ID: 1103061647

View in Genome Browser
Species Human (GRCh38)
Location 12:117863180-117863202
Sequence AAACAGCTGTACTTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 393}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103061636_1103061647 19 Left 1103061636 12:117863138-117863160 CCCATCACAGCTGCAGGATGCGC 0: 1
1: 0
2: 1
3: 17
4: 118
Right 1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 393
1103061635_1103061647 20 Left 1103061635 12:117863137-117863159 CCCCATCACAGCTGCAGGATGCG 0: 1
1: 0
2: 2
3: 12
4: 141
Right 1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 393
1103061637_1103061647 18 Left 1103061637 12:117863139-117863161 CCATCACAGCTGCAGGATGCGCA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 393
1103061639_1103061647 -10 Left 1103061639 12:117863167-117863189 CCCAGGCCCCACCAAACAGCTGT 0: 1
1: 0
2: 2
3: 22
4: 216
Right 1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG 0: 1
1: 0
2: 1
3: 28
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103061647 Original CRISPR AAACAGCTGTACTTGGGTCA AGG Intronic
901042066 1:6370289-6370311 AAAGAGCTTTATTTGGCTCATGG - Intronic
901291656 1:8129107-8129129 AAAGAGCTTTAATTGGCTCACGG + Intergenic
902296420 1:15470154-15470176 AACCAGCTGTCCTTGGGTGGGGG + Intronic
902299218 1:15489441-15489463 AACCAGCTGTCCTTGGGTGGGGG + Intronic
903451602 1:23457243-23457265 GAACAGCTGGGCTGGGGTCAGGG - Intronic
904778557 1:32927036-32927058 AAACAGGTTTAATTGGCTCATGG + Intergenic
905362422 1:37430027-37430049 AAAGAGGTTTACTTGGCTCATGG - Intergenic
905835834 1:41119967-41119989 AAACAACTCTCCTTAGGTCAGGG + Intronic
905907561 1:41629057-41629079 AAGCAGCTTTACTTGGTACAGGG + Intronic
908690301 1:66772187-66772209 AAACAGGTTTATTTGGCTCATGG + Intronic
909860719 1:80602120-80602142 AAAGAGGTTTAATTGGGTCATGG + Intergenic
910424132 1:87101874-87101896 AAAAAGGTTTACTTGGCTCATGG + Intronic
910593445 1:88952648-88952670 AAAGAGGTTTACTTGGCTCATGG - Intronic
910654474 1:89605816-89605838 AAACAGCTGTATTTTTGCCAAGG - Intergenic
913202529 1:116506833-116506855 AAACAGGTTTAATTGGCTCATGG - Intergenic
914921818 1:151852530-151852552 AAACAGCTGTTCCTGGGTGCTGG + Intronic
914939676 1:152011897-152011919 AAAGAGGTTTAATTGGGTCATGG + Intergenic
915608269 1:156969207-156969229 AGGCAGCAGAACTTGGGTCAAGG + Intronic
916288165 1:163133387-163133409 AAAGAGCTTTAATTGGCTCATGG - Intronic
917522667 1:175760962-175760984 CAGCAGCTGTGCTTGGGTCAAGG - Intergenic
918677395 1:187304589-187304611 GTACAGGTATACTTGGGTCATGG + Intergenic
918913481 1:190604460-190604482 AAAAAGGTGTAATTGGCTCATGG - Intergenic
918957398 1:191226615-191226637 AAATTACTGTACTTTGGTCAAGG - Intergenic
919057468 1:192588804-192588826 AAACAGCTGTTGTTGGGTTCTGG - Intergenic
920553166 1:206882126-206882148 AAACAGGTTTAATTGGCTCACGG - Intergenic
921351675 1:214242464-214242486 AAACAGATTTAATTGGCTCACGG - Intergenic
921734040 1:218606528-218606550 AAACAGGTTTACTTGAGTCACGG - Intergenic
922075451 1:222239078-222239100 AAACAGCTGTACCTAGTTCCAGG - Intergenic
922183057 1:223251188-223251210 AAAAAGGTGTAATTGGCTCATGG + Intronic
922925714 1:229345186-229345208 AAACAGGTTTATTTGGCTCATGG - Intergenic
922977984 1:229801042-229801064 AAACAGGTGTAATTGGCTCATGG - Intergenic
922998049 1:229982546-229982568 AAAGAGGTTTATTTGGGTCACGG + Intergenic
923886732 1:238165393-238165415 AAACATCTGTACTTTGGAAAGGG - Intergenic
924369867 1:243336436-243336458 AAAGAGCTTTAATTGGCTCATGG + Intronic
924856707 1:247881478-247881500 AAACAGGTTTAGTTGGCTCACGG - Intergenic
1063765478 10:9135637-9135659 AAAGAGGTGTAATTGGCTCATGG + Intergenic
1063960823 10:11304219-11304241 CACCAGCTTTACTTGGCTCATGG + Intronic
1064235002 10:13565508-13565530 AAACAGGTTTAATTGGCTCATGG - Intergenic
1064739310 10:18416025-18416047 AAACTGCTGTACTTGGGTGACGG - Intronic
