ID: 1103065279

View in Genome Browser
Species Human (GRCh38)
Location 12:117892367-117892389
Sequence CTCTTTGTTTGAGAGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103065279 Original CRISPR CTCTTTGTTTGAGAGGCATA AGG (reversed) Intronic
901254731 1:7812886-7812908 CTCTTTGCTTGAGAGACATGAGG + Intronic
902968113 1:20026035-20026057 CTCATTGTTTGATGGGCATTTGG + Intergenic
906956162 1:50376553-50376575 CTCATTGATTGATAGGCATTTGG - Intergenic
907041641 1:51266203-51266225 TTCTGAGTTTGAGAGGCATGTGG + Intronic
907879768 1:58536732-58536754 CTTTTTGCTTTAGGGGCATAAGG - Exonic
908752845 1:67441332-67441354 CTTTTTGTTTGAGAAGAAAACGG + Intergenic
911223915 1:95283284-95283306 CTCTTGGTTGGAAAGGCAAAGGG - Intergenic
911689593 1:100817771-100817793 CTCATTGATTGATAGGCATTTGG - Intergenic
912622990 1:111184018-111184040 CTCTTTGTTAGAGAGACAGATGG - Intronic
912800641 1:112717705-112717727 CTCTTAGTTTAAGAGGCCTTTGG - Intergenic
912947962 1:114100355-114100377 CTCTGTGATTCATAGGCATATGG + Intronic
913384122 1:118241074-118241096 CTCATTGATTGATAGGCATTTGG - Intergenic
916261040 1:162842475-162842497 CTCTTTGATTGATGGGCATTTGG - Intronic
919205015 1:194410576-194410598 CTCTATCTTTGAGAAGAATATGG - Intergenic
919278309 1:195450004-195450026 CTCTTTGGTTGATGGGCATTTGG - Intergenic
920687632 1:208121325-208121347 CTCTGTGTTTTAGAAGCAGATGG + Intronic
920908611 1:210193559-210193581 CTCTTTGCTAGAGAGGGATTGGG - Intergenic
921360124 1:214323835-214323857 CTCTCTGTTAGGGAGGCAGAGGG - Intronic
1063810484 10:9699605-9699627 TTCCTTGTTTGACAGGCAAAGGG - Intergenic
1064711088 10:18125750-18125772 GTCTTGCTTTGAGATGCATAGGG + Intergenic
1065418106 10:25510938-25510960 CTCATTGCTTGATGGGCATATGG + Intronic
1066484422 10:35829818-35829840 CTCATTGATTGATAGGCATTTGG + Intergenic
1067399121 10:45954883-45954905 GGATTTGATTGAGAGGCATAAGG - Intergenic
1067867442 10:49924099-49924121 GGATTTGATTGAGAGGCATAAGG - Intronic
1068036915 10:51771340-51771362 CTCTTTTTTTAAGAGGAAGAAGG - Intronic
1069065561 10:63938553-63938575 TTCTTTGGTTGTGAGGTATAAGG - Intergenic
1069091216 10:64200965-64200987 CCCTTTGTCTGAGAGCCAGAAGG - Intergenic
1070888392 10:79924121-79924143 CTCATTGTGTGAATGGCATACGG - Intergenic
1071056600 10:81518888-81518910 CTCATTGATTGACAGGCATTTGG - Intergenic
1073734838 10:106334111-106334133 CTCTGTGTTTAAGAGGAAAAAGG - Intergenic
1074287963 10:112116112-112116134 CTCTTTGTGGAAGAGGCAAAGGG - Intergenic
1074501375 10:114028047-114028069 CACTTTGTTTGAGGGGCACGGGG - Intergenic
1074563749 10:114557825-114557847 TTTTTTTTTTGAGAGTCATAAGG - Intronic
1075066987 10:119295551-119295573 CTCATTGATTGACAGGCATTTGG - Intronic
1075684067 10:124351824-124351846 TTCTTGGTTAGAGAGGCATGAGG - Intergenic
