ID: 1103053155

View in Genome Browser
Species Human (GRCh38)
Location 12:117798335-117798357
Sequence CTAAAGAAACAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103053149_1103053155 23 Left 1103053149 12:117798289-117798311 CCAGCTGCAGGCTAATCAAGTCT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 444
1103053148_1103053155 29 Left 1103053148 12:117798283-117798305 CCTGTTCCAGCTGCAGGCTAATC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103053155 Original CRISPR CTAAAGAAACAGAGGAAGCT GGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900907267 1:5568208-5568230 ATAAAGAAACACAGGAGGCTGGG - Intergenic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
902110121 1:14071353-14071375 CTGAAGGAACAGAGGATTCTGGG + Intergenic
903422333 1:23226906-23226928 TCAGGGAAACAGAGGAAGCTAGG + Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904525351 1:31129300-31129322 GAAAAGAAACTGAGGAGGCTGGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
905531604 1:38683799-38683821 TTAAAGAATAAGAAGAAGCTGGG - Intergenic
905547827 1:38813920-38813942 CTCCAGAAGCAGAGGAACCTGGG - Intergenic
905654791 1:39679181-39679203 GAAAAGAAAGAGAAGAAGCTGGG - Exonic
905868027 1:41386825-41386847 CCAAAGGACCAGAGGAAGGTTGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
908077850 1:60540492-60540514 CTAAATAAACAGAGTTAACTTGG - Intergenic
908134392 1:61115343-61115365 ATAGAGAAAAACAGGAAGCTGGG + Intronic
908669113 1:66526193-66526215 CTACAGAAGCAGAGAAAGGTAGG - Intergenic
908671181 1:66549214-66549236 AAAAAGAAAGAGAGGAAGCAAGG - Intronic
908946132 1:69499671-69499693 CTCAAGAGAAAGAGGAAGCAAGG + Intergenic
909914619 1:81301853-81301875 CTAAAGAAACCCACTAAGCTTGG + Intergenic
910804108 1:91173531-91173553 ACAAAGAGACAGAGGAATCTGGG + Intergenic
910991699 1:93063366-93063388 ATATAGAAAAAGAGGGAGCTTGG - Intergenic
911195283 1:94988235-94988257 AGAAAGAAAGAGAAGAAGCTTGG + Intronic
911702753 1:100973662-100973684 CTAAAGAAAAAAATAAAGCTTGG - Intronic
912204690 1:107496781-107496803 TTAAAGACACAGGGGGAGCTGGG + Intergenic
912449442 1:109760209-109760231 CAAAAGGAACAAAGGAAGCCAGG - Intronic
913401882 1:118444429-118444451 CTAAGGATGCAGAGGGAGCTAGG + Intergenic
915562983 1:156698372-156698394 CAAAAGAAACAGATGAGGCCGGG + Intergenic
915690390 1:157683248-157683270 CAAAACAAACAAAGGAAGGTTGG + Intronic
915778901 1:158523418-158523440 ATAAAGAAAGATAGGAAGATTGG + Intergenic
915940986 1:160117974-160117996 AGAAAGAAAGAGAGGAAGCAAGG - Intronic
916086405 1:161273194-161273216 TTAAAGAAATATAGGAAGGTAGG + Intronic
916232135 1:162550920-162550942 GCAAGGAAACAGAGGGAGCTTGG - Intergenic
917282298 1:173389863-173389885 CTCAACAAATAGAAGAAGCTAGG - Intergenic
917734850 1:177911081-177911103 GTCAAGAAACACAGGAAGCTAGG + Intergenic
917986389 1:180324299-180324321 CTAAAGGAAGACAGGAAGCAAGG - Intronic
918198823 1:182247809-182247831 GAAAAAAAAGAGAGGAAGCTGGG + Intergenic
920498222 1:206470391-206470413 TTAAAGAGACAGAGGCAACTCGG - Intergenic
922235096 1:223716732-223716754 CAAAAGCCACAGAGGAAGTTGGG - Intronic
922606402 1:226892340-226892362 CTCAGGAATCAGAGGAAGCCGGG + Intronic
922770221 1:228177732-228177754 TTAAAGACACAGAAGAGGCTGGG - Exonic
924127653 1:240872294-240872316 ATAAAGAAAGACAGGAAGCAGGG + Intronic
924205729 1:241709616-241709638 CTAAAGAAAGAAAGAAAGTTAGG + Intronic
924556060 1:245119636-245119658 CTAAAAAAAAAAAGGAGGCTGGG + Intronic
924660952 1:246016285-246016307 CTAAAGAAACAGAACTGGCTGGG + Intronic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063098650 10:2930678-2930700 CTAAAGAAATAAAGGAAGGAAGG + Intergenic
1063281277 10:4632025-4632047 CTGAAGAAACAGATGATTCTAGG + Intergenic
1063623494 10:7668178-7668200 CTAAGGAAACAGAGGAGACGAGG + Intergenic
1064149912 10:12854056-12854078 TTAAAGAGAGATAGGAAGCTAGG + Intergenic
1065550041 10:26860895-26860917 TTAAAGAGACAGAGGCAGCAAGG + Exonic
1065689909 10:28322508-28322530 CAAAAGTAACAGAGAAAGGTTGG - Intronic
1065807993 10:29412552-29412574 ATAAAGAAACAGAACAAACTTGG - Intergenic
1066223792 10:33361550-33361572 CACAAGATAGAGAGGAAGCTTGG - Intergenic
