ID: 1103070052

View in Genome Browser
Species Human (GRCh38)
Location 12:117933868-117933890
Sequence GTGGATGGAGAACTGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 415}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103070052_1103070061 17 Left 1103070052 12:117933868-117933890 CCGTGCTCCAGTTCTCCATCCAC 0: 1
1: 0
2: 1
3: 37
4: 415
Right 1103070061 12:117933908-117933930 ATACATGGCGCCTCTTAAATGGG 0: 1
1: 0
2: 1
3: 8
4: 41
1103070052_1103070062 20 Left 1103070052 12:117933868-117933890 CCGTGCTCCAGTTCTCCATCCAC 0: 1
1: 0
2: 1
3: 37
4: 415
Right 1103070062 12:117933911-117933933 CATGGCGCCTCTTAAATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1103070052_1103070056 2 Left 1103070052 12:117933868-117933890 CCGTGCTCCAGTTCTCCATCCAC 0: 1
1: 0
2: 1
3: 37
4: 415
Right 1103070056 12:117933893-117933915 ACCATCCCAAAAAAGATACATGG 0: 1
1: 0
2: 0
3: 16
4: 274
1103070052_1103070063 21 Left 1103070052 12:117933868-117933890 CCGTGCTCCAGTTCTCCATCCAC 0: 1
1: 0
2: 1
3: 37
4: 415
Right 1103070063 12:117933912-117933934 ATGGCGCCTCTTAAATGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1103070052_1103070060 16 Left 1103070052 12:117933868-117933890 CCGTGCTCCAGTTCTCCATCCAC 0: 1
1: 0
2: 1
3: 37
4: 415
Right 1103070060 12:117933907-117933929 GATACATGGCGCCTCTTAAATGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103070052 Original CRISPR GTGGATGGAGAACTGGAGCA CGG (reversed) Intronic
900161944 1:1228045-1228067 GTGGCTGGAGAGCTGGTACAGGG - Intronic
900212054 1:1460971-1460993 GTGTCCGGAGAACAGGAGCAGGG - Intronic
900596209 1:3481290-3481312 CCGGCTGGAGCACTGGAGCAGGG + Intergenic
901359926 1:8688649-8688671 GTGGGAGGATAACTTGAGCATGG + Intronic
901407768 1:9061186-9061208 GTGGAAGGATCACTTGAGCACGG + Intronic
901749560 1:11397488-11397510 GAGGAGGGGGCACTGGAGCAGGG - Intergenic
902261431 1:15227655-15227677 ATGGATGGAGAAAAGGAGAAAGG - Intergenic
903274062 1:22209621-22209643 GTGGTTGGAGTAAGGGAGCAGGG + Intergenic
904282714 1:29432627-29432649 GTGGAGGTAGACATGGAGCAAGG + Intergenic
904298278 1:29538049-29538071 GGGGATGGAGAACAGGAGAGAGG + Intergenic
904373609 1:30066171-30066193 GTGGAGGGAGGGCTGGAGGAGGG - Intergenic
904373620 1:30066199-30066221 GTGGAGGGAGGGCTGGGGCAGGG - Intergenic
904641363 1:31933093-31933115 GTGGAAGGATCACTGGAGCCTGG - Intronic
904933644 1:34110743-34110765 GAGGGTGGAGAACGGGAGGAGGG + Intronic
905622709 1:39462619-39462641 GTGGAAGGATCACTTGAGCATGG + Intronic
905864789 1:41370850-41370872 GTGGATGTAGCCCTGGATCACGG - Intronic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906368152 1:45228497-45228519 GTGGGAGGTGAACTGGATCATGG + Intronic
906491922 1:46275121-46275143 GAGGATAGAGGACTGCAGCAAGG - Intronic
906529221 1:46513612-46513634 CTGGATGGAGAGCAGCAGCAGGG + Exonic
907365703 1:53957719-53957741 GTGATTTGAAAACTGGAGCAAGG - Intronic
907930158 1:58991551-58991573 GTGGAGGGAGAAGTTGAGCTGGG + Intergenic
910936010 1:92485056-92485078 GGGGCTGGGGATCTGGAGCAGGG - Intronic
911466694 1:98263572-98263594 GTGAATGGAGAAATGAAGAAAGG + Intergenic
911523954 1:98961938-98961960 GTGGATGGAGACCTGCATCTGGG - Intronic
911854401 1:102858780-102858802 GTGGCTGGTGAGGTGGAGCAGGG - Intergenic
911941781 1:104056902-104056924 ATGGAAGAAGAACAGGAGCAGGG + Intergenic
914194929 1:145442245-145442267 GTGAATGGAAAACTCTAGCAAGG + Intergenic
914476203 1:148024812-148024834 GTGAATGGAAAACTCAAGCAAGG + Intergenic