1076553694 10:131306813-131306835 CTTTTAGTTGGAGAGGCTTATGG - Intronic
1077626334 11:3775090-3775112 TTCTTTTTTTGAGAGGGATTGGG - Intronic
1077876292 11:6310240-6310262 CTCGTTGATTGATAGGCATTTGG + Intergenic
1079484079 11:20915726-20915748 TTTTTTTTTTGAGAGGAATAAGG + Intronic
1079650709 11:22925338-22925360 TTCTTTGTTAGAGAGGCTTTCGG - Intergenic
1082021658 11:47539096-47539118 ATTTTTGTTTGTGAGGCATATGG - Intronic
1083643873 11:64160864-64160886 CTCTTTTGTTGATAGGCATTTGG - Intronic
1086997404 11:93373682-93373704 CTCATTGATTGATAGGCATTTGG + Intronic
1087589386 11:100166851-100166873 ATCTTAGTTTTAGAGTCATATGG + Intronic
1088434856 11:109800737-109800759 CTCTTTGATTGATGGGCATTTGG + Intergenic
1088658037 11:112019803-112019825 ACTTTTGTTTGAAAGGCATAAGG + Intronic
1089074519 11:115727613-115727635 TTCTGTGTTTGTAAGGCATATGG - Intergenic
1090666955 11:128920731-128920753 CTGTTTGTTTGGGAGGCACTTGG - Exonic
1091520368 12:1233984-1234006 CTCTTTTTTGGAGATGCATCAGG + Intronic
1091713341 12:2758607-2758629 CTCATTGATTGAGGGGCATTTGG - Intergenic
1094355144 12:29569643-29569665 CTCTTTGTGTTAGAGGGAAAAGG - Intronic
1099476696 12:83116329-83116351 CTCGTTGATTGATAGGCATTTGG + Intronic
1102989649 12:117305718-117305740 CTCTATTTCTGAGAGGCATTTGG + Intronic
1103065279 12:117892367-117892389 CTCTTTGTTTGAGAGGCATAAGG - Intronic
1103826891 12:123746192-123746214 TTTTTTTTTTGGGAGGCATAGGG + Intronic
1105988617 13:25594932-25594954 CTCGTTGTTTGATGGGCATTTGG - Intronic
1106053312 13:26212193-26212215 CTCTTGATTTTAGTGGCATAGGG - Intronic
1106947369 13:34843588-34843610 TTCTTATTTTTAGAGGCATATGG - Intergenic
1107761340 13:43682756-43682778 TTCTTTTTCTGAGAGGCATCTGG - Intronic
1108469005 13:50749329-50749351 CTCTTTGATTGATGGGCATTTGG + Intronic
1110350070 13:74496658-74496680 TTCTTTTTTTGAGGGGGATATGG + Intergenic
1110509882 13:76337145-76337167 CTCTTTGTTTGAGTGGAGTTGGG - Intergenic
1110604979 13:77421661-77421683 CTCATTGTTTGATGGGCATTTGG - Intergenic
1111492608 13:89002132-89002154 CTCATTGATTGATAGGCATTTGG + Intergenic
1111575257 13:90145051-90145073 CACTTTGTTTGACAGGCCCAGGG - Intergenic
1112124429 13:96448729-96448751 CACTTTGTTAGAGAGACATTAGG - Intronic
1112728764 13:102335546-102335568 CTCTTTCTTTCATAGGCATTCGG - Intronic
1114279787 14:21181640-21181662 CTCTTTGATTGATGGGCATCTGG + Intergenic
1114284082 14:21223352-21223374 TTCTTTGTAGGAGAGGCATTTGG - Intronic
1117756792 14:58982747-58982769 CTCATTGATTGATAGGCATTTGG + Intergenic
1119416769 14:74476161-74476183 CCCTTTGTGGCAGAGGCATATGG + Intergenic
1120171662 14:81252211-81252233 CTCTTTGTTTGAGTTACAAAAGG - Intergenic
1120229363 14:81826283-81826305 CTTTCTGTTTGAGAGGAATGAGG - Intergenic