1064868781 10:19913395-19913417 AAAGAGGTTTAATTGGGTCATGG - Intronic
1065174032 10:23060125-23060147 AAAGAGGTGTAATTGGCTCATGG + Intergenic
1065416393 10:25491982-25492004 AAAGAGGTGTATTTGGCTCATGG + Intronic
1065783915 10:29195374-29195396 AAAGAGATTTACTTGGCTCATGG - Intergenic
1066761966 10:38763452-38763474 AAACACCTTTAGTTGGCTCATGG - Intergenic
1066959625 10:42209018-42209040 AAACACCTTTAGTTGGCTCATGG + Intergenic
1067962399 10:50869082-50869104 ACACAGGTGAACTTGTGTCATGG - Intronic
1068071320 10:52199693-52199715 AAATATCTGCACTGGGGTCACGG - Intronic
1070459332 10:76648968-76648990 AAAGAGCTTTAGTTGGCTCACGG - Intergenic
1070975036 10:80599703-80599725 CAACAGCTAAACTTGGGCCAAGG - Intronic
1071871127 10:89795885-89795907 AAAGAGCTTTACTTGGCTTATGG + Intergenic
1074156719 10:110806313-110806335 AAAGAGCTTTAATTGGCTCATGG + Intronic
1074650960 10:115523937-115523959 AAAGAGGTTTACTTGGCTCATGG + Intronic
1075586336 10:123660931-123660953 AAACAGCTTTCCTGGGGGCAGGG + Intergenic
1077257797 11:1596602-1596624 AAACAGATGGACTTGGCTCAGGG + Intergenic
1079178777 11:18169786-18169808 AAACAGGTTTAATTGGCTCATGG - Intronic
1079264224 11:18914840-18914862 AAACAGGTTTAATTGGCTCATGG + Intergenic
1079270055 11:18976131-18976153 AAACAGGTTTAATTGGTTCATGG + Intergenic
1080012226 11:27471588-27471610 AAACACCTGTACCTCAGTCAGGG - Intronic
1080183410 11:29450395-29450417 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1080233567 11:30044719-30044741 AAATGGCTGTGCTTTGGTCAAGG + Intergenic
1082103299 11:48192379-48192401 AAACAGGTTTATTTGGGTTATGG + Intergenic
1082693427 11:56331981-56332003 CAGCAGCTGTACCCGGGTCAGGG + Intergenic
1084804182 11:71567289-71567311 AAACAGATGGACTTGGCTCAGGG - Intronic
1084806252 11:71581281-71581303 AAACAGATGGACTTGGCTCAGGG + Intronic
1084963596 11:72731566-72731588 AAAGAGGTGTATTTGGCTCAGGG - Intronic
1085986941 11:81799252-81799274 AAAAAGGTTTAATTGGGTCAAGG - Intergenic
1086238808 11:84663943-84663965 AAACAGGTGTCCTTTAGTCATGG - Intronic
1087171390 11:95052939-95052961 GAACAGTTTTATTTGGGTCATGG - Intergenic
1088207435 11:107409765-107409787 AAGAAGCTGTACTTGTGTGATGG + Intronic
1088721825 11:112599185-112599207 ACACAGATGAACTTGTGTCATGG - Intergenic
1088923370 11:114278091-114278113 AAAGAGCTTTATTTGGCTCATGG + Intronic
1090156554 11:124444151-124444173 AAAAAGCTGTGCTGGGGACAAGG - Intergenic
1090811297 11:130246476-130246498 AATCAGCTTTATATGGGTCAGGG + Intronic
1092901188 12:13060881-13060903 TACCAGCTGTACTTGGATCTAGG + Intronic
1093855634 12:24098891-24098913 AGAAAGCTGTACTTGGGTGGAGG - Intergenic
1095639130 12:44467004-44467026 AAAGAGGTGTAATTGGCTCATGG - Intergenic
1096384393 12:51185337-51185359 AAACAGCTGCCCTTTGGCCACGG + Intergenic
1097152088 12:56986687-56986709 AAACAGGTTTAATTGGCTCATGG - Intergenic
1097400216 12:59119356-59119378 AAACAGATTTAATTGGCTCATGG + Intergenic
1097673657 12:62572486-62572508 ACACTGCTGCACTTGGGTCTGGG - Intronic
1097922627 12:65092782-65092804 AGACAGCTTTCCTTGGGTTAAGG - Intronic
1098520987 12:71435506-71435528 AAAGAGGTTTACTTGGCTCATGG + Intronic
1098715348 12:73822674-73822696 AAAAAGGTGTAATTGGCTCATGG + Intergenic
1099807777 12:87542235-87542257 AAAGAGCTTTAATTGGCTCATGG - Intergenic
1100039080 12:90290632-90290654 AAAGAGATGTATTTGGCTCATGG + Intergenic
1100915953 12:99422065-99422087 AAACAGATTTAATTGGCTCACGG - Intronic
1101335178 12:103790677-103790699 AAAAAGATGTACTTGGGCCGGGG - Intronic
1101446996 12:104743659-104743681 ACATAGGTGAACTTGGGTCATGG + Intronic
1102812147 12:115833423-115833445 AAAAAGCTGTAACTGTGTCATGG - Intergenic
1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG + Intronic
1103135877 12:118507136-118507158 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1104045017 12:125155777-125155799 AAACAGCTGGGCTTTGGTGAGGG + Intergenic
1104108212 12:125683307-125683329 AAACAGCTTTTCTTAGCTCAGGG + Intergenic
