1012729881 6:102868080-102868102 CTGTCTTTGGAGTGATAAATAGG - Intergenic
1013341139 6:109217257-109217279 CTGTCTTTGCAGCGTGATCTTGG - Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1014462434 6:121712770-121712792 CTGTCTCTGGAGAGGGGATTGGG + Intergenic
1015790515 6:136959965-136959987 CTTTCTTTGGAGGCGGAAATTGG - Intergenic
1015820063 6:137251349-137251371 ATGTTTTTGAAGAGAGAAATTGG - Intergenic
1015987824 6:138902654-138902676 CTGTCTTTGCTGGGGAGAATTGG - Exonic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1019661158 7:2224779-2224801 CTGTCCTTGGGGAGGGAATTAGG - Intronic
1020995242 7:15255480-15255502 CTGGCCTTGTAGAGGGAATTCGG - Intronic
1021052598 7:16007039-16007061 TTGTCTTTGCACAGTAAAATTGG - Intergenic
1021293243 7:18871542-18871564 CTTTCTTTTCAGTGGGATATTGG + Intronic
1021959019 7:25853962-25853984 CGGTATTTGCAGAGGGAGACGGG - Intergenic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022030429 7:26487491-26487513 CTGGCTTTGCAGAGAGACAAGGG - Intergenic
1022099759 7:27161997-27162019 CAGGCTCTGAAGAGGGAAATAGG - Intergenic
1023386871 7:39667332-39667354 CTGTCTTTTCACAGGGAGTTGGG - Intronic
1024547740 7:50536501-50536523 CTGGCTTTGAAAATGGAAATGGG + Intronic
1025812644 7:64884929-64884951 CTGCCTGAGCAGAGGAAAATGGG - Intronic
1027149518 7:75722988-75723010 CTGTCTATGCAGCGAGACATGGG + Intronic
1027565771 7:79791431-79791453 CTGACTTTCAAGTGGGAAATGGG - Intergenic
1027800082 7:82739337-82739359 CTGTCTTTGAATGGGGACATTGG + Intergenic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1029205778 7:98868841-98868863 CTGTATTTCCAGGAGGAAATAGG + Intronic
1032342404 7:131087044-131087066 GTGTTTTGGCAGAGGCAAATAGG + Intergenic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1032985355 7:137331204-137331226 CTGTCTGTTTAGAGAGAAATTGG + Intronic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1034737037 7:153439065-153439087 CTCTCTTTGCTGTGGGAAAGAGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1035742172 8:1936808-1936830 CTGTCATCTCAGAGGGAAAGTGG + Intronic
1036105017 8:5829424-5829446 CTTTAGGTGCAGAGGGAAATGGG + Intergenic
1036442786 8:8796368-8796390 CTGTCATTGCAGAATGAAGTTGG - Intronic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1038439524 8:27561662-27561684 CTGCCTTTGGAGAGGCAGATGGG - Intergenic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1041564667 8:59262959-59262981 CTGTCCTTGCAGAGGTAGAAAGG - Intergenic
1043316715 8:78931947-78931969 TTGTTTTTGCTAAGGGAAATTGG + Intergenic
1044727388 8:95204494-95204516 CGGTCTTTGCAGATGGACAGGGG + Intergenic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1045750180 8:105474520-105474542 CTGTCTTTTCATAAGGTAATTGG + Intronic
1045945645 8:107792660-107792682 CTGACCTTGCAGAAGGAATTAGG - Intergenic
1046024887 8:108710771-108710793 GTGTCTTTGCAGATGGACAGTGG - Intronic
1046811961 8:118543106-118543128 TTTTCTTTGGAGAGGGAACTAGG - Intronic
1047285708 8:123485602-123485624 CTTTCTTTGGAGGCGGAAATTGG - Intergenic