915249624 1:154578853-154578875 CTGGATGGAAACCTGGAGCAAGG + Exonic
916004464 1:160646784-160646806 GTGGATGGAGAGAAGGTGCAGGG - Intronic
916264591 1:162877829-162877851 GAGGATGGAGAACTGCAGAGAGG + Intergenic
916575786 1:166065153-166065175 GTGGCTGGACAAGTGGAGGAGGG + Intronic
917453713 1:175168010-175168032 GTGGTTTGAGAGCTGGGGCAAGG - Intronic
917860914 1:179143017-179143039 GTGGAAGGAGAACTGTCCCAAGG + Intronic
921022807 1:211251875-211251897 GTGGATTGAGAAGTGGAGGAAGG - Intergenic
921386193 1:214572373-214572395 GGTGATGGAGAACTGGGGAAGGG + Intergenic
921486692 1:215723354-215723376 GTGGATGGAGAACTGGCAGTGGG - Intronic
922406299 1:225316650-225316672 ATGGAGGGAGAACTGAAGCAGGG - Intronic
923909983 1:238430882-238430904 GTAGATGGAGAGCCGGAGCATGG + Intergenic
924813151 1:247420908-247420930 CTGGATGGAGAATTGGAGGCAGG - Intronic
924870831 1:248042793-248042815 GAGGATGAGGATCTGGAGCAAGG - Intronic
1062829719 10:597474-597496 GTGAATGGAGACCTGGTGAATGG + Intronic
1062928762 10:1338727-1338749 GTGGATAGAGAGGTGGAGGAAGG + Intronic
1063626947 10:7699103-7699125 GTGGCTAGAGAAGTGGAGTAGGG - Intergenic
1063905904 10:10779928-10779950 GTGGATGGATCACTGCAGAAAGG + Intergenic
1064276957 10:13915279-13915301 GGGGCTAGCGAACTGGAGCACGG + Intronic
1065708533 10:28493508-28493530 GTGGATGGATCACTTGAGCTCGG + Intergenic
1065951638 10:30657775-30657797 GTGGATGGAGAAAGGGAGGGAGG - Intergenic
1066051092 10:31636299-31636321 GTTGAAGGATAACTGGTGCAAGG + Intergenic
1067108872 10:43384545-43384567 GTGGGAGGATAACTTGAGCACGG + Intergenic
1067432931 10:46255847-46255869 GTGGGTAGAGAGCTGGAGCCAGG - Intergenic
1067440328 10:46305590-46305612 GTGGGTAGAGAGCTGGAGCCAGG + Intronic
1067474559 10:46557032-46557054 GCGGAGGGGGAACTGGAGCGAGG - Intergenic
1067493168 10:46733697-46733719 GAGGGTGGAGAATTGGAGGAGGG - Intergenic
1067601492 10:47606709-47606731 GAGGGTGGAGAATTGGAGGAGGG + Intergenic
1068429100 10:56909330-56909352 GAGGATGGGAGACTGGAGCAGGG - Intergenic
1068455869 10:57253011-57253033 GTGGAGGGAGAGTGGGAGCATGG - Intergenic
1068654086 10:59556487-59556509 GTGGAAGGTGAAGGGGAGCAGGG - Intergenic
1070333220 10:75432335-75432357 GTGGAAAGAGAACTGGAGGTCGG - Intronic
1070640567 10:78165972-78165994 GTGGATGTAGAACTCAAGCCTGG + Intergenic
1070799261 10:79235496-79235518 GAGGATGGAGAATTGCAGAAGGG - Intronic
1071216159 10:83404458-83404480 GTGGAGGGAAAACTGGATCTTGG - Intergenic
1071463213 10:85918010-85918032 GTGGAGGGAGAAGTGGAGACAGG + Intronic
1071653017 10:87414287-87414309 GAGGGTGGAGAACTGGAGGAGGG + Intergenic
1073013503 10:100380127-100380149 GTGGAAGGAGCACTTGAGCCTGG + Intergenic
1073491960 10:103858518-103858540 GTGAATGGAGAACTGGAACCAGG - Intergenic
1074514863 10:114157275-114157297 GTGGGTGGATCACTGGAGCCGGG - Intronic
1075415282 10:122258188-122258210 GTGGATGGAGACGTGGAGGTTGG + Intergenic
1076389705 10:130090256-130090278 ATGGAGGGACAACTGAAGCAGGG + Intergenic
1076676068 10:132148464-132148486 GTGGATGGAGGACGGGCGGATGG - Intronic
1076791967 10:132781645-132781667 GTGAATGTGGAACTGGAGCCAGG - Intronic
1078005406 11:7528885-7528907 CTGGATGGAGAACTGGGCCCTGG - Intronic
1078240445 11:9526258-9526280 GTGGAAGGATCACTTGAGCAAGG + Intronic
1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG + Intronic
1078406142 11:11071527-11071549 GTTGATGCAGAACTGGTGCTGGG + Intergenic
1079132534 11:17755896-17755918 GTAGATGAAGAAGAGGAGCAAGG + Intronic
1081120255 11:39257049-39257071 GTGGGATGGGAACTGGAGCAAGG - Intergenic