1104127074 12:125858047-125858069 AAACAGGTTTAATTGGCTCATGG - Intergenic
1104406749 12:128524336-128524358 AAACGGCAGCACTTGGGTCCTGG - Intronic
1104496803 12:129248604-129248626 ACACAGGTAGACTTGGGTCATGG + Intronic
1104884497 12:132098566-132098588 AAACAGTTTTAATTGGCTCACGG + Intronic
1105321331 13:19324960-19324982 AAACAGCTTTAATTGGCTCATGG + Intergenic
1105615453 13:22007985-22008007 AAAGAGGTTTACTTGGATCATGG - Intergenic
1107449066 13:40492337-40492359 AAACAGATTTATTTGGCTCATGG - Intergenic
1108032347 13:46246230-46246252 AAAGAGCTTTAATTGGCTCACGG - Intronic
1108128986 13:47276785-47276807 AAAGAGCTTTATTTGGCTCATGG + Intergenic
1108845052 13:54668008-54668030 AAACAGCTGTATTTTTGACATGG - Intergenic
1110110422 13:71738263-71738285 AACAAGGTGTACTTGGGGCAGGG + Intronic
1110819311 13:79896244-79896266 AAAGAGGTTTAATTGGGTCATGG + Intergenic
1111050799 13:82881557-82881579 AAACAGCATTAATTGGCTCATGG - Intergenic
1111327562 13:86719169-86719191 AAACAGGTTTATTTGGCTCACGG - Intergenic
1111753171 13:92359594-92359616 AAAAAGCTTTATTTGGCTCATGG + Intronic
1111804365 13:93021078-93021100 AAAGAGGTGTAATTGGCTCATGG + Intergenic
1111963467 13:94836177-94836199 AATCTGCTCTTCTTGGGTCATGG - Intergenic
1113060927 13:106322042-106322064 AAATAGCTTGACTTGGCTCATGG - Intergenic
1113391106 13:109897936-109897958 AAAGAGATGTATTTGGCTCATGG - Intergenic
1116072489 14:40066666-40066688 AAACAGTTTTAATTGGCTCATGG + Intergenic
1116296439 14:43118057-43118079 CCACAGCTGTAGGTGGGTCAAGG - Intergenic
1116340809 14:43721613-43721635 AAAGAGCTTTATTTGGCTCATGG + Intergenic
1117007166 14:51432719-51432741 AAACTGCAGTACTGAGGTCACGG + Intergenic
1119952201 14:78756676-78756698 AAACAGCTGTACTTGGCAGCTGG + Intronic
1120331814 14:83102788-83102810 ACACAGCTAAACTTGTGTCATGG - Intergenic
1120654890 14:87177617-87177639 AAAGAGGTGTAGTTGGCTCATGG - Intergenic
1121464572 14:94106675-94106697 AAAGAGGTGTACTTGGCTCATGG + Intronic
1121707785 14:96012098-96012120 AAAGAGATTTACTTGGCTCATGG + Intergenic
1123579859 15:21705366-21705388 AGACAGCTGTGCTTGTCTCAGGG - Intergenic
1123616486 15:22147877-22147899 AGACAGCTGTGCTTGTCTCAGGG - Intergenic
1123616507 15:22147988-22148010 AGACAGCTGTGCTTGTCTCAGGG - Intergenic
1123982251 15:25614712-25614734 AGACTGCTGTCCTTAGGTCAGGG + Intergenic
1124158105 15:27245880-27245902 AAACAGGTTTATTTGGCTCACGG + Intronic
1124463121 15:29911448-29911470 AAACAGGTTTAATTGGCTCATGG + Intronic
1124663055 15:31566931-31566953 AAAGAGGTTTACTTGGCTCATGG - Intronic
1125274786 15:37978794-37978816 AAAGAGGTTTAATTGGGTCACGG + Intergenic
1125655050 15:41349376-41349398 GAGCAGCTGGACTTGGGTCTGGG - Intronic
1125881149 15:43197143-43197165 AAAGAGCTTTATTTGGCTCACGG - Exonic
1127271047 15:57402390-57402412 AAAGAGGTTTACTTGGCTCACGG - Intronic
1127692838 15:61414709-61414731 AAACAGGTTTAATTGGCTCACGG + Intergenic
1128381904 15:67119428-67119450 ACACAGCTGTGCTGGGGCCATGG + Intronic
1128400161 15:67270764-67270786 AAACAGATTTATTTGGCTCATGG - Intronic
1129314694 15:74734401-74734423 AAAGAGGTGTAATTGGCTCATGG - Intergenic
1130682994 15:86012640-86012662 AAACATATGTGCTTGGGTCCTGG - Intergenic
1131005427 15:88973556-88973578 AAAGAGCTTTAATTGGGTCTTGG - Intergenic
1131032427 15:89197420-89197442 TCACAGCTGTAGTTGGGTGAAGG - Exonic
1131383834 15:91986231-91986253 AAGCAGCTGAGCCTGGGTCAGGG + Intronic
1202988729 15_KI270727v1_random:439611-439633 AGACAGCTGTGCTTGTCTCAGGG - Intergenic
1134389924 16:13810232-13810254 AAACAGCTGTTCTGAGGGCAAGG + Intergenic
1134647560 16:15882232-15882254 AAAGAGGTTTACTTGGCTCACGG - Intronic
1135933825 16:26762200-26762222 AAAGAGCTATATTTGGCTCATGG + Intergenic
1137419945 16:48324430-48324452 AGACGGCTGTACTTGTGTCAGGG - Intronic
1139152266 16:64396963-64396985 AAAGAGGTTTACTTGGCTCACGG + Intergenic
1140609587 16:76581920-76581942 AAAGAGGTGTAATTGGCTCATGG - Intronic