1066234379 10:33470519-33470541 ATGAAGAAAGAGAGGAAACTGGG + Intergenic
1067407587 10:46037045-46037067 CTAATGGAACAGAGGAATATTGG - Intronic
1068362216 10:55991868-55991890 CTAAAGAAACAGAGGAATACAGG - Intergenic
1068628501 10:59274938-59274960 CTAGGGATACAGAGAAAGCTGGG + Intronic
1068832699 10:61515818-61515840 CTAAAGAAAAAGAACAAGCCTGG - Intergenic
1069024722 10:63527339-63527361 CTAAAGAGACAGAGGGAAATGGG - Intronic
1069024838 10:63528351-63528373 CTAGAGAAAGAGAGGAATCAAGG - Intronic
1070060552 10:72979189-72979211 CTAAAATAACAGAGGAAGTAAGG - Intergenic
1070393590 10:75992317-75992339 GTAAAGTAGCAAAGGAAGCTGGG + Intronic
1070495938 10:77022477-77022499 CAAAAGAAACAGAGACAGCAAGG - Intronic
1071080348 10:81803016-81803038 ATAAAGAAAAAGAGTAAGTTGGG + Intergenic
1071103288 10:82063746-82063768 CTAAAGAAAGAAAGTAAACTGGG + Intronic
1071144396 10:82550584-82550606 CTAAAAACACAAAGGAATCTTGG - Intronic
1071396994 10:85233897-85233919 CAAAGGAAACAGAGGAACTTGGG - Intergenic
1072067516 10:91885265-91885287 CTGAAGAAAGAGCGGAAGTTAGG - Intergenic
1072135799 10:92544518-92544540 CTACAGAGAAAGAGGAAGCGTGG + Intronic
1072166712 10:92820816-92820838 CTAAAGAAATACATGAGGCTGGG + Intergenic
1072660093 10:97358628-97358650 CCAGAGAAACAGAGTCAGCTAGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074102795 10:110366586-110366608 CTAAAGCAACCCAGGAAGGTGGG + Intergenic
1075464133 10:122638737-122638759 TTAAAGAAATAGAGGAGGCCAGG - Intronic
1075792353 10:125094129-125094151 TTAAAGAAACAGAGGAAAGCAGG + Intronic
1076007694 10:126961116-126961138 TTAAGGAAACAGAGCTAGCTGGG - Intronic
1076071271 10:127491795-127491817 CTCATGAAAGAGAAGAAGCTGGG - Intergenic
1076254705 10:129012764-129012786 CTAAAGGAACCGATGTAGCTGGG - Intergenic
1078015257 11:7607959-7607981 ATAAAGAAAGAGAGGGAGGTAGG + Intronic
1078072638 11:8127354-8127376 CTAGAGAAATTGAGGAAACTGGG + Intronic
1078928877 11:15898131-15898153 CTAAGGGAACAGAAGAATCTTGG + Intergenic
1079156494 11:17952969-17952991 GTAAAGTAACAGGGGAATCTTGG - Intronic
1079313438 11:19387328-19387350 CTAAAGAAAAGGAGGTAGTTAGG + Intronic
1079967047 11:26992689-26992711 GAAAAGAAACAGAGGAAGCATGG - Intergenic
1080027326 11:27628228-27628250 ATAAAGATACAGAGGAAGGCAGG - Intergenic
1081590944 11:44422694-44422716 AAAAAGAAAGAGAGAAAGCTAGG - Intergenic
1081637660 11:44731252-44731274 CTAAAGAAATAGAGAAACCGAGG - Intronic
1081902304 11:46639279-46639301 ATAAAGAAAATGTGGAAGCTGGG - Intronic
1081950975 11:47042219-47042241 ATAAAGAAAGAGAGGAAGGAAGG + Intronic
1084798681 11:71526790-71526812 CTAAAGAAATACTTGAAGCTGGG - Intergenic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1087763070 11:102122596-102122618 ATAAAGAAAAAGAGCAGGCTGGG + Intronic
1088120323 11:106361355-106361377 ATTAAGAACCAGAGGAGGCTGGG - Intergenic
1088228924 11:107653563-107653585 ATGAAGAAAAAAAGGAAGCTAGG - Intronic
1088973929 11:114798042-114798064 CTAAAGAAATAGAAGGATCTGGG - Intergenic
1089084764 11:115807495-115807517 CTAAAGAAACAGAGGCACAAGGG - Intergenic
1090967798 11:131613870-131613892 CTGAGGAAACAGAGGAACCCTGG + Intronic
1091385444 12:91832-91854 CTGAAGGAAGAGGGGAAGCTGGG - Intronic
1092258557 12:6940283-6940305 CAAAAGAAAAAAAGGAAGCCGGG - Intronic
1092428531 12:8391783-8391805 CCACAGAAACAGAGGAGGCCAGG + Intergenic
1092691454 12:11114955-11114977 CTAAAGAAAAATAGGAAGGTAGG + Intronic
1094124521 12:27009399-27009421 CTAAAGAAATAGAGGAATATCGG - Intronic
1094546607 12:31410265-31410287 CTAAAGAAACAGATGAAATGGGG + Intronic
1095116968 12:38366237-38366259 CTAAAGAAACAGACAAAAATGGG - Intergenic
1096319043 12:50594237-50594259 AAAAAGAAACAAAGGAGGCTGGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096669236 12:53188575-53188597 CTCAAGAAACAAAGGAATCTGGG + Exonic
1096852875 12:54453542-54453564 CTAAAGAAACAGAACTGGCTGGG + Intergenic
1097008906 12:55938641-55938663 CTTAAGAAACAGAAGAGGATGGG + Intronic
1097818395 12:64100743-64100765 CTTAAGAAAGAGAGGATTCTTGG + Intronic
1097994987 12:65878598-65878620 ATAAAGAAACTGGGGAAACTGGG - Intronic