1082748680 11:56995497-56995519 ATGGATGGAGAACTGGAAGGGGG + Intergenic
1083254840 11:61489704-61489726 GTCGATGGAGAAGGGCAGCAGGG + Intronic
1083545694 11:63547424-63547446 GTGGAGGTAGCCCTGGAGCAAGG - Intergenic
1083826368 11:65206341-65206363 GGGGCTGGAGAGCTGGGGCATGG - Intronic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1085531908 11:77196961-77196983 GTCAAGGGAGAACTGGAGCCTGG - Intronic
1087021711 11:93609904-93609926 GTGAAAGGAGATCTGGAACAAGG + Intergenic
1087619439 11:100525419-100525441 CTGGCTGGAGAACTTGCGCAAGG - Intergenic
1088670395 11:112134808-112134830 GTGTATGGAGAAGTGTAGGAAGG + Intronic
1090246616 11:125220689-125220711 ATGGATGGAGAAATAGAACAAGG - Intronic
1090540724 11:127700312-127700334 CTGGATGGGGAACTGGAGGCAGG + Intergenic
1091400024 12:175909-175931 GTGGAAGCAGAACTGGAGACGGG + Exonic
1091402409 12:189015-189037 GAGGATGGCGAATTGGTGCAGGG + Intergenic
1091749214 12:3012159-3012181 GTGGCTGGAGACCTGTGGCAGGG - Exonic
1092207806 12:6626625-6626647 GTGAATGGAGCAAAGGAGCATGG - Intronic
1092269396 12:7011126-7011148 GTGGAAGGATCACTGGAGCCCGG - Intronic
1093214624 12:16348391-16348413 GTGGAAGGAGAAAAGGAGAAGGG + Intronic
1093719522 12:22422992-22423014 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1093720019 12:22429632-22429654 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1094535091 12:31314106-31314128 GTGGAAGGACAACAAGAGCAGGG + Intronic
1095882809 12:47156490-47156512 GTGGATGGAGCAAGGGTGCAAGG - Intronic
1096186037 12:49581153-49581175 GGATATGTAGAACTGGAGCATGG + Intronic
1096863946 12:54550044-54550066 GAGGGGGGATAACTGGAGCAGGG + Intronic
1097710286 12:62910181-62910203 GTGGATGGAGCACAGGAGAGAGG + Intronic
1097812292 12:64032190-64032212 GTGGGAGAAGCACTGGAGCATGG - Intronic
1097919592 12:65057146-65057168 GTGGGTGGAAAACAGGAGTATGG + Intronic
1097920151 12:65063328-65063350 GAGGATGGAGAAATGGAGAGGGG + Intronic
1098984642 12:76998491-76998513 GAGGATGGGGAAGTGGAGTAAGG + Intergenic
1099135880 12:78900617-78900639 GAGCATGGAGAACTGGAGGAAGG + Intronic
1099236186 12:80084565-80084587 ATGGAGGGCGAACTGAAGCAGGG - Intergenic
1101091603 12:101292449-101292471 GTTGTTGGAGAAATGGAGCCTGG + Intronic
1101116563 12:101537669-101537691 TTGGTTGGATAACTGGAGAAGGG - Intergenic
1102338779 12:112105223-112105245 GTGGATGGATGACTTGAGCCTGG + Intronic
1102935551 12:116893586-116893608 TAGGATGGAGCAATGGAGCAGGG + Intergenic
1103039450 12:117682861-117682883 GAGGATGGAGGATTGGAGCAGGG + Intronic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1103238512 12:119394942-119394964 GTGGAGGGAGAATTGAAGAAGGG + Intronic
1103762082 12:123257944-123257966 TTTTATGGAGAACTGGAGAATGG + Exonic
1103959095 12:124596641-124596663 GTGGGTGGATTACTTGAGCATGG + Intergenic
1104033125 12:125079365-125079387 GGGGACGCAGAGCTGGAGCACGG - Intronic
1104034744 12:125090501-125090523 GTGGATGGAGAGATGGAAGATGG - Intronic
1104366066 12:128178653-128178675 GTGGGAGGATCACTGGAGCATGG + Intergenic
1104706970 12:130954850-130954872 GTGGATGGAGAAGTGGTTCTGGG + Intronic
1104879346 12:132059343-132059365 TTGGATTGAGTAGTGGAGCATGG + Intronic
1104926017 12:132314173-132314195 GTGGATGGATAAATGGATGATGG - Intronic
1105068683 12:133220702-133220724 AGGGATGGAGGACTGGGGCAGGG - Intronic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1106343978 13:28858450-28858472 GTGGATGAAGAATGGGAGGAAGG - Intronic
1107833282 13:44393281-44393303 GTGGATGGAGATGTGGAGTCAGG + Intronic