1140650371 16:77081722-77081744 AATGAGCTGTAATTGGGCCACGG - Intergenic
1140895303 16:79319478-79319500 AAACAGTTGTGCTTGGGGAAGGG - Intergenic
1141017825 16:80466864-80466886 AAGGATCTGTGCTTGGGTCAAGG - Intergenic
1142798888 17:2331663-2331685 AAAGAGATTTAATTGGGTCATGG - Intronic
1143455762 17:7066659-7066681 AAAGAGCTTTACTTGGCTCATGG + Intergenic
1143735087 17:8905921-8905943 AAACAGCTGTGGTTGGGTTTGGG - Intronic
1144150189 17:12435690-12435712 AAAAAGGTTTACTTGGCTCATGG - Intergenic
1146608636 17:34285416-34285438 AAACACCTGTAGTTGGGGAAAGG - Intergenic
1147728201 17:42579964-42579986 ACACCCCTGTACTTGGGTGAGGG - Exonic
1147789362 17:43003752-43003774 AAACAGCTGCTCTAGGCTCAGGG - Intergenic
1150329588 17:64284212-64284234 AAAGAGGTTTAATTGGGTCATGG + Intergenic
1150835344 17:68558660-68558682 AAAAAGATGTAATTGGCTCATGG - Intronic
1151432712 17:74075035-74075057 AAAGAGGTTTACTTGGCTCATGG + Intergenic
1151517142 17:74603958-74603980 AAACAGCTGTGCCTGGGAAAAGG + Intergenic
1151808257 17:76420273-76420295 AAACAACTGGCCTTGGATCAGGG - Intronic
1151868054 17:76817958-76817980 AAACAGGTTTAATTGGCTCACGG + Intergenic
1153421012 18:4905235-4905257 AAAGAGGTGTAATTGGCTCAGGG + Intergenic
1155853484 18:30801956-30801978 AAAGAGGTGTAATTGGCTCATGG + Intergenic
1155853725 18:30805562-30805584 AAACAGCTTTACTGCTGTCATGG + Intergenic
1156068374 18:33174026-33174048 AAAGAGATGTAATTGGCTCACGG + Intronic
1156986913 18:43359894-43359916 AAACAGGTTTAATTGGCTCATGG + Intergenic
1156995937 18:43466727-43466749 AAAGAGGTTTAATTGGGTCATGG + Intergenic
1158406303 18:57162801-57162823 AAAGAGGTTTAATTGGGTCACGG - Intergenic
1158564242 18:58541139-58541161 AAAGAGGTGTAATTGGCTCACGG + Intronic
1159002938 18:62989187-62989209 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1159149827 18:64506159-64506181 AAAGAGGTGTAGTTGGCTCATGG - Intergenic
1159218380 18:65427540-65427562 AAAGAGGTGTAATTGGCTCATGG - Intergenic
1159277481 18:66239427-66239449 ATATAGGTGAACTTGGGTCATGG - Intergenic
1159960096 18:74548491-74548513 AAAGAGGTGTAATTGGCTCATGG - Intronic
1160010014 18:75100211-75100233 AAATAGGTTTATTTGGGTCATGG + Intergenic
1163145453 19:15376892-15376914 GCAGAGCTGAACTTGGGTCAAGG - Intronic
1164710691 19:30355096-30355118 AAGCAGGTGTATTTGGCTCATGG + Intronic
1165192129 19:34073596-34073618 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1166352187 19:42204568-42204590 AAAGAGATTTACTTGGCTCACGG - Intronic
1166380788 19:42354099-42354121 AAACAGCAATACTAGGGTCAGGG - Intronic
925559957 2:5180969-5180991 AAACAGGTTTAGTTGGCTCATGG + Intergenic
926454864 2:13054554-13054576 AAAGAGGTGTAATTGGCTCACGG - Intergenic
926814933 2:16790936-16790958 AAACAGGTTTAATTGGCTCATGG + Intergenic
927358766 2:22207410-22207432 AAGCAGCTGTACTTGGTTTATGG + Intergenic
927897112 2:26790070-26790092 AACCACTTGTTCTTGGGTCATGG + Intronic
928074307 2:28249048-28249070 AAAAAGCTATACTTAGCTCAAGG - Intronic
928235832 2:29538550-29538572 AAAGAGGTGTAATTGGCTCATGG - Intronic
929175746 2:38973819-38973841 ACACAGCTGTTCCTTGGTCAAGG - Exonic
929419482 2:41776224-41776246 AAACAGGTTTATTTGGCTCATGG - Intergenic
929948664 2:46389532-46389554 GTGCAGCTGTACTTGGGCCAAGG + Intergenic
930260559 2:49141302-49141324 AAAGAGGTTTAATTGGGTCATGG + Intronic
930653562 2:53986323-53986345 AAAGAGGTTTACTTGGCTCAAGG - Intronic
931450586 2:62364626-62364648 AAACTGCTGGGCTGGGGTCAGGG + Intergenic
932490516 2:72117101-72117123 AAAGAGGTTTACTTGGCTCATGG + Intergenic
932659500 2:73640179-73640201 AAAGAGGTGTATTTGGTTCATGG - Intergenic
932666065 2:73699850-73699872 AAAGAGGTGTATTTGGTTCATGG - Intergenic
933484992 2:82909814-82909836 AAACAGCTTTAATTGGCTTATGG - Intergenic
933989522 2:87624265-87624287 AAAGAGGTTTACTTGGCTCACGG + Intergenic
934325281 2:92008082-92008104 AAACACCTTTAGTTGGCTCATGG - Intergenic