1098028132 12:66227247-66227269 CTAAAGAGAAAGAGGCAGCCTGG + Intronic
1098795403 12:74882115-74882137 ATAAAGAAACACCTGAAGCTGGG + Intergenic
1099738815 12:86604200-86604222 CTAAAGAAACTGCAGAAGTTGGG + Intronic
1100027563 12:90148509-90148531 CCAAAGAAACAGGGAAACCTGGG - Intergenic
1100983482 12:100183049-100183071 CAAAAGAAACAAAGGAAGGAAGG + Intergenic
1101615045 12:106328248-106328270 CTAAGTAAACAGTGGAGGCTGGG + Intronic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103870888 12:124090786-124090808 CTATAAAAACAAAGGAAGCCTGG + Intronic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1105073510 12:133253112-133253134 ATAAAGAAACACCTGAAGCTAGG - Intergenic
1106811685 13:33364592-33364614 ATTAAGAAAAAGAGGAGGCTGGG + Intergenic
1107046452 13:35998048-35998070 CTAAAGCCACTGAGGAAGGTGGG - Intronic
1108544701 13:51481116-51481138 CCAGAGAAACACATGAAGCTAGG - Intergenic
1109217114 13:59602677-59602699 ATAAAGCAACAGGGTAAGCTGGG + Intergenic
1110177939 13:72579698-72579720 AAAAAGAAGCAGAGGGAGCTGGG + Intergenic
1110350918 13:74506215-74506237 CGCATGTAACAGAGGAAGCTTGG + Intergenic
1110614096 13:77521943-77521965 TTAAAGTAGCAGAGGAAGGTAGG + Intergenic
1110800733 13:79691769-79691791 CTAAAGAAATAAATGAGGCTAGG + Intergenic
1110963186 13:81657364-81657386 CTAAAGAAATGGAGACAGCTGGG - Intergenic
1111199346 13:84913910-84913932 ATAAAGAAAAAGAGGCAGCCAGG + Intergenic
1111607019 13:90552281-90552303 CTAAAGAAATAAAGGAACATAGG + Intergenic
1115088721 14:29548315-29548337 GGAAAGAAACAGTGGAAGGTAGG + Intergenic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117971725 14:61257722-61257744 GCAAAGAGAGAGAGGAAGCTAGG - Intronic
1118248057 14:64131024-64131046 CTAAAGATAAAGAGTAATCTAGG + Intronic
1118369764 14:65127817-65127839 AGAAAGAAAGAGAGGAAGCGAGG - Intergenic
1118480268 14:66157906-66157928 CTAAAGAAAGAGAACAATCTTGG - Intergenic
1119497387 14:75091809-75091831 TTAAAGAAGCAGAGTAAGCATGG - Intronic
1120527454 14:85593635-85593657 CAAAAGAAACAGTAGAAGGTTGG - Intronic
1121163954 14:91774066-91774088 GTGAAGATCCAGAGGAAGCTAGG + Intronic
1125667805 15:41446034-41446056 AAAAAGAGTCAGAGGAAGCTGGG - Intronic
1126149267 15:45507781-45507803 TTAAAGAACCAGGAGAAGCTGGG - Intronic
1127053455 15:55108563-55108585 AGTAAGAAACTGAGGAAGCTAGG + Intergenic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1128064583 15:64756352-64756374 CTAAAGATACAAAGTTAGCTGGG + Intronic
1129911451 15:79230773-79230795 ATAAAGAAATACCGGAAGCTGGG + Intergenic
1130525537 15:84702888-84702910 CTAAATAAATAGAGTAAGTTGGG - Intronic
1131126356 15:89860843-89860865 ATAGAGAAACAGAGGCAGCCAGG + Intronic
1132270214 15:100517578-100517600 CCACAGATAAAGAGGAAGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133346799 16:5076544-5076566 CTCAAGATGCAGAGAAAGCTCGG - Intronic
1133905528 16:10018779-10018801 CTAGAGAATCAGAGCAACCTCGG - Intronic
1135208487 16:20503326-20503348 CAACAGAAACAAAGGAAGCTAGG + Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1136231914 16:28890998-28891020 TTAAAAATACATAGGAAGCTGGG + Intronic
1137748740 16:50842449-50842471 CCAAAGAGAAAGAGGAAGCCAGG - Intergenic
1139445914 16:66998571-66998593 CTAAAGAAAGAGAGGAGGCTGGG + Intronic
1140267897 16:73436032-73436054 ATAAAGAAAAAGAGGTAGCCCGG + Intergenic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1141437486 16:84008679-84008701 GTAAAGAAAAGGAGGTAGCTGGG - Intergenic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1142844538 17:2662698-2662720 ATAAAGAATCAGAGAAGGCTGGG - Intronic
1144140000 17:12339134-12339156 CTGAAGCAAGAGAGGAAGGTTGG - Intergenic
1146646557 17:34580639-34580661 CTACCGAAACCGAGGAAACTGGG + Intergenic
1147027365 17:37599112-37599134 CTAAAGAAACAGAGACTCCTAGG - Intronic
1147265878 17:39234337-39234359 CTAAAGAAACAGACCTGGCTGGG + Intergenic
1148571252 17:48671194-48671216 ATAAAGAAACTGAGGCAGGTGGG - Intergenic
1148766704 17:50043821-50043843 CCAAGGAAACAGAGAAAGCTAGG - Intergenic
1148906602 17:50916356-50916378 CCAAAGAGACAGAGCAGGCTGGG + Intergenic
1149046693 17:52254858-52254880 GTACAGAGACAGAGGAAGCGGGG + Intergenic