1108265934 13:48708654-48708676 TGGGAAGGAGAACTGCAGCAAGG - Exonic
1111852929 13:93599843-93599865 GAGGAAGGAGAAATGGAGGATGG + Intronic
1112378975 13:98870582-98870604 GTAGATGGAGAACTCTATCATGG + Intronic
1113574781 13:111387488-111387510 GTGGATGGAAAACTGGGTGAGGG - Intergenic
1114102998 14:19394821-19394843 GTGGCTGGAGAACCGGTGCCTGG - Intergenic
1117684334 14:58238027-58238049 GTGGATAGAGAAGGGGACCAAGG + Intronic
1118045188 14:61962116-61962138 GAGGATGGAGAATGGGAGGAGGG + Intergenic
1118335729 14:64852234-64852256 GGTGATGGAGAAGTGGAGCCAGG + Intronic
1118640182 14:67785077-67785099 TTTGAAGGAGAACTGCAGCAAGG + Exonic
1119742912 14:77026067-77026089 GTGGATGGCGAACCAGAGCGAGG - Exonic
1119894478 14:78208311-78208333 GAGGATAGAGAACTTGAGCTTGG - Intergenic
1120361619 14:83511443-83511465 GTTAATGGAGAACTCAAGCATGG - Intergenic
1120738965 14:88086695-88086717 GAGGATGGAGAATGGGAGGAGGG - Intergenic
1122320713 14:100853958-100853980 GTGGATGGAAGAATGGAGGAAGG + Intergenic
1122387779 14:101360831-101360853 ATGGAGGGGGAACTTGAGCAAGG - Intergenic
1124897756 15:33792854-33792876 GGTGTTGGAGAACTGGAGAATGG - Intronic
1125219821 15:37320103-37320125 ATGGAGGGAGAGCTGAAGCAGGG + Intergenic
1125766047 15:42137272-42137294 GTGAAAGGAGACCTGGGGCATGG + Intergenic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1129087540 15:73111712-73111734 GTGGGAGGATCACTGGAGCACGG - Intronic
1129379891 15:75158264-75158286 GGGGATGGGGAAGTGGAGCCTGG + Intergenic
1130330524 15:82918659-82918681 GTGCAGGGAGAACAGCAGCAGGG - Intronic
1130542825 15:84834174-84834196 GTGGAAAGAGTACTGGAGAAAGG + Intronic
1130703714 15:86211815-86211837 ATGGAGGGTGAACTGAAGCAGGG - Intronic
1131439900 15:92451852-92451874 ATGGATGGTGATCAGGAGCAGGG - Intronic
1131855978 15:96594882-96594904 GTGGCTGGAGTACTGGAAGATGG - Intergenic
1131923979 15:97361854-97361876 GTGGATGGAGAAAGGAACCAGGG - Intergenic
1132424099 15:101699400-101699422 GTGGCTGATGAACAGGAGCAGGG - Intronic
1132549858 16:549919-549941 GTGGAAGCAGAACTGGGTCAGGG - Intronic
1133559854 16:6941062-6941084 GTGGAGGGAGAAATGGAGGTGGG + Intronic
1133782560 16:8951334-8951356 GTGGAAGGAAAACTGGGTCAGGG - Intronic
1135072049 16:19360718-19360740 GTGGAAGGATAACTTGAGCATGG - Intergenic
1135223696 16:20637260-20637282 GAGGAAGGATGACTGGAGCAGGG + Intronic
1136030004 16:27495877-27495899 CTGGAAGGGGAAGTGGAGCAAGG + Intronic
1136130830 16:28220002-28220024 GTGGAAGGATCACTGGAGCCTGG - Intergenic
1137374933 16:47944311-47944333 GTGGAGGGTGAACTGCAGCGGGG + Intergenic
1137438268 16:48476185-48476207 GAGGATGTAGAACGGGAGGAGGG + Intergenic
1138124377 16:54426773-54426795 GTGGAGAGAGAAGTGGGGCAGGG + Intergenic
1138938417 16:61759452-61759474 GGGGATGGAGAAGGGGAGGATGG + Intronic
1139379227 16:66520064-66520086 GTGGACGGAGAACAGCAGCGGGG + Intronic
1140462280 16:75149058-75149080 GTGGAGGAAGGACTGGAGCCTGG + Intronic
1141126547 16:81404624-81404646 GTGGATGGTGGAAGGGAGCAGGG - Intergenic
1141327879 16:83079397-83079419 CTGGATGTGGAACTGAAGCAAGG + Intronic
1141509153 16:84501446-84501468 GTGGTCGGAGAACAGCAGCAGGG + Intronic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142255615 16:89012387-89012409 GTGGATGGAGAATGGGTGGACGG - Intergenic
1142711538 17:1726402-1726424 GCGGATGCAGAACTGGACCCCGG + Exonic
1143813825 17:9494520-9494542 GTGGATGGATCACTTGAGCATGG + Intronic
1144170808 17:12658074-12658096 GTGGAAGATGGACTGGAGCAGGG + Intergenic