934463654 2:94238846-94238868 AAACACCTTTAGTTGGCTCATGG - Intergenic
936304321 2:111326561-111326583 AAAGAGGTTTACTTGGCTCACGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936714018 2:115162999-115163021 AGAGAGCTGCACTTAGGTCAGGG + Intronic
937320954 2:120960432-120960454 AAACCGGTGTACTGGGGACAAGG - Intronic
937558733 2:123193885-123193907 AAACAGGTTTATTTGGCTCATGG + Intergenic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
938844411 2:135194207-135194229 AAAGAGGTGTATTTGGCTCATGG + Intronic
939024527 2:136996396-136996418 AATGAGCTGTAATTGCGTCACGG - Intronic
939779746 2:146431038-146431060 AAAGAGGTGTAATTGGCTCATGG - Intergenic
940412177 2:153377686-153377708 AAATAGCTTTATTTGGCTCATGG - Intergenic
940488766 2:154329951-154329973 AAAGAGGTTTACTTGGCTCATGG - Intronic
940965388 2:159831375-159831397 AAAGAGCTTTAATTGAGTCACGG - Intronic
941163766 2:162063655-162063677 AAACAGCTGTATTCTTGTCAAGG - Intronic
942026041 2:171911986-171912008 AAATGGCTGTGCTTTGGTCAAGG + Intronic
942104675 2:172620868-172620890 AAAGAGATGTAATTGGCTCACGG - Intergenic
943532634 2:189103640-189103662 GACCAGCTATACTCGGGTCATGG + Intronic
943549115 2:189316686-189316708 ATACAGGTGAACTTGTGTCATGG - Intergenic
944059717 2:195559545-195559567 AAACATCTGTATTTGTTTCACGG - Intergenic
944447742 2:199808209-199808231 AAAGAGATGTAATTGGCTCATGG - Intronic
944484219 2:200187106-200187128 TAAAAGCTGTTGTTGGGTCAAGG + Intergenic
945145931 2:206738050-206738072 AAACAGATGTACTTCACTCAAGG - Exonic
946764717 2:223029956-223029978 AAAGAGGTTTACTTGGCTCATGG + Intergenic
948224776 2:236300314-236300336 AAAGAGGTTTACTTGGCTCACGG - Intergenic
948803340 2:240442583-240442605 ACACAACTCTAATTGGGTCAGGG + Intronic
1169166835 20:3431408-3431430 AATCAGCTGGGCTTGGCTCAAGG - Intergenic
1169334320 20:4742818-4742840 AAATAGGTTTACTTGGTTCATGG - Intergenic
1169868430 20:10225518-10225540 TAACAGCTGTACTGGGCTTATGG + Intronic
1170509718 20:17064212-17064234 AATCAGCTGGACTTGGCTCATGG + Intergenic
1174135869 20:48378753-48378775 AAAGAGCTTTACTTGGCTCATGG - Intergenic
1174682176 20:52419443-52419465 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1174736130 20:52967831-52967853 AATCTGCTGTGCTTGGGGCAAGG + Intergenic
1175195874 20:57243023-57243045 AAACAGCTGTATGTGGCTCATGG + Intronic
1175423206 20:58848836-58848858 AAACATCAGTAATGGGGTCAGGG - Intronic
1177188254 21:17821245-17821267 AAACAGGTTTATTTGGCTCATGG + Intergenic
1177273408 21:18876970-18876992 AAACACATGTAATTGGCTCACGG + Intergenic
1178237652 21:30861351-30861373 AAAGAGATGTATTTGGCTCATGG + Intergenic
1178361190 21:31949706-31949728 AAAGAGCTCTATTTGGCTCATGG + Intronic
1178603462 21:34015020-34015042 AAAGAGGTTTAATTGGGTCATGG + Intergenic
1179782105 21:43707913-43707935 AAAGAGCTTTAATTGGCTCACGG - Intergenic
1180093849 21:45545510-45545532 AAATAGGTGTAATTGGCTCACGG - Intergenic
1180169846 21:46052355-46052377 ACACAGCTGCACTGGGGGCAAGG - Intergenic
1180584781 22:16877844-16877866 AAACACCTTTAGTTGGCTCACGG - Intergenic
1180942545 22:19668796-19668818 AAAAAGCTTTACTTGGCTCACGG + Intergenic
1181878956 22:25962060-25962082 AAAGAGGTTTACTTGGCTCACGG - Intronic
1184174764 22:42782084-42782106 AAAGAGCTTTAATTGGCTCATGG - Intergenic
1184571691 22:45328832-45328854 AAAGAGCTGTAATTGGCTCACGG + Intronic
1184852894 22:47130895-47130917 AAAGAGGTGTATTTGGCTCAGGG + Intronic
1184999342 22:48234562-48234584 ATACAGGTATACTTGTGTCACGG - Intergenic
949280736 3:2343827-2343849 AAAGAGGTTTACTTGGCTCATGG + Intronic
949662999 3:6303588-6303610 ATACACCTGAACTTGGGGCAGGG - Intergenic
950087384 3:10269909-10269931 GAACAGCTGTATTGGGTTCAGGG - Intronic
950220890 3:11195352-11195374 AAACAGCTGTGCCTGGGGCTAGG + Intronic
950870571 3:16224995-16225017 AAAAAGGTGTAATTGGCTCATGG + Intronic
951059678 3:18190533-18190555 AAACAGCTCTTCTTGGGTGGTGG - Intronic