1120472982 14:84950061-84950083 CTCTAGGGTTGAGAGGAATATGG - Intergenic
1122350986 14:101090419-101090441 CTCATTGTTTCCGAGGCATTTGG - Intergenic
1122420808 14:101575913-101575935 CTGTTTGTTAGAAAGGGATAAGG + Intergenic
1123936554 15:25196848-25196870 CTCTGTGTTTGGGAGGTATGCGG + Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1125413646 15:39430354-39430376 CTCTTTGTTTGAAAAGTGTAAGG + Intergenic
1125921317 15:43527463-43527485 CTCCTTGGTTGAGAGGCATGGGG - Exonic
1127694283 15:61429233-61429255 CTCATTGATTGAGGGGCATTTGG + Intergenic
1128105496 15:65041618-65041640 CTCTAAATTTTAGAGGCATATGG - Intergenic
1129143737 15:73628258-73628280 ATCTTTGTTTGAGGAGCATCCGG - Intronic
1131366877 15:91849037-91849059 CTATTTGGTAGAAAGGCATATGG + Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1133689082 16:8195742-8195764 CTCTTTGTTTCAGAGGAGGAAGG + Intergenic
1133808416 16:9142977-9142999 CTCTTTTTCTGAGAGAGATATGG - Intergenic
1135946145 16:26866697-26866719 CTCTTTGTCAGAGGGGCAAATGG - Intergenic
1136414087 16:30092924-30092946 CTCTGTGTTTGTGAGAAATACGG - Intronic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1138201124 16:55089268-55089290 CATTTTGTTTGAGTGGCATATGG + Intergenic
1146011556 17:29198459-29198481 ATGTTTATTTGAGAGGCAGAAGG - Intergenic
1146583865 17:34065125-34065147 GTCTTTGTTTGATGGGCATTTGG - Intronic
1147440581 17:40444647-40444669 CTTGTTGTTTGAGAGGCAGTGGG + Intronic
1149303960 17:55330947-55330969 CTCTCTGGGTGAGAGGAATATGG + Intergenic
1151079308 17:71310476-71310498 CTCATTGTTTGATGGGCATTTGG - Intergenic
1152220970 17:79065802-79065824 CTCTTTGATTGATGGGCATTTGG - Intergenic
1152317683 17:79590379-79590401 CCCTTTGTTTAAAAGGCACATGG + Intergenic
1153175856 18:2372151-2372173 TTCTTTGATTGATAGGCATTTGG + Intergenic
1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG + Intergenic
1158671592 18:59479205-59479227 CTATTTGTTTGAAGGGCATGAGG - Intronic
1159710070 18:71747480-71747502 CTCTTTCTTTGGTAAGCATACGG + Intronic
1160088711 18:75805396-75805418 CTATTTGTTAGACAGGCATATGG - Intergenic
1160420102 18:78738162-78738184 CTCTGTGTTTAAAAGGCATCCGG - Intergenic
1162641802 19:12016340-12016362 CTCTATGTTTGTGAGGAATGCGG - Exonic
1165057052 19:33184159-33184181 CTCATTGATTCAGAGGCATGGGG + Intronic
1167332747 19:48866611-48866633 CTCTTTTTTTGATGGGCAGAGGG + Intronic
1168167102 19:54556348-54556370 TTGTTTGTTTGAGAGACAGAAGG + Intergenic
926410975 2:12602435-12602457 CTCTTTGTTTCAGAGTCATCTGG + Intergenic
926622286 2:15057815-15057837 CTCGTTGATTGACAGGCATTTGG + Intergenic
928979052 2:37119398-37119420 AGCTTTATTTGAGAGGCAGAGGG - Intronic
930517770 2:52430619-52430641 ATCTTTGTTTGCAAGGCGTATGG + Intergenic
931828827 2:66029319-66029341 CTCATTGATTGATAGGCATTTGG + Intergenic