1145290932 17:21545260-21545282 GTGGAAGGGGAAGTGGAGCAAGG - Intronic
1146508711 17:33427545-33427567 GAGGATGGAGAGTTGGAGGATGG - Intronic
1147614959 17:41822212-41822234 GAAGGTGGAGAACTGGGGCAGGG - Exonic
1148467854 17:47875466-47875488 GAAGATGGAGACCTGGAGGAGGG - Intergenic
1148674113 17:49435131-49435153 GTGGATGAAGAACCGGAACTGGG + Intronic
1149991562 17:61386437-61386459 GTGGGTGGAGAAATGCAGCCAGG + Intronic
1151050979 17:70978487-70978509 GTGGAGGGAGGAAGGGAGCAAGG + Intergenic
1151109520 17:71659077-71659099 GTGGATGTAAAACTGGGGCTGGG + Intergenic
1151607371 17:75147068-75147090 GTGGGGAGAGAACTGGAGAAGGG - Intronic
1152167992 17:78723371-78723393 GTGCAGGGAGAGCCGGAGCAAGG + Intronic
1153003713 18:479256-479278 GTAGATGGGGAACAGGAGCACGG + Intronic
1153645647 18:7193857-7193879 GTGGATGGAGAAGCGCAGCTGGG - Intergenic
1155293405 18:24363864-24363886 GTGGAAGGATCACTTGAGCACGG - Intronic
1156259159 18:35428610-35428632 GAGGAGGGAGAACAGGAGCAAGG - Intergenic
1157229744 18:45904090-45904112 GTGGATGGAGTATTTGAACATGG - Exonic
1159224468 18:65514247-65514269 CTGGATTGAGAAGGGGAGCAGGG + Intergenic
1159583608 18:70262178-70262200 GTGGGTGGAGGACTGGAGAGTGG - Intergenic
1160366415 18:78329683-78329705 GTGGCTGGAGAACTGGAGGAAGG - Intergenic
1160820247 19:1054487-1054509 GTGGTTGTAGAGCAGGAGCAGGG + Intronic
1161153940 19:2722676-2722698 GTGGAAGGAGGGCTGGAGGAAGG - Intronic
1161210178 19:3061947-3061969 GTGGATCGGGAACTGGAGGGGGG + Intronic
1161329160 19:3678232-3678254 GAGGATGGAGGAATGGAGAATGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1162827840 19:13264649-13264671 GTGACTGGAGAAGTGGAGGAAGG - Intronic
1163233964 19:16020464-16020486 CTGGATGGAGACCTGGGGCGGGG + Intergenic
1163429097 19:17256335-17256357 GTGAAGGGAGAATTGGAGCTGGG - Intronic
1163487137 19:17594664-17594686 GGAGATGGAGGAGTGGAGCATGG - Intergenic
1163827849 19:19533559-19533581 GAGGAAGGAGAACAGGAGGAGGG - Intronic
1164618668 19:29681181-29681203 GAGGTGGGAGAGCTGGAGCAGGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164672021 19:30077667-30077689 GAGGCTGGAGAAGTGGGGCAAGG - Intergenic
1164678541 19:30119063-30119085 GTGGATGGAGATTTGGGACAAGG + Intergenic
1164803078 19:31093672-31093694 GTGGATGGAGAACTGGGGAGAGG - Intergenic
1165003801 19:32787912-32787934 GTGGAGGGTGAGCTGAAGCAGGG - Intronic
1165068405 19:33241717-33241739 GTGGGTGGAGACCTAGGGCAGGG + Intergenic
1165922482 19:39307694-39307716 GAGGATGGAGACCTGGGGCTGGG - Exonic
1165923187 19:39311273-39311295 GGGGTTGGAGAACTGGAACTGGG + Intronic
1166144128 19:40822590-40822612 GTGGATGGATCACTTGAGCCCGG + Intronic
1166254699 19:41594973-41594995 GTGGAGTGAGAACTGGACAAAGG + Intronic
1166476889 19:43134407-43134429 GGGGATGGAGAACTGGAATGGGG - Intronic
1166930983 19:46301150-46301172 TTGGATGGAGGGTTGGAGCAGGG - Intronic
1167486513 19:49766356-49766378 GTGGAGGGAGAAAGGGAACACGG + Intergenic
1167586177 19:50377040-50377062 GGGGATGGGGACCTGGAGCGAGG + Intronic
1167598196 19:50438278-50438300 GTGGATGGATAACGGGTGAATGG + Intronic
925015577 2:521967-521989 GTGGAAGGAGGTCTGGAGAAGGG + Intergenic
925178182 2:1799431-1799453 GTGGATGAAGTACTGGGGCTGGG - Intronic
925988594 2:9235591-9235613 GAGGAGGGAGAACTGGAGCTGGG + Intronic
926265381 2:11312977-11312999 GAGGATGATGAAGTGGAGCACGG + Intronic
926378387 2:12258692-12258714 GTGGGAGGAGCACTTGAGCATGG + Intergenic
926624580 2:15080568-15080590 ATGGATCAAGAACTTGAGCAAGG + Intergenic