951109296 3:18783236-18783258 ATACAGCTGTACTCAGGTGATGG + Intergenic
951237082 3:20249337-20249359 AAAGAGGTTTACTTGGCTCATGG + Intergenic
951407744 3:22322019-22322041 AAAAAGCTATAATTGGGTAAAGG - Intronic
953586686 3:44207472-44207494 ATACGGATGTACTTTGGTCAAGG - Intergenic
954559000 3:51539668-51539690 AATCAGCTTTATGTGGGTCATGG + Intergenic
954848981 3:53584294-53584316 AAACAGCTGTAATTAGCACAAGG + Intronic
955109433 3:55933344-55933366 AAACAGCTGTACATGGGTTTTGG + Intronic
956449454 3:69358976-69358998 AAACAGATTTATTTGGCTCATGG - Intronic
957576674 3:82016247-82016269 AAACAGGTTTAATTGGCTCATGG - Intergenic
958752173 3:98204260-98204282 AATCATCTGTACTTGGATCACGG - Intergenic
959310786 3:104734282-104734304 ATATAGGTGTACTTGTGTCATGG + Intergenic
960292350 3:115900844-115900866 AAACAGCTGATTTTGGTTCATGG + Intronic
961656748 3:128446730-128446752 AAAGAGGTTTAATTGGGTCACGG - Intergenic
962047069 3:131771658-131771680 AAACAGGTTTATTTGGTTCATGG - Intronic
962264027 3:133933158-133933180 GAACAGCTGGGCATGGGTCATGG - Exonic
962423872 3:135251826-135251848 AATCAGCTGTGCTGGGTTCAGGG + Intronic
963867585 3:150379149-150379171 AAAAAGGTGTAATTGGCTCATGG - Intergenic
964608552 3:158585441-158585463 AAAGAGGTTTATTTGGGTCATGG - Intronic
965767265 3:172144031-172144053 AAAGAGGTTTAATTGGGTCATGG + Intronic
966230793 3:177649277-177649299 GAACAGCTTTCCTTGGGCCAAGG + Intergenic
967324365 3:188224565-188224587 AAGAAGGTGTAATTGGGTCATGG + Intronic
967921598 3:194618039-194618061 AACCAGGTGTAATTGGCTCACGG - Intronic
968006388 3:195245954-195245976 AAAGAGGTGTAATTGGCTCATGG - Intronic
968513024 4:1003571-1003593 AACCAGCTGCCCTTGGGTCAGGG - Exonic
969230018 4:5823782-5823804 AAAGAGGTTTACTTGGCTCACGG - Intronic
970747138 4:19312568-19312590 AAAGAGCTTTAATTGGCTCATGG - Intergenic
971751225 4:30650902-30650924 AAAAAGCAAAACTTGGGTCACGG + Intergenic
972759402 4:42088473-42088495 AAAGAGCTTTAATTGGCTCATGG + Exonic
973635443 4:52857876-52857898 AAAAAGGTTTACTTGGCTCATGG - Intergenic
973731982 4:53831698-53831720 AAACAGGTTTAATTGGCTCATGG - Intronic
975419493 4:74145948-74145970 AAAGAGGTTTACTTGGCTCAAGG - Intronic
975975221 4:80087890-80087912 AAATAGGTGTATTTGGCTCATGG + Intronic
976045474 4:80941684-80941706 AAACAGGTTTAATTGGCTCATGG + Intronic
977070733 4:92382912-92382934 AAAGAGGTTTAGTTGGGTCATGG + Intronic
979515353 4:121603009-121603031 AAAGAGATGTAATTGGCTCACGG + Intergenic
979745986 4:124213680-124213702 ACACAGGTAAACTTGGGTCACGG + Intergenic
980910444 4:138989209-138989231 AAACAGGTTTAATTGGCTCACGG - Intergenic
981075711 4:140589272-140589294 AAACGGCTGTGCTTTGATCAAGG - Intergenic
981419407 4:144532293-144532315 AAAGAGGTTTACTTGGCTCATGG - Intergenic
981819578 4:148870162-148870184 ATAAAGATGTAATTGGGTCATGG - Intergenic
982027927 4:151270488-151270510 AAAGAGCTTTAATTGGCTCATGG - Intronic
982096118 4:151925044-151925066 AACCAGCTTTTCCTGGGTCAGGG - Intergenic
982208075 4:153012247-153012269 AAACAGGTTTAATTGGCTCATGG + Intergenic
982677492 4:158392692-158392714 AAACAGGTGTTCTTGGCTGATGG - Intronic
983353343 4:166622916-166622938 AAACAGATGTATTTGGCTCATGG + Intergenic
984405159 4:179319978-179320000 AAAGAGGTGTAATTGGCTCATGG + Intergenic
985357120 4:189133173-189133195 AAAGAGGTTTACTTGGCTCATGG - Intergenic
986073823 5:4313837-4313859 AAACAGCTTCACATGGGTCCTGG + Intergenic
986124846 5:4875393-4875415 AAAAAGGTGTAATTGGCTCATGG + Intergenic
986183302 5:5414326-5414348 ACACAGGTATACTTGGGCCATGG - Intergenic
986214099 5:5702024-5702046 AAACAGGTTTAATTGGCTCATGG + Intergenic
986916500 5:12626240-12626262 AAACAGGTTTAATTGGCTCATGG - Intergenic
986940745 5:12946113-12946135 AAAGAGGTGTAATTGGCTCACGG - Intergenic
987069763 5:14325294-14325316 AAACAGGTTTATTTGGCTCACGG + Intronic
987831159 5:23096903-23096925 ACACAGGTAAACTTGGGTCATGG - Intergenic
988027859 5:25722383-25722405 AAAGAGATGTACCTGGCTCATGG - Intergenic