931835166 2:66091523-66091545 CTCTTTGATTGATGGGCAGATGG - Intergenic
932820205 2:74893460-74893482 GTGTGTGTTTGAGAGGCATGTGG + Intergenic
934014967 2:87870719-87870741 ATATATGTTTGTGAGGCATATGG - Intergenic
934018262 2:87914089-87914111 CTCCTTGTATAAGAGGCATTCGG - Intergenic
936614612 2:114035678-114035700 CTCTTTGTTTGATGGGCATTTGG + Intergenic
940648450 2:156416202-156416224 CTCATTGGTTGACAGGCATTTGG + Intergenic
943131405 2:183857793-183857815 CTCATTGATTGATAGGCATTTGG - Intergenic
945480723 2:210342308-210342330 CTCATTGATTGATAGGCATTTGG + Intergenic
946036959 2:216751617-216751639 CTCATTGTTTGATGGGCATTTGG - Intergenic
947108119 2:226689300-226689322 CTCGTTGATTGATAGGCATTTGG - Intergenic
948001403 2:234570781-234570803 CTCTTGGTTTCAGAGGGAAATGG - Intergenic
948571263 2:238918874-238918896 CTCGTTGATTGACAGGCATTTGG - Intergenic
948940528 2:241193429-241193451 CTCTGTGTGTGTGAGGCTTAAGG + Intronic
1169279440 20:4254525-4254547 TTGTTTGTTTGAGAGAGATAGGG + Intergenic
1171848934 20:30294530-30294552 CTCCTTCTTTGTGAGGCAGAGGG + Intergenic
1173716880 20:45215715-45215737 CTCATTGATTGATAGGCATTTGG - Intergenic
1174680163 20:52398978-52399000 CTCGTTGTTTGATAGGCATTTGG - Intergenic
1176999924 21:15599614-15599636 TTCTTTGTATGATAGACATAGGG - Intergenic
1177195010 21:17894917-17894939 CTCGTTGATTGATAGGCATTTGG + Intergenic
1177741733 21:25162498-25162520 TTCTTTCTTTGAGATGCATTTGG - Intergenic
1179153767 21:38831971-38831993 ATGTATGTTTGAGTGGCATAAGG + Intergenic
1180251207 21:46590993-46591015 CTCGTTGTTTGATGGGCATTTGG - Intergenic
1185017261 22:48352050-48352072 CTCTTTGTTTGACACACAAAAGG + Intergenic
949558856 3:5184522-5184544 CTCTTTTTTAAAAAGGCATAGGG - Intergenic
950075572 3:10184512-10184534 CTCTTTGGTTGAGAGGCCCTGGG - Intronic
952178206 3:30890097-30890119 CTCTTTGTTTGATATGTAAATGG + Intronic
952446820 3:33389257-33389279 CTCAATATTTGAGAGGCTTAAGG + Exonic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
956047861 3:65215485-65215507 CTCGTTGATTCAGAGGCATGAGG - Intergenic
957516658 3:81263107-81263129 CTATTTCTTTGAGAGACAAATGG - Intergenic
957697030 3:83652288-83652310 CTCTTTGTTTTAAATGCATATGG + Intergenic
959101734 3:102017687-102017709 CTCTGTTTTTGAGAAGCTTAGGG + Intergenic
959567894 3:107851455-107851477 CTCTTTGATTGATGGGCATTTGG - Intergenic
960524904 3:118698639-118698661 CTCATTGATTGATAGGCATTTGG - Intergenic
962999839 3:140669466-140669488 CTCATTGATTGATAGGCATTTGG - Intergenic
971575969 4:28275159-28275181 CTCTTTGATTGATGGGCATTTGG - Intergenic
971882074 4:32389640-32389662 CTCTTTCTTGGGGAGGCAGAGGG + Intergenic
973113256 4:46422021-46422043 CTCTTTGATTGATGGGCATTTGG + Intronic
976455479 4:85241971-85241993 CTTTTTGTTTAATGGGCATAGGG - Intergenic