926729483 2:16025462-16025484 GGGCATGGAGAAGTGGAGCATGG + Intergenic
927322397 2:21762574-21762596 ATGGATGGGGAGCTGGAACAGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929905616 2:46043636-46043658 GTGGAAGGGGAGATGGAGCAGGG + Intronic
931632096 2:64310899-64310921 GAGGAAGGAGAACTAGAGAAAGG - Intergenic
932283262 2:70512778-70512800 ATGGATGGAGACTTGGAGGAGGG + Intronic
932605924 2:73165570-73165592 GTGGAAGGAGGACTGGAACTAGG - Intergenic
933729928 2:85448834-85448856 GGGGAGAGAGAACTGGAGCGGGG - Intergenic
933926501 2:87094880-87094902 GTGGAAGGAGGACTGGAACTAGG + Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
935537494 2:104310980-104311002 GAAGATGGAGAACTGAAACAAGG + Intergenic
936450598 2:112631125-112631147 GTGGATGGACAGCTGTAGCCTGG - Intergenic
937017153 2:118616652-118616674 GGGGGTGTAGAGCTGGAGCAGGG + Intergenic
937139652 2:119588887-119588909 GTGGATAGAGAAGTGGACCGAGG + Intronic
938387853 2:130880438-130880460 GTGGAAGGAGACCTGGGACAGGG + Intronic
939002886 2:136756604-136756626 TTGGATACAGAATTGGAGCATGG + Intergenic
939536776 2:143441165-143441187 GTTGATGAAAGACTGGAGCAGGG + Intronic
940139952 2:150483040-150483062 ATGGATGGAGAAAGGGAGAAAGG + Intronic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943767386 2:191677888-191677910 GTGGGTGGAGAACGGGAGGGCGG + Intergenic
946506621 2:220308461-220308483 GTGGAAAGAGAATTGGATCATGG + Intergenic
947237803 2:227962287-227962309 GTGGATGAGGAATTTGAGCAAGG + Intergenic
947329024 2:229008886-229008908 CAAGATGGAGACCTGGAGCAGGG - Intronic
947468951 2:230382300-230382322 GAGGTGGGAGCACTGGAGCAGGG + Intronic
947497172 2:230646301-230646323 GTAGATAGGGAACTGGAGGATGG - Intergenic
947848078 2:233261690-233261712 GTAGATGGAGAAAAGGAACAAGG - Intronic
948671324 2:239570612-239570634 GTGGATGGAGAACCGTAGGGTGG - Intergenic
1168760412 20:346785-346807 GGGGATGGAGACCTGGAAAAGGG + Intronic
1168763796 20:368094-368116 GTGGATGGATCACTTGAGCCTGG - Intronic
1168794721 20:603898-603920 GTGGCTGGAGGACAGGGGCACGG + Exonic
1171108929 20:22462676-22462698 GTGGATGGGAAACCGGAGGAGGG - Intergenic
1171227117 20:23451190-23451212 ATGGATGAAGAAATGAAGCAAGG - Intronic
1172777496 20:37416010-37416032 GTGGAGGGAGGCCTGCAGCATGG + Intergenic
1172793886 20:37524094-37524116 CTGGATGGAGACCTGAAGTAAGG - Intronic
1172806733 20:37617366-37617388 GATGATGGAGATTTGGAGCAGGG + Intergenic
1172948036 20:38703615-38703637 GTGGAGTGAGGACAGGAGCAGGG - Intergenic
1174191448 20:48743434-48743456 GTGGAGGGAGAACTGGAAGCCGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175863361 20:62161778-62161800 GAGAGTGGACAACTGGAGCAGGG - Intronic
1176143992 20:63557457-63557479 GTGGAGGGAGGGGTGGAGCATGG - Intergenic
1176152161 20:63597252-63597274 GTGGAAGGATCACTGGAGCCTGG - Intronic
1177608145 21:23408607-23408629 GTAAATGGAGAACTGCAGCTTGG + Intergenic
1179582396 21:42352000-42352022 GAGGATGGAGCCCTGGAGAATGG - Intergenic
1179603056 21:42493842-42493864 GTGGAAGGATCACTGGAGCCTGG - Intronic
1179818996 21:43925540-43925562 GGGGAGGGAGAACGGGAGCTTGG + Intronic
1180478028 22:15729545-15729567 GTGGCTGGAGAACCGGTGCCTGG + Intergenic
1181002708 22:19995334-19995356 GTGGATGGAGGAGTGGATGAAGG + Intronic
1181528346 22:23502468-23502490 GGGGATGGAGAAATGGGGGATGG - Intergenic
1182022805 22:27095281-27095303 ATGGAGGGAGAACTTGAGCAGGG + Intergenic
1182144717 22:27990376-27990398 GTGGATGGCGAAGTGGAACCCGG + Intronic
1183264601 22:36817478-36817500 GTGGAGAGAGAAAGGGAGCAGGG - Intronic