1047638384 8:126791917-126791939 CTGGCTTTGAAGAAGGAAAATGG - Intergenic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048892152 8:138957693-138957715 TTGTCTTGGCAGAGTGAATTGGG - Intergenic
1049210490 8:141384316-141384338 CTGTCATTGCAGAGGGGGACTGG + Intergenic
1049910451 9:261119-261141 TTGTCTATGCAGAGGGAACTGGG + Intronic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1052223250 9:26053167-26053189 CTGACTAGGCAGAGGGAAAGGGG + Intergenic
1052418362 9:28207257-28207279 CTATGTTTACAGTGGGAAATTGG - Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1055464463 9:76550422-76550444 CTGTCTTGGTAGAAAGAAATTGG + Intergenic
1055731955 9:79287550-79287572 CTGTCTTTGCAGATCGCTATAGG - Intergenic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1056040835 9:82665374-82665396 CAGTGTTTGAAGAAGGAAATGGG - Intergenic
1056886932 9:90451865-90451887 CTGTCTTTGCACTGGGAGATTGG - Intergenic
1056995825 9:91458149-91458171 CTGTCCTTGTAGAGAGAATTTGG + Intergenic
1058815692 9:108680882-108680904 TTGTCTTTCCAGTGGGAAAATGG - Intergenic
1059682169 9:116596781-116596803 CTTTCTGTGCAGATGAAAATGGG + Intronic
1061374287 9:130214900-130214922 AGGTCTTTGCAGAGGGAAACTGG - Intronic
1203662175 Un_KI270753v1:55137-55159 CTGTTTCTGCAGAGGGATTTGGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186125040 X:6404261-6404283 CTGGCTTTGAAGATGGAAATTGG + Intergenic
1186134733 X:6507116-6507138 AAGTCTATGAAGAGGGAAATGGG + Intergenic
1186136900 X:6531116-6531138 ATATCTTTCCAAAGGGAAATTGG - Intergenic
1186233866 X:7485800-7485822 CTGGCTTTGAAGATGGAAAGGGG - Intergenic
1186267397 X:7847006-7847028 ATCTCTTTCCAAAGGGAAATTGG + Intergenic
1186297601 X:8167547-8167569 ATCTCTTTCCAAAGGGAAATTGG - Intergenic
1186325271 X:8469835-8469857 ATATCTTTCCAAAGGGAAATTGG + Intergenic
1186330534 X:8527342-8527364 CTGTCTTTTGTGGGGGAAATTGG + Intergenic
1186376594 X:9009708-9009730 ATCTCTTTCCAAAGGGAAATTGG + Intergenic
1186935719 X:14448783-14448805 CCGTCTTTGCAGATGGACAAGGG + Intergenic
1187121065 X:16406968-16406990 TTGTCTTTTTAGAGGGATATGGG - Intergenic
1187888157 X:23908066-23908088 CTGTCTTTGCAGCGGCGACTGGG + Exonic
1189052275 X:37658398-37658420 CTGTCTTTGAACTGGGACATTGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190771725 X:53520351-53520373 CTGTCTTTGGAGGCAGAAATTGG - Intergenic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1196767830 X:119264718-119264740 ATATCTTTGCATAGGAAAATGGG + Intergenic
1198325471 X:135567196-135567218 CTCTCTTTGAAGAAAGAAATGGG + Intronic
1198464930 X:136896555-136896577 CAGTCTTTGAAGAGGTAATTAGG - Intergenic
1199338828 X:146651463-146651485 CTTTCTTTGGAGACAGAAATTGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1199984013 X:152937488-152937510 CTGTCTTTGCAGGTGGACAGAGG - Intronic
1200851803 Y:7891245-7891267 CTCTCTTTGCAGATGGATTTTGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201378849 Y:13350649-13350671 CTTTCTTTGGAGGGAGAAATTGG - Intronic
1201446296 Y:14059411-14059433 ATCTCTTTCCAAAGGGAAATTGG + Intergenic
1201606762 Y:15794397-15794419 CTGGCTTTGAAGATGGAAATTGG + Intergenic