976791706 4:88886265-88886287 CTCGTTGATTGATAGGCATTTGG - Intronic
978323898 4:107528928-107528950 CTCTTTGTTGGAAAGTCAAAAGG - Intergenic
979184736 4:117773504-117773526 CTGTTTGTTTGAGGGAAATAAGG + Intergenic
979648060 4:123094933-123094955 CTGGTTGTTTGAGAGGGAGATGG - Intronic
980580561 4:134744758-134744780 CTCATTGATTGATGGGCATATGG - Intergenic
982189288 4:152837171-152837193 CTCATTGATTGATAGGCATTTGG + Intronic
982451517 4:155558022-155558044 CTCTTTGATTGATGGGCATTTGG - Intergenic
982594341 4:157359952-157359974 CTCTGTGTTTGTGAGGACTACGG + Exonic
983763079 4:171438896-171438918 TTCGTTGTTTAAGAGTCATATGG - Intergenic
986018269 5:3776868-3776890 CTCATTGATTGAGGGGCATTTGG + Intergenic
988310453 5:29549695-29549717 CTTGTTGTTTGATAGGCATCTGG - Intergenic
988474685 5:31573382-31573404 TTATTTGTTTGAGAGACACATGG - Intergenic
988636041 5:32986100-32986122 CTCGTTGATTGATAGGCATTTGG - Intergenic
991001306 5:61786043-61786065 CTCTTTGATTGATGGGCATTTGG - Intergenic
991912343 5:71574387-71574409 CTCATTGTTTGAGAGGCCCAGGG - Intergenic
996593144 5:125171045-125171067 TTGTTTATTTGAGAGGCAGAAGG - Intergenic
996783324 5:127212475-127212497 CCCTATGTTAGAGAGGCAAAAGG - Intergenic
997848576 5:137310651-137310673 CACTTTGTTTGAGTGGAACAGGG - Intronic
999819261 5:155208953-155208975 CTCATTGATTGATAGGCATTTGG - Intergenic
1000468951 5:161615045-161615067 CTCTATGTTTGAGAAACATTTGG + Intronic
1001178597 5:169496824-169496846 CACTTTGTTTGGGTGGCATAAGG + Intergenic
1002623391 5:180507024-180507046 TTCTGTGTTTGGGAGGGATATGG + Intronic
1003074703 6:2972819-2972841 CTCTTTGATTGATGGGCATTTGG - Intergenic
1003269529 6:4595066-4595088 CTCTTTGATTGATGGGCATTTGG + Intergenic
1005191121 6:23225817-23225839 CTCTTTGATTGATGGGCATTTGG + Intergenic
1007893180 6:45315877-45315899 CTCATTGATTGATAGGCATTTGG - Intronic
1009461191 6:63915431-63915453 AGCTTTGTTGGAGAGGCACAAGG + Intronic
1009715172 6:67383241-67383263 CTCTTTGTTTGCAAGAAATAAGG + Intergenic
1010479426 6:76332708-76332730 CTCATTGATTGACAGGCATTTGG + Intergenic
1011334278 6:86242743-86242765 CTCTATCTTTGATAGGCATTTGG - Intergenic
1011410025 6:87058319-87058341 CTCTTTGTTAGAGAAGTTTAGGG - Intergenic
1011878713 6:91995861-91995883 CTCATTGATTGATAGGCATTTGG - Intergenic
1012200542 6:96400827-96400849 CTTTTTGTTTGAGAAGAAAAGGG + Intergenic
1012225243 6:96695844-96695866 CTCATTGATTGATAGGCATTTGG - Intergenic
1014182520 6:118400814-118400836 TGCTTTGTGTGAAAGGCATATGG + Intergenic
1015527449 6:134187214-134187236 CTTTTTGATTCAGAGGCATGAGG + Intronic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016197018 6:141356630-141356652 CTCTTTGATTGATAGACATTTGG + Intergenic