1183602487 22:38848063-38848085 GTGTATGGAGAACTGGACCTTGG - Intergenic
1184087512 22:42274071-42274093 GAGGAAGGAGAGCTGGAGCTTGG - Intronic
1184131461 22:42519282-42519304 GTGGGTGGAGAACAGAAGCAGGG + Intronic
1184141687 22:42581498-42581520 GTGGGTGGAGAACAGAAGCAGGG + Intergenic
1184259874 22:43308645-43308667 GCGGAGGGAGAGCTGGAGCGCGG + Intronic
1184416577 22:44355381-44355403 GTGGGTGGAGAACTCGGGAAAGG - Intergenic
1184914585 22:47560761-47560783 GTGGATGAAAAACTGGAGCTTGG + Intergenic
1185054040 22:48568823-48568845 GTGGAAGGAGATCTAGAGAAGGG - Intronic
1185127271 22:49018118-49018140 GTGGAGGGAGGCCTGGGGCATGG - Intergenic
949439464 3:4065018-4065040 GAGGGTGGAGAACTGCACCATGG - Intronic
949509653 3:4757133-4757155 GTGCCTGGAGAACTGGAACTCGG - Intronic
949580064 3:5378781-5378803 GGGGATGGAGAACTAGGGGAAGG - Intergenic
950576702 3:13836535-13836557 GTGGATGGAGGACATGACCAGGG - Intronic
950937081 3:16850190-16850212 GGGGATGTGGAACTGGAGCCTGG - Intronic
951833827 3:26959663-26959685 ATGGAGGGAGAGCTGAAGCAGGG - Intergenic
951922480 3:27871663-27871685 GATGATGGAGAACTGGATCTGGG + Intergenic
952359515 3:32615631-32615653 GTGGATGGATCACTTGAGCCAGG + Intergenic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
953197374 3:40746977-40746999 GTGGAGGGAGCACTGGATCTAGG + Intergenic
953717739 3:45330354-45330376 TAGGAGGGAGAACTGGAGCAAGG - Intergenic
955140057 3:56260098-56260120 GTGGAATGAGAAGTGGGGCAGGG - Intronic
956112596 3:65884733-65884755 GGGGATGGAGAGATGGAGGAAGG - Intronic
957058705 3:75463902-75463924 GTGGATGGATCACTTGAGCCCGG - Intergenic
957198578 3:77102217-77102239 GAGCATGGAGAATTAGAGCAGGG + Intronic
958975960 3:100668082-100668104 ATGGAGGGAGAGCTGAAGCAGGG - Intronic
958978811 3:100697066-100697088 GTGGATGGGGAGCTGGAAAAGGG - Intergenic
959064987 3:101647137-101647159 GTGGGTGGATCACTTGAGCAAGG + Intergenic
960618590 3:119618487-119618509 GTCTATGAAGAACTGGAGAATGG - Intronic
960744364 3:120870294-120870316 GTGGATGGAGAGGTTGAGGAAGG - Intergenic
961648887 3:128407687-128407709 GAGGGTGGAGAAGTGGAGAATGG + Intronic
961819908 3:129570759-129570781 GTGGATGGGGCGCCGGAGCAGGG - Intronic
962487848 3:135862482-135862504 GAGGGTGGAGAACAGAAGCAGGG - Intergenic
965779571 3:172270393-172270415 GGGCACAGAGAACTGGAGCAGGG - Intronic
966358065 3:179103383-179103405 GTGGATGGAGAATTGGGGAGGGG + Intergenic
967384767 3:188900454-188900476 GTGGTTGCAGAGCAGGAGCAAGG + Intergenic
967408010 3:189138769-189138791 GTGTCTGGAGAACAGGAGGATGG + Intronic
967439077 3:189485948-189485970 GTGGGTGGAGAACTAGGGGAGGG + Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969510318 4:7614034-7614056 GTGGATGGATAAATGGATTATGG - Intronic
970389373 4:15592165-15592187 TTGGATGGAATAGTGGAGCATGG - Intronic
970457611 4:16240552-16240574 GGGAATGGAGAACAGTAGCAGGG - Intergenic
970725297 4:19036791-19036813 GTGGAAAGAGAAAGGGAGCAAGG - Intergenic
973967867 4:56182274-56182296 GTGGGAGGATCACTGGAGCAGGG + Intronic
974213180 4:58809485-58809507 GGAGATGGAGAAATGGGGCAAGG - Intergenic
975622560 4:76308576-76308598 GTGGAGGGAGAACTGGGGGAAGG - Intronic
976203721 4:82604513-82604535 GTGGGTTGAGAACTTGGGCAGGG - Intergenic
976496863 4:85739969-85739991 GTGGCTGGAGCATGGGAGCAAGG - Intronic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
979392257 4:120141147-120141169 ATGGATGGAGAGCTGGAAGAGGG - Intergenic
979551355 4:121994745-121994767 GAGGAGTGAGACCTGGAGCAGGG + Intergenic