988635256 5:32976883-32976905 AAAGAGGTGTAATTGGCTCATGG - Intergenic
989268687 5:39506495-39506517 ACACAGCTGTCCTGAGGTCATGG - Intergenic
989373928 5:40739712-40739734 AAACAGGTTTAATTGGCTCACGG - Intronic
989662514 5:43814969-43814991 AAACAGGTTTAATTGGCTCATGG - Intergenic
989690064 5:44131411-44131433 AAAAAGATGTAATTGGCTCATGG + Intergenic
990619091 5:57540562-57540584 AAAGAGCTGTAATTGGCTCATGG - Intergenic
990805964 5:59662143-59662165 AACCAGCTGTACTCTGGGCAAGG + Intronic
991266390 5:64724152-64724174 AAATAGCTATACTTGGGGCATGG + Exonic
994430591 5:99654793-99654815 AAACAGGTATACTGGGGCCATGG - Intergenic
995335465 5:110993398-110993420 ATACAGGTGAACTTGTGTCATGG - Intergenic
999227181 5:150035407-150035429 AAAGGGAGGTACTTGGGTCAGGG - Intronic
999680768 5:154057986-154058008 AAACTGCTGTATTTGGGCCCAGG - Intronic
1000882434 5:166713779-166713801 AAAGAGGTTTACTTGGCTCATGG + Intergenic
1001007184 5:168063066-168063088 AAACAGCTTTACTAGGTTTAGGG + Intronic
1001197988 5:169691007-169691029 AAAGAGCTTTAATTGGCTCATGG + Intronic
1001234113 5:170015001-170015023 AAACAGCTGAACTGGGGAAAGGG - Intronic
1001247011 5:170112343-170112365 AAAGAGCTCAGCTTGGGTCAGGG - Intergenic
1001751837 5:174137250-174137272 AAACAGCTGTAACAGGGTGAGGG + Intronic
1001890958 5:175338075-175338097 AAACAGGTTTATTTGGCTCATGG - Intergenic
1003612055 6:7622581-7622603 AAACAGCTGTGCCTGAGTCTCGG - Intergenic
1005489649 6:26335700-26335722 AAAGAGGTGTATTTGGCTCATGG + Intergenic
1005669987 6:28095680-28095702 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1008557642 6:52689889-52689911 AAATAGCTATACTTGGGGCATGG - Intergenic
1008904335 6:56659559-56659581 AAACACTTATTCTTGGGTCATGG - Intronic
1009909331 6:69905701-69905723 ACACGGCTGTGCTTTGGTCAAGG - Intronic
1009957834 6:70477414-70477436 AAAGAGGTTTAATTGGGTCATGG + Intronic
1010525552 6:76895924-76895946 AAAGAGCTTTAATTGGCTCATGG - Intergenic
1011910771 6:92434442-92434464 AAACAGGTTTACTTGGCTCACGG - Intergenic
1013339333 6:109198133-109198155 AAACAGGTCTACTTTGATCAAGG - Intergenic
1015285981 6:131487026-131487048 AAACAGGTTTATTTGGCTCATGG + Intergenic
1017109498 6:150919202-150919224 AAACAGATTTAATTGGCTCACGG + Intronic
1018161225 6:161044698-161044720 AAAGAGGTGTATTTGGCTCATGG + Intronic
1020989808 7:15182792-15182814 AAACAGGTTTAATTGGTTCATGG + Intergenic
1021761077 7:23903719-23903741 AAAGAGGTGTAATTGGCTCATGG + Intergenic
1021803720 7:24334154-24334176 TAACAGCTGGACTTGGCCCATGG - Intergenic
1022714912 7:32891159-32891181 AAACAGCTTTACTTCGGTAAGGG + Intronic
1022907494 7:34871095-34871117 AAACAGATTTAATTGGTTCATGG + Intronic
1023957041 7:44894821-44894843 ACACAGATGTACTTGGATGAGGG + Intergenic
1024624535 7:51193998-51194020 ACACAGCTAAACTTGTGTCATGG + Intronic
1025799859 7:64775597-64775619 AAACAGGTTTACTTAGCTCATGG - Intergenic
1026146263 7:67749387-67749409 AAAGAGGTTTACTTGGCTCATGG + Intergenic
1026477412 7:70748952-70748974 TCACAGTTGTACTTGGGGCAAGG + Intronic
1026619048 7:71934401-71934423 AAAGAGGTTTACTTGGCTCATGG + Intronic
1026864664 7:73816036-73816058 AAAGAGGTGTATTTGGCTCATGG + Intronic
1027513906 7:79116926-79116948 AAAAAGCTTTAATTGGCTCATGG - Intronic
1028269693 7:88773649-88773671 AAACAGATTTAATTGGCTCACGG + Intronic
1031961632 7:127995345-127995367 AGTCAGCTGTATGTGGGTCAGGG - Intronic
1032510856 7:132471258-132471280 AAAGAGGTGTAATTGGCTCATGG - Intronic
1033841276 7:145377392-145377414 AAAGAGGTTTACTTGGCTCATGG + Intergenic
1033868545 7:145721436-145721458 AAACAGGTTTATTTGGCTCATGG + Intergenic
1035726759 8:1829546-1829568 AGGCAGCTGGACGTGGGTCAGGG - Intronic
1037393760 8:18420767-18420789 AAAGAGGTTTATTTGGGTCATGG - Intergenic
1038489698 8:27961468-27961490 AAACAGGTTTATTTGGCTCATGG - Intronic
1040055217 8:43051809-43051831 AAAGAGGTTGACTTGGGTCATGG - Intronic