1149695892 17:58615780-58615802 CTGAAGAATTAGAGGCAGCTTGG - Intronic
1149914206 17:60593599-60593621 CTATTTAAAGAGAGGAAGCTTGG - Intergenic
1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG + Intronic
1151030873 17:70737328-70737350 ATAAAGCAACTGAAGAAGCTTGG - Intergenic
1152061225 17:78077095-78077117 CCAAGGAAACAGAGGAGGCGTGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152896058 17:82912056-82912078 CTCAGGAAGCAGAGGCAGCTGGG + Intronic
1155191042 18:23430858-23430880 CTAAAGAAATTGAGCCAGCTGGG + Intronic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1157767141 18:50307820-50307842 CTATGGAAACCGAGGACGCTGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158565509 18:58551066-58551088 CTAAAGAAGCCCAGGAAACTAGG - Intronic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1159268329 18:66113500-66113522 CTAAACAAACATAGAATGCTTGG + Intergenic
1160221313 18:76979962-76979984 AAAAAAAAACAAAGGAAGCTTGG + Intronic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1161471832 19:4461285-4461307 CTAAAAAAAAAAAGAAAGCTGGG - Intergenic
1161752038 19:6105246-6105268 CTAAGGAGACAGAGAAAGCAGGG + Intronic
1162299810 19:9838119-9838141 GTGATGGAACAGAGGAAGCTGGG - Intronic
1162637604 19:11982465-11982487 CTAAAGGAAAGGAAGAAGCTTGG + Intergenic
1162661963 19:12176782-12176804 CTAAGGAGAGAGAGAAAGCTGGG + Intronic
1162693900 19:12456747-12456769 CTAAAGAGGGAAAGGAAGCTGGG - Intronic
1165499462 19:36176409-36176431 GTAAAGAAACACAGGAGGCTGGG - Intergenic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1167304459 19:48699164-48699186 CTAAAGAAACAGGGAAACCTGGG + Intronic
1167754945 19:51406643-51406665 ATCAAGAAACAGAGGAGGCTGGG + Intergenic
1168439063 19:56347847-56347869 CAAAAGAAAGAGAGCAAGCTCGG + Intronic
925677034 2:6373652-6373674 ATAAAGAAATACAGGAAACTGGG - Intergenic
925730175 2:6914333-6914355 TTAAGGACACAGAGGAATCTGGG - Intergenic
927205356 2:20605616-20605638 TTAAAGAGACAGAAGAAGGTAGG - Intronic
927338253 2:21950355-21950377 ATAAAGAAAGGGAGGAGGCTGGG - Intergenic
927791300 2:26011854-26011876 CCAAAGAATCAGGGGAAGCCAGG - Intergenic
927791773 2:26015753-26015775 CTAAAGAAAAGGAGGAAGAAGGG + Intergenic
931343436 2:61425103-61425125 CTAAAAAATCAGTGGCAGCTGGG - Intronic
931629326 2:64285072-64285094 AGAGAGAAACAGAGGAAGCAGGG - Intergenic
931732326 2:65164316-65164338 TTAAAGAAACAGAGGAAAAAAGG + Intergenic
932549712 2:72755623-72755645 AGAAAGAAACAGAGGAAGAAAGG + Intronic
932782167 2:74566568-74566590 CAAGAGAAACAGACAAAGCTAGG + Intronic
932951202 2:76295758-76295780 ATAACAAAAAAGAGGAAGCTTGG + Intergenic
933183906 2:79257926-79257948 CCAAAGAAAGACTGGAAGCTAGG - Intronic
933490515 2:82980686-82980708 ATAAAGAAACATAGGTGGCTGGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935661586 2:105471255-105471277 CTAGAGAACCAGAGAAAGCTTGG - Intergenic
935950000 2:108320045-108320067 CTAAAAATACAAAGTAAGCTGGG + Intergenic
936797099 2:116219451-116219473 CTAAAGAAATAAAGAAAACTGGG + Intergenic
937510769 2:122592456-122592478 ATAAAGAAAAAGAGAAAGTTAGG - Intergenic
938130203 2:128708693-128708715 CTAAAGAAATACATGAGGCTGGG + Intergenic
938728548 2:134128071-134128093 CTTAAGAAAAAGTGGAGGCTGGG + Intronic
938794347 2:134705600-134705622 CAGAAGGAACAGAGGAAGCCGGG - Intronic
939349099 2:141009934-141009956 CTCAAGAAACACAGTAAGCCAGG - Intronic
939371072 2:141300840-141300862 ATAAAGAAACATCTGAAGCTGGG - Intronic
939539414 2:143475127-143475149 CTAAAGAAGGAGAGAAAACTAGG - Intronic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
940077540 2:149759935-149759957 CTAAAGTAACAGAAACAGCTTGG - Intergenic
941435447 2:165465400-165465422 CTAAGGAAATAGATGAGGCTTGG - Intergenic
941597645 2:167497617-167497639 CTAAAGAACCTGAGGGAGATTGG + Intergenic
941959079 2:171235931-171235953 CTAAAGAATCAATGGCAGCTGGG + Intergenic
942119452 2:172762351-172762373 CAAAAGAAACAGTGGAGGCCAGG - Intronic
942261902 2:174173111-174173133 ATAAAGAAACACCTGAAGCTGGG - Intronic
942455571 2:176136212-176136234 AAAAAGAAACAGAGGAGGCGGGG + Intergenic
943976759 2:194489825-194489847 ATATAGAAAGAGAGGAAGTTGGG + Intergenic