1017368919 6:153681399-153681421 CTTTATGTTTGTGATGCATATGG - Intergenic
1018656044 6:166037080-166037102 CTCTTTGATTGATGGGCATATGG + Intergenic
1018748529 6:166781462-166781484 CTCTTTGGGTGAGAGGCACCTGG + Intronic
1020915427 7:14186617-14186639 CTCTTTGATTGATGGGCATTTGG - Intronic
1024333758 7:48182649-48182671 CTCTTTTTTTGTGAGGAGTAGGG - Intronic
1024391869 7:48822958-48822980 CCCTCTGTTTGATAGGTATATGG - Intergenic
1024665115 7:51538414-51538436 CTTTTTGTTTGATGGGCATTTGG + Intergenic
1026577206 7:71582251-71582273 CTCTTTGATTGATGGGCATTTGG - Intronic
1028214557 7:88115470-88115492 CTCTTTGCTTGAGTTGCAGATGG + Intronic
1029229246 7:99052603-99052625 CTTTCTGTTTGAGTGGCACATGG - Intronic
1029287327 7:99474766-99474788 CTCTTTGCTTAAAAGGCAGAGGG + Intronic
1030804055 7:113891817-113891839 CTCGTTTTTTAAGAGACATATGG - Intronic
1032184737 7:129714737-129714759 CTCTTTCTCTGAGAGGCTTTTGG + Intronic
1032254692 7:130287633-130287655 TTCTTTCTCAGAGAGGCATAGGG + Intronic
1032634065 7:133686957-133686979 CTCATTGATTGATAGGCATTTGG - Intronic
1032920367 7:136538858-136538880 CTCGTTGATTGATAGGCATTTGG - Intergenic
1033623356 7:143083121-143083143 CTCATTGATTGATAGGCATTTGG - Intergenic
1035922824 8:3696191-3696213 CTGTCTGTTTGAAGGGCATATGG - Intronic
1036746175 8:11411721-11411743 CCGTTTGTTTAAGAGGCAGAAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038454228 8:27661997-27662019 CTTGTTGATTCAGAGGCATAAGG + Intronic
1039000770 8:32977690-32977712 CTCTTTGATTGATGGGCATTTGG + Intergenic
1040034270 8:42853450-42853472 CTCAGTGTTTGAGAGGTACAAGG - Exonic
1040525714 8:48222851-48222873 CTCGTTGGTTGACAGGCATTTGG + Intergenic
1041832460 8:62170287-62170309 CTCTTTGATTGATAGGCATTTGG - Intergenic
1042769901 8:72368211-72368233 CTCGTTGATTGACAGGCATTTGG - Intergenic
1042994395 8:74679490-74679512 CTCATTGGTTGATAGGCATTTGG + Intronic
1044809355 8:96041789-96041811 GTTTTTGTTTGAGAGGCACTGGG + Intergenic
1045605422 8:103768355-103768377 CACTTTTTATGAGAAGCATATGG + Intronic
1046923460 8:119760720-119760742 CTAGTTGTTTGAGAGCCATACGG - Exonic
1047393001 8:124469590-124469612 CTCATTGATTGATAGGCATTTGG + Intergenic
1048053826 8:130845579-130845601 TTCTTGGTTTGAGGGGCTTAGGG - Intronic
1051927479 9:22346510-22346532 CACTTTATTTGAGATACATATGG + Intergenic
1052708576 9:32023520-32023542 CTCGTTGATTGATAGGCATTTGG + Intergenic
1052894749 9:33736473-33736495 CTCATTGATTGATGGGCATATGG - Intergenic
1053280425 9:36816854-36816876 CTCTTTCTTTCAGAGGCCCAGGG - Intergenic
1053786645 9:41657250-41657272 CTCCTTCTTTGTGAGGCAGAGGG + Intergenic
1054158415 9:61656945-61656967 CTCCTTCTTTGTGAGGCAGAGGG - Intergenic
1054450334 9:65400471-65400493 CTCCTTCTTTGTGAGGCAGAGGG + Intergenic
1054478188 9:65587950-65587972 CTCCTTCTTTGTGAGGCAGAGGG - Intergenic