1042152486 8:65803091-65803113 AAAGAGGTGTACTTGGCTCACGG - Intronic
1042529321 8:69798350-69798372 AAAGAGCTTTAATTGGCTCATGG + Intronic
1045718731 8:105080172-105080194 AAAGAGGTGTATTTGGCTCATGG - Intronic
1045966721 8:108033335-108033357 TAGCAGCTGGACTGGGGTCATGG - Intronic
1047304666 8:123643047-123643069 AAACAGGTTTATTTGGTTCATGG + Intergenic
1047322015 8:123795590-123795612 AAACAGGTTTAATTGGCTCATGG - Intronic
1047386049 8:124410240-124410262 GAACAGCTGTACTTGATTCTGGG - Intergenic
1047399708 8:124535746-124535768 AAAGAGGTGTATTTGGCTCATGG + Intronic
1048705423 8:137147974-137147996 AAAGAGGTGTACTTGGCTCACGG + Intergenic
1049179846 8:141216637-141216659 AACCAGGGGTAATTGGGTCAGGG - Intronic
1050592753 9:7176868-7176890 ATACAGCTGTACTTGGTTATAGG - Intergenic
1051994022 9:23192125-23192147 AAACAGCTGTGTTTGCTTCAGGG - Intergenic
1052877662 9:33579314-33579336 AAAGAGGTGTAATTGGCTCACGG - Intergenic
1053498326 9:38564894-38564916 AAAGAGGTGTAATTGGCTCACGG + Intronic
1053693725 9:40615499-40615521 AAACACCTTTAGTTGGCTCATGG - Intergenic
1053940712 9:43245926-43245948 AAACACCTTTAGTTGGCTCATGG - Intergenic
1054271111 9:63024637-63024659 AAACACCTTTAGTTGGCTCATGG + Intergenic
1054304970 9:63414727-63414749 AAACACCTTTAGTTGGCTCATGG - Intergenic
1054403715 9:64738705-64738727 AAACACCTTTAGTTGGCTCATGG - Intergenic
1054437335 9:65224210-65224232 AAACACCTTTAGTTGGCTCATGG - Intergenic
1054493067 9:65797766-65797788 AAACACCTTTAGTTGGCTCATGG + Intergenic
1056109198 9:83377753-83377775 AAACAGGTTTAGTTGGCTCATGG - Intronic
1058286073 9:103180093-103180115 AATCAGCTATTCCTGGGTCATGG + Intergenic
1058572955 9:106367106-106367128 AAAGAGATTTACTTGGCTCATGG + Intergenic
1061934594 9:133850310-133850332 CTGCAGCTGTACCTGGGTCAGGG - Intronic
1185828708 X:3277584-3277606 AAAGAGGTGTAATTGGCTCATGG + Intronic
1186385597 X:9107389-9107411 AAATAGGTGTATTTGGCTCACGG - Intronic
1186700679 X:12086864-12086886 AACCAGGTGAACTTGGGTGATGG - Intergenic
1186926778 X:14342381-14342403 GAACAGCTGGACATGGGGCAGGG - Intergenic
1187050480 X:15691107-15691129 AAAGAGGTTTACTTGGCTCATGG + Intronic
1187650315 X:21395575-21395597 AGACAGCTTTACTTCTGTCAGGG + Intronic
1187985444 X:24805617-24805639 CAACAGCTGTACTTTGTTAAGGG + Intronic
1189207978 X:39258073-39258095 AAAGAGATGTATTTGGCTCATGG - Intergenic
1190944790 X:55081540-55081562 ATACAGGTGAACTTGTGTCATGG + Intergenic
1190958065 X:55216807-55216829 ATACAGATGAACTTGTGTCATGG + Intronic
1190965060 X:55291772-55291794 ATACAGGTGAACTTGTGTCATGG + Intergenic
1191846443 X:65550944-65550966 CAGCAGCTGTCCTTGGGCCAGGG - Intergenic
1191873487 X:65770169-65770191 AAAGAGCTTTAATTGGCTCATGG - Intergenic
1191944437 X:66516259-66516281 AAAGAGGTTTACTTGGCTCATGG - Intergenic
1192744154 X:73922084-73922106 AAAGAGGTTTATTTGGGTCATGG + Intergenic
1193046258 X:77058071-77058093 AAACAGGTTTATTTGGCTCATGG - Intergenic
1193527455 X:82611278-82611300 AAACAGGTTTAATTGGCTCATGG - Intergenic
1193632884 X:83911541-83911563 AAACAGGTTTATTTGGCTCATGG + Intergenic
1193704256 X:84801806-84801828 AAACAGATTTACTTGACTCATGG - Intergenic
1194360192 X:92941034-92941056 AAAGAGGTTTAATTGGGTCACGG + Intergenic
1194522034 X:94931188-94931210 AAAGTGCTGTCCTAGGGTCAGGG + Intergenic
1194898740 X:99479938-99479960 AAACAACTGTAAATGGATCAAGG + Intergenic
1195428151 X:104758830-104758852 AAACATTTGGAATTGGGTCACGG - Intronic
1195717210 X:107828263-107828285 AAAGAGGTTTAATTGGGTCATGG - Intronic
1197303249 X:124806930-124806952 AAAGAGGTTTACTTGGCTCATGG + Intronic
1197812652 X:130461282-130461304 AAAGAGCTTTAGTTGGCTCATGG + Intergenic
1198610690 X:138396345-138396367 AAACAGGTTTAGTTGGCTCATGG - Intergenic
1199250670 X:145658532-145658554 AAAGAGCTTTAATTGGCTCATGG - Intergenic
1201071484 Y:10150823-10150845 ACATAGCTGTACCTGGGTCTGGG - Intergenic
1201191506 Y:11447054-11447076 AAACAACTTTAGTTGGCTCATGG - Intergenic