944487444 2:200221750-200221772 CTAAAGAAAGAGAAGAAATTGGG - Intergenic
945982127 2:216320971-216320993 TTAAAGAAAAAGAGGCATCTGGG - Intronic
946725663 2:222658693-222658715 CTAATGGAAAAGAGGAAACTAGG + Intergenic
946729318 2:222692983-222693005 CTTAAGAGGCAGAGGATGCTGGG - Intronic
947556093 2:231094506-231094528 ATAAATAAACAGAGTAAGCAGGG + Intronic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1171856088 20:30344787-30344809 CTAAAAAAACCGAGGATGGTGGG - Intergenic
1172228715 20:33322754-33322776 ATAAAGAGACAGAGGCAGGTGGG + Intergenic
1172988797 20:39016197-39016219 GAAGAGAAACAGAGGAAGCCAGG + Intronic
1173208640 20:41014551-41014573 CTAAATAAACTGAGAAAGCCGGG + Intergenic
1173242823 20:41312934-41312956 AGAAAGCAACAGTGGAAGCTGGG + Intronic
1173416607 20:42862463-42862485 CTCAAGCAAGAGAGGAAGTTGGG + Intronic
1173958035 20:47049757-47049779 ATAAAGAAACACCTGAAGCTGGG - Intronic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1174911167 20:54608969-54608991 ATGAAGAAACAGAGGGAGTTTGG - Intronic
1174957264 20:55112429-55112451 TAAAAGAAACAGAGGAAGACAGG + Intergenic
1175274836 20:57761209-57761231 CCAAAGGACCAGAGGGAGCTTGG - Intergenic
1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG + Intronic
1176209724 20:63913224-63913246 CTAAGGAAACAAAGGAAACACGG - Intronic
1176366216 21:6034345-6034367 CAAAGGAAACCGGGGAAGCTGGG + Intergenic
1176939605 21:14908759-14908781 CTAAAGAAAGATAGGAAGGAAGG - Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1178163450 21:29945423-29945445 CTAAAGAAACTGAGGCAGAGAGG + Intergenic
1178369844 21:32018230-32018252 CTAAAGATACAAAAGTAGCTGGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179757301 21:43504200-43504222 CAAAGGAAACCGGGGAAGCTGGG - Intergenic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181934985 22:26431898-26431920 ATAAAGAAACTGAGGCAGCCAGG + Intronic
1182092251 22:27603874-27603896 GTAACGAAACAGAGGAATGTCGG - Intergenic
1182676948 22:32046670-32046692 CTTAAGAAACTGAGGATGTTGGG - Intronic
1183745674 22:39690314-39690336 CTCAAGAAACAGTGCAGGCTGGG - Intergenic
1183866803 22:40710701-40710723 CAAATAAAACAGAGGAGGCTGGG - Intergenic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
950124103 3:10501077-10501099 CTAAAGAAACAGAGGTCCCTGGG - Intronic
950563520 3:13749767-13749789 CTAGAGATACAGAGGACACTCGG - Intergenic
951379839 3:21969440-21969462 CTGAAGACAAAGAGAAAGCTAGG - Intronic
952212638 3:31244226-31244248 CTAAAAAAACAATGGAAACTTGG + Intergenic
952803045 3:37315453-37315475 CCCAAAAAACAGAGGAAGCACGG + Exonic
954142926 3:48619669-48619691 CCATAGAAACAAAGGCAGCTAGG + Intergenic
954448753 3:50560506-50560528 CTCAGGAAGCAGAGGAACCTGGG + Intronic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
955589382 3:60518191-60518213 TTAAAGAAACTGAAGAGGCTAGG + Intronic
955904674 3:63794268-63794290 TTATAGAAACGGAGGAAGATGGG - Intergenic
956202654 3:66722466-66722488 TTAAAGAAATGGAGGAGGCTGGG - Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957136582 3:76296244-76296266 CTAAAGCCCCAGAGAAAGCTTGG + Intronic
957940166 3:86993036-86993058 CTAAAAAAACAAATTAAGCTGGG - Intergenic
958053809 3:88383956-88383978 CTAAAGAATAAGAAGAAGCCCGG - Intergenic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
959099227 3:101991591-101991613 CTAAAGAAACAGAGCATCCAAGG - Intergenic
959190140 3:103100579-103100601 ATAAAGAAACAATGGAAACTGGG - Intergenic
959659699 3:108852920-108852942 CTAAAGAAAGACAGGAAACTAGG - Intronic
960502416 3:118454234-118454256 CTAAAGAAACCGAGGCAACAAGG - Intergenic
960737914 3:120800829-120800851 GTAAAGCAAGAGTGGAAGCTAGG - Intergenic
961225095 3:125236974-125236996 CTAATGAAGCAATGGAAGCTGGG + Intronic
962620815 3:137176564-137176586 CTAAGGAAACAAAGGCGGCTGGG + Intergenic
962893307 3:139692063-139692085 GAAAAGAAAGAGAGGAAGTTAGG - Intergenic
963002164 3:140692318-140692340 CTAAGGAAACAGAGTATGGTTGG - Intronic
963529439 3:146455612-146455634 CAAAGGAAAAAGAGGAAGTTAGG + Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964095846 3:152930564-152930586 CTACAGAAGCAGAGTAGGCTGGG + Intergenic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966334324 3:178851332-178851354 GGAAAGAAACAGAGGAACTTGGG - Intergenic