1054958634 9:70942238-70942260 CTGTTTGTTTGAGAGTCCTAAGG - Intronic
1056316347 9:85394380-85394402 CCCTTATTTTGAGAAGCATACGG + Intergenic
1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG + Intronic
1058348594 9:103994531-103994553 CTCGTTGTTTGATGGGCATCTGG - Intergenic
1058367237 9:104223069-104223091 CTCATTGTTGGTGAGGCTTATGG + Intergenic
1060096133 9:120792340-120792362 CTCTTTGTTTGATAAGAAAAGGG - Intronic
1062427453 9:136512527-136512549 CTCTTTGTGTGAGCGGAACAAGG - Intronic
1186277906 X:7959834-7959856 CTATTGGTTTTACAGGCATAGGG - Intergenic
1187744606 X:22394890-22394912 CTCATTGATTGATAGGCATTTGG - Intergenic
1192046563 X:67681387-67681409 CTCTTTGTCTAGGAAGCATATGG - Intronic
1192967822 X:76198021-76198043 CTCGTTGATTGATAGGCATCTGG + Intergenic
1193181679 X:78465855-78465877 CTCATTGATTGAAGGGCATATGG + Intergenic
1193220996 X:78926481-78926503 CTCGTTGATTGATAGGCATTTGG - Intergenic
1193325385 X:80173780-80173802 CTCATTGATTGATAGGCATTTGG + Intergenic
1193779456 X:85684528-85684550 CTCATTGATTGATGGGCATATGG + Intergenic
1193861664 X:86675075-86675097 ATCTTTGGTTGGGAGGCAGAGGG - Intronic
1194072005 X:89337580-89337602 CTCTTTCTGTTAGAAGCATAAGG - Intergenic
1194108534 X:89802078-89802100 GTCTTTATTTGAGATGGATATGG - Intergenic
1194353442 X:92851557-92851579 CTCATTGATTGACAGGCATTTGG + Intergenic
1194393955 X:93356733-93356755 CTCATTGATTGATAGGCATTTGG + Intergenic
1194471028 X:94297064-94297086 CTCATTGATTGACAGGCATTTGG + Intergenic
1194606167 X:95981204-95981226 CTCATTGATTGATAGGCATTTGG + Intergenic
1194747739 X:97647405-97647427 CTCTTTGTTTTATAGAGATAGGG + Intergenic
1194791360 X:98154880-98154902 CTCATTGATTGATAGGCATTTGG + Intergenic
1195825736 X:108998488-108998510 CTCATTGATTGATAGGCATTTGG + Intergenic
1196227271 X:113180674-113180696 CTCTTAGGTTGATACGCATATGG - Intergenic
1197671035 X:129277845-129277867 CTCTTTGATTGATGGGCATTTGG + Intergenic
1197843806 X:130779077-130779099 CTCCTGGTTTGAGAGCCATCTGG - Intronic
1198257126 X:134933568-134933590 CTGTTTGTTTGAGAGACTGATGG + Intergenic
1198982918 X:142419691-142419713 CTCATTGTGTGAGAGACATTGGG - Intergenic
1199126267 X:144124917-144124939 CTCCTTGTATAAGAGGCATTCGG + Intergenic
1199129512 X:144167792-144167814 ATATATGTTTGTGAGGCATATGG + Intergenic
1199555409 X:149102580-149102602 CTGCTTCTTTGAAAGGCATATGG + Intergenic
1199859436 X:151788118-151788140 TTCTTTGTTTGAATGGCATGTGG - Intergenic
1200461192 Y:3456809-3456831 GTCTTTATTTGAGATGGATATGG - Intergenic
1200661800 Y:5968631-5968653 CTCATTGATTGACAGGCATTTGG + Intergenic
1200726248 Y:6673317-6673339 CTCTTTCTGTTAGAAGCATAAGG - Intergenic
1201685068 Y:16692409-16692431 CTCTTTGTTTCAGGGACCTAGGG + Intergenic