966668714 3:182502376-182502398 TTTAAGAAACAGAGTAAGATGGG + Intergenic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
968231316 3:197006437-197006459 CTAGAGAAATTGAGGAAGCCCGG - Intronic
968796617 4:2710466-2710488 GTAAAGAAAAACAGTAAGCTAGG - Intronic
969335657 4:6508282-6508304 CAATAGAAACAGCTGAAGCTGGG + Intronic
969393083 4:6903562-6903584 CTAGAGAAGCACAGGAACCTGGG - Intergenic
972601996 4:40581124-40581146 CTAAAGAAAAGGAGAAAGCCGGG + Intronic
973720405 4:53718194-53718216 CTAAGAAAAAAGAGGAGGCTGGG + Intronic
973756276 4:54076983-54077005 AAAAAGAAACTGAGGAAACTGGG + Intronic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
975989391 4:80241614-80241636 CAAAAGAAACAGAGGAAGATAGG - Intergenic
976710966 4:88071343-88071365 TTAAAGAAATAAAGGAGGCTGGG - Intronic
976978562 4:91194630-91194652 ATAATGAAACAAAGGAAACTTGG - Intronic
978627683 4:110705586-110705608 CCAAAGAAGAAGAGGAAGCAAGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982092537 4:151892842-151892864 CAAAAGAACAAGAGGAAGCCTGG - Intergenic
983714578 4:170764227-170764249 CTAAGGATACAGAAGAAGCAAGG + Intergenic
984009645 4:174355571-174355593 CCCAAGAAGCAGAGGAAGTTAGG + Intergenic
984496490 4:180504733-180504755 CTAAAGAAATAAGGGGAGCTGGG - Intergenic
984946897 4:184975850-184975872 CACAAGACACAGAGGATGCTGGG - Intergenic
985222987 4:187727797-187727819 CTGAAGAAACAGGACAAGCTTGG + Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
986134749 5:4965936-4965958 CTAAAGAAACAGAGGTGGCATGG + Intergenic
986479212 5:8168070-8168092 CAAAAGAAAAAAAGGAATCTTGG - Intergenic
986831730 5:11587450-11587472 TTAAAGAAACTGAGGAAGAAAGG - Intronic
987316886 5:16732210-16732232 CCAAAGAAACAAAGGAAGGAAGG + Intronic
988250533 5:28751393-28751415 ATAAAGAAACACCTGAAGCTGGG - Intergenic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
990104894 5:52246449-52246471 ATAAAGAAACAGAGGTTTCTTGG - Intergenic
991507417 5:67339649-67339671 CTACAGAAAGAGAGGAAGGAAGG - Intergenic
991665026 5:68990942-68990964 CTCAGGAAAGAGAGCAAGCTTGG - Intergenic
992478548 5:77127544-77127566 CTAAAGAAACTGAAGGACCTGGG - Intergenic
992504154 5:77368905-77368927 CAAAAGAAAAAGAAGAGGCTGGG + Intronic
993149994 5:84149109-84149131 CTAGTGAAAGAGAGGGAGCTGGG + Intronic
993914279 5:93723212-93723234 CTAAGGCAACAGATTAAGCTGGG + Intronic
994729076 5:103470729-103470751 CTAAAGAAGCAGATGTGGCTGGG - Intergenic
994744181 5:103658451-103658473 CTAAAGGAAGAAAGGAAGGTGGG - Intergenic
995817685 5:116190586-116190608 CCAAAGAAACAGAGAACTCTTGG - Intronic
995903829 5:117099959-117099981 GTCAACAAACTGAGGAAGCTTGG + Intergenic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
996482496 5:123990797-123990819 GTAAAGAAATAGAGGCACCTTGG + Intergenic
997018331 5:129964335-129964357 CTGATGAAACAGAAGATGCTAGG - Intronic
997652119 5:135530101-135530123 TGAAAGAAACAGAGGAATCAAGG - Intergenic
998632579 5:143916131-143916153 CTCAAGAAGTAGAGGAAGCAAGG + Intergenic
999488029 5:152019691-152019713 CTCAAAAAACAAAAGAAGCTAGG - Intergenic
999523132 5:152373272-152373294 TTAAAGAAACAGTGGAAGACAGG - Intergenic
1000858094 5:166425069-166425091 CTAAACAAAAAGAGGAAATTGGG - Intergenic
1001044751 5:168363226-168363248 CTAAAAAGAGAGAGGAAGCCAGG + Intronic
1001705880 5:173740944-173740966 TTAAAGCAACAGAGGAACCGAGG - Intergenic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002269294 5:178059247-178059269 CTAAAGATACAAAGTTAGCTGGG - Intergenic
1002855688 6:1035965-1035987 ATAAAGCAACGGGGGAAGCTGGG + Intergenic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1003849544 6:10207778-10207800 ATAAAGAAACAGAGCAGGCTGGG + Intronic
1003964329 6:11238704-11238726 CCAGAGATACAGAGGAAGATTGG - Intronic
1004472910 6:15945081-15945103 CTACAGAAATAGAGGATGTTAGG + Intergenic
1005082125 6:21966588-21966610 TTAATGAAAAAGAGGAAGGTTGG - Intergenic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1006614051 6:35312689-35312711 CCAAAGTAGCAGAGGCAGCTGGG - Exonic
1007225296 6:40309469-40309491 CTAAAGGAACACCTGAAGCTTGG + Intergenic
1007520352 6:42447198-42447220 CTGAAGAAACAGATGATTCTTGG - Intronic
1008314579 6:50024911-50024933 ATCAAGAAACTGAGGAAGGTTGG + Intergenic
1008413691 6:51214371-51214393 CTAAAGAACAGGAGAAAGCTGGG - Intergenic
1008505400 6:52225165-52225187 CTAAGGAAACAGAGGAGTTTGGG - Intergenic
1008843302 6:55930759-55930781 ATTAAGAAACAGAAGAAACTTGG - Intergenic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1009057001 6:58348121-58348143 CTAAAGAGCAATAGGAAGCTTGG - Intergenic
1009234242 6:61103448-61103470 CTAAAGAGCAATAGGAAGCTTGG + Intergenic
1009435947 6:63618729-63618751 CTAAAGAAACAAAGTTAGCCAGG + Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010373941 6:75144422-75144444 CTAAGGAAACAGAGCATGATGGG - Intronic
1010404567 6:75488579-75488601 AGAAAGAAACAAAGGAAGGTAGG - Intronic
1010579425 6:77575595-77575617 CCAAAGTTACAGAGGAAGCATGG + Intergenic
1010968480 6:82239030-82239052 CTAAAGAAACTGATGAGGCCAGG - Intronic
1011277846 6:85646606-85646628 CTAATGAAAGAGAGGAATGTAGG + Intergenic
1011309016 6:85960716-85960738 CTCTAGAAACAAAGGAACCTGGG + Intergenic
1011627029 6:89291132-89291154 CCACAGAATCAGAGGAACCTAGG - Intronic
1012254715 6:97018188-97018210 AAAAAGAAACAGAGAAAGCATGG + Intronic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013257552 6:108403649-108403671 CAAAATATAAAGAGGAAGCTAGG + Intronic
1014901761 6:126974253-126974275 CAAAACAAACAGAGAAAGCAGGG + Intergenic
1015011616 6:128356180-128356202 CTAAAGAAACAGGAGAAGAGGGG - Intronic
1015040736 6:128715718-128715740 CTTATGAAACAGGAGAAGCTGGG - Intergenic
1015793845 6:136990656-136990678 TAAAAGAACCAGAGGAAACTCGG - Intergenic
1016395035 6:143614783-143614805 GTAAAGAAAGAAAGGGAGCTAGG + Intronic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1017849774 6:158295004-158295026 GAAAAGAAAGAGAGGAAGCCAGG - Intronic
1019140932 6:169941901-169941923 CTCAAGAAGGAGTGGAAGCTTGG + Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019461621 7:1162016-1162038 CTAAAGAAAAACAACAAGCTGGG - Intergenic
1021250442 7:18318774-18318796 ATAAAGAAACAGAGGAAAAGAGG - Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022396413 7:29990941-29990963 CTAAAGAAAAATAAAAAGCTAGG + Intergenic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1023597202 7:41843541-41843563 AAATAGAAACAAAGGAAGCTGGG - Intergenic
1024145971 7:46516654-46516676 CTAAAGAAACCCACCAAGCTAGG + Intergenic
1024520427 7:50301210-50301232 CTATGGAAAGAGAGGCAGCTAGG - Intergenic
1025267347 7:57474562-57474584 CTAAAGAAATAGCCCAAGCTGGG - Intergenic
1026669836 7:72380337-72380359 CTTAAGAAACAGAGGTAGGCTGG + Intronic
1026870206 7:73846411-73846433 CCAAAGTGACAGAGGGAGCTTGG + Intergenic
1027628273 7:80571118-80571140 CAAAAGAAACAGAATAGGCTGGG - Intronic
1028059221 7:86288942-86288964 ATGAAGAAACAGAGAAAACTGGG + Intergenic
1028276242 7:88861313-88861335 TTAAAGAAAAAGATGAAGCCAGG + Intronic
1028356629 7:89918446-89918468 GTAAAGAAAGAGAGTAAGCTTGG + Intergenic
1028591735 7:92504017-92504039 ATAAAGAAGCAAAGGAAGCGTGG - Intronic
1028859018 7:95626696-95626718 CCAAAGAAACAGAAGTAGATTGG + Intergenic
1028866143 7:95715936-95715958 CTATAGTAACAGAGGTTGCTTGG + Intergenic
1029843968 7:103394173-103394195 GTAAGGAAACAGAGGAAGAAAGG + Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1030210821 7:106994036-106994058 CTCAAGAAAGAGAGGAAGCCTGG - Intergenic
1030827197 7:114172563-114172585 CTAATGTAATAGAGGAAACTGGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032177565 7:129644251-129644273 GTAAAGAAACATAGGAAATTAGG + Intronic
1033075713 7:138248295-138248317 CTATAGAAACAAGGGAAGTTAGG + Intergenic
1033297757 7:140156615-140156637 CCAAAGGGAGAGAGGAAGCTAGG + Intronic
1033606412 7:142931306-142931328 CTAAATAACCTGAGGATGCTGGG - Intronic
1035220513 7:157403689-157403711 CTAAAGGGAGAGAGCAAGCTGGG - Intronic
1035819234 8:2574038-2574060 CTAAAGACACACAGGAGACTGGG - Intergenic
1035973425 8:4279168-4279190 TTACAGAGACAGACGAAGCTTGG - Intronic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1037759316 8:21731363-21731385 GCAAAGAAACAGAGGAATCTTGG + Intronic
1038150368 8:24937995-24938017 ATAAAGAAACACAGAAAGATAGG + Intergenic
1038365041 8:26922989-26923011 ATGAAGAACCAGAGGAAGATGGG + Intergenic
1038414406 8:27383552-27383574 TGAAAGAAACAGAGGAGGCCAGG - Intronic
1038890343 8:31714072-31714094 ATAAAGAAACAGAGAAAGGCCGG - Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1039162324 8:34636120-34636142 ATAAAGAATCAGAGGAACTTTGG + Intergenic
1039244029 8:35588265-35588287 CTTAGGAAAGAGAGGTAGCTAGG + Intronic
1039272361 8:35897001-35897023 CTGAAGAAAATGAAGAAGCTTGG + Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041797070 8:61756613-61756635 CCAAGGAAGCAGAGGCAGCTGGG - Intergenic
1042537210 8:69870910-69870932 CTAAAGAACCAGAGCAAGCCGGG + Intergenic
1042835003 8:73071779-73071801 CTACACACACAGAGGATGCTGGG - Exonic
1045404761 8:101854783-101854805 ATAAAGTAACAGAGTAAGATTGG + Intronic
1047291534 8:123535226-123535248 CTAAAGAAGCAGCAGCAGCTTGG - Intronic
1048768051 8:137865955-137865977 CTAAAGAAGCAGAGGAACTTTGG - Intergenic
1049276900 8:141724508-141724530 CTAAAGTATCAGAGGCAACTAGG + Intergenic
1049845158 8:144797160-144797182 CCAAAGAATCTGAGGAACCTAGG + Intergenic
1050434104 9:5591083-5591105 TTAAAGAAATAGGGGAAACTTGG + Intergenic
1051725922 9:20088366-20088388 CTAGAGAATCAGAGGCAACTAGG + Intergenic
1055480525 9:76705029-76705051 CTGAAACAATAGAGGAAGCTGGG - Exonic
1056344762 9:85680646-85680668 CTAAAGTAACAGAGCAATCTAGG + Intronic
1056884698 9:90429966-90429988 CTAAGGAAACAGGGGAAGAAAGG + Intergenic
1057511531 9:95683687-95683709 CTAAAAATACAAAGGAGGCTGGG + Intergenic
1058553653 9:106142420-106142442 ACAAAGAAACAGAAGCAGCTCGG + Intergenic
1058898226 9:109418382-109418404 ATAAAGAGACAGAGGGTGCTGGG + Intronic
1059847426 9:118295925-118295947 CTGAAGAAACAAAGAATGCTGGG + Intergenic
1059970784 9:119666111-119666133 TTAAAGAAACAAAGGAAGAAAGG - Intergenic
1060273007 9:122160585-122160607 AGAAAGAAAGAGAGGAAGGTAGG - Intronic
1060297863 9:122355390-122355412 CTACAGAAAGGCAGGAAGCTGGG + Intergenic
1060855553 9:126912807-126912829 ATAAAGAAACCGAGGCAGGTTGG + Intergenic
1061348949 9:130048776-130048798 CAAAAAAAAAAGAGGAAACTGGG - Intergenic
1185590414 X:1272784-1272806 AAAAAGAAAAAGAAGAAGCTAGG - Intronic
1186468374 X:9802427-9802449 CTCAAATAACAGAGGATGCTGGG - Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187315999 X:18195887-18195909 CGAAAGAGACAGAGGAAGGGAGG + Intronic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1187580869 X:20605936-20605958 CTAAAGAACCAGGGGAAGACTGG - Intergenic
1188321592 X:28745056-28745078 CTCAAGAAACTGAGGTAACTTGG - Intronic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1190281334 X:48932646-48932668 AGAAAGAAAAAGAGGAAGCTGGG + Intronic
1190378854 X:49818401-49818423 CTATAGAAACTAAGGAAGGTGGG - Intergenic
1190758984 X:53424078-53424100 ATAAATAAAGGGAGGAAGCTTGG + Intronic
1190895835 X:54617146-54617168 CTAAAGAAACAGAAGAGGATGGG - Intergenic
1191646835 X:63490879-63490901 CTAAAGAAAGACAGGAAGGAAGG + Intergenic
1192033940 X:67544275-67544297 CTAAAGACTCGGAGGAAGCAAGG + Intronic
1192426195 X:71079067-71079089 CTAAAGATACAGAGGGGACTGGG - Intergenic
1195009641 X:100722910-100722932 CTAAAGATCCAGAGAAATCTAGG - Intronic
1195598954 X:106724537-106724559 CTAAAGTAACAGAGGGAGGGTGG - Intronic
1196558436 X:117119482-117119504 CTAAAGAAACACTAGAAGCATGG + Intergenic
1197622887 X:128770942-128770964 CTGAAGAAAGAGTGGAATCTAGG - Intergenic
1197672111 X:129288678-129288700 CAAAAGAAAGACAGGAAGATAGG + Intergenic
1198251890 X:134887124-134887146 ATAAAGAAACAGAAGTAGCCTGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199324981 X:146488722-146488744 ATAAAGAGAAAGAGGAAGCCGGG - Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1200510043 Y:4066524-4066546 CTAAAGAAATACCTGAAGCTGGG + Intergenic
1201184264 Y:11383464-11383486 CTAGAGCAAAAGAGGAAGTTTGG + Intergenic
1201448353 Y:14082917-14082939 CAAAAGAAAAAAAAGAAGCTGGG + Intergenic
1201885372 Y:18875847-18875869 TTAAAGAAAAAGAGGTGGCTGGG - Intergenic