982090312 4:151874958-151874980 GAGAAAGAAGAACTGGAGCAGGG + Intergenic
982116803 4:152104970-152104992 GTGGGTGGAGAAAGGGAGCTTGG - Intergenic
982426175 4:155264122-155264144 GAGGATGGAGAATGGGAGGAGGG - Intergenic
983161924 4:164427333-164427355 CTGGAATGGGAACTGGAGCAGGG - Intergenic
983323830 4:166227881-166227903 ATACATGGACAACTGGAGCAAGG - Intergenic
983969015 4:173848579-173848601 GTGAAAGGATCACTGGAGCATGG - Intergenic
984428310 4:179615941-179615963 TTGAAGGGAGAACTGGAGGATGG + Intergenic
984597750 4:181689967-181689989 GTGGATGGAGAGGTGATGCAGGG + Intergenic
986272295 5:6243897-6243919 CTGCATGGAGCACTGGAGGAAGG - Intergenic
987510917 5:18836979-18837001 GTGGGTGGATAACTGGAGTTCGG - Intergenic
988482831 5:31643910-31643932 GTGGAAGGATCACTGGAGCCGGG - Intronic
988893354 5:35644683-35644705 CAGGATGGAGAAAAGGAGCAGGG - Intronic
989604682 5:43232656-43232678 GTAAATGGAGAACTGCAGCTTGG + Intronic
990193802 5:53290447-53290469 ATGGATGGGGAGCTGGAACAGGG - Intergenic
993689118 5:90977258-90977280 GAGGGAGGAGAACTGGGGCAAGG + Intronic
994501533 5:100584830-100584852 GTAGATGGAGATCTGCAGCAGGG - Intronic
995132181 5:108642337-108642359 GAGAATGGAGAACTGGAGAAGGG - Intergenic
995242583 5:109901848-109901870 ATGGATGGAGACCAGGAGCAGGG + Intergenic
995637165 5:114206671-114206693 GTGGATGATGAACTGGAGTCAGG - Intergenic
997399555 5:133591767-133591789 GAGGAGGGAGAAATGGAGAAGGG + Intronic
997992694 5:138559197-138559219 GTGGGTGGATCACTTGAGCATGG - Intronic
998161502 5:139815186-139815208 GTGGAGGGAGAAGTGGAGGGAGG - Intronic
998855322 5:146389513-146389535 GTAGATGGAGAAGAGGTGCAGGG - Intergenic
999170816 5:149593309-149593331 GGGGATGGAGAATTGGAGTTTGG - Intronic
1000625941 5:163538600-163538622 GTGAATGGAGCAGTGGGGCAGGG - Intergenic
1000628953 5:163570141-163570163 GTAGAGGGAGAAGTGGAGTATGG + Intergenic
1001562144 5:172676829-172676851 GTGGATAGAGAACTTGGCCAAGG + Intronic
1001613593 5:173023749-173023771 GTGGGAGGAGAACTTGAGCCTGG + Intronic
1001919767 5:175590723-175590745 GTGGAGTGAGGAATGGAGCATGG + Intergenic
1002294318 5:178221723-178221745 GTGGAGAAAGAACTGGAGGAAGG - Intronic
1005882994 6:30074642-30074664 GAGGATGGAGGAAGGGAGCAAGG - Intronic
1006441152 6:34054484-34054506 GGGGAAGGAGGACTGGAGCAGGG - Intronic
1009760012 6:67993317-67993339 TTGTATGGAGAACTTGGGCAAGG - Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011209122 6:84936068-84936090 ATGGAGGGTGAACTGAAGCAGGG + Intergenic
1012000641 6:93650447-93650469 GTGGTGGGAGAACTTGAGAAAGG + Intergenic
1012157393 6:95836794-95836816 GTGACTGGAGGACTGGAGCCAGG + Intergenic
1012541608 6:100367920-100367942 GTGGATGGATCACTTGAGCCCGG + Intergenic
1014294024 6:119595825-119595847 GTTGATGGAGAGCAGTAGCAGGG - Intergenic
1015522754 6:134147791-134147813 GGGGTTGGAGGACTGGAGTAAGG + Intergenic
1017272043 6:152518476-152518498 GCGGAAGGAGAAGGGGAGCAGGG - Intronic
1017308500 6:152949394-152949416 GTAGATGGTGAATTGGAGAAGGG - Intergenic
1018139457 6:160814815-160814837 GAGGATGGAGGATTTGAGCAGGG + Intergenic
1018362680 6:163087568-163087590 GAGGATGGAGACCAGGACCAGGG + Intronic
1018549809 6:164982993-164983015 CTGGATGGAACACTGGAACAGGG - Intergenic
1018580251 6:165301977-165301999 GTGGATGGTGAAGTGGGCCAGGG + Exonic
1018618575 6:165709593-165709615 GTGGAGGGAGCACAGCAGCATGG - Intronic
1019035896 6:169058415-169058437 GTGGATGGAGAACTATGGCTCGG + Intergenic
1019574346 7:1729195-1729217 GTGGATGGGGAACGTGAGCTTGG + Intronic
1019925978 7:4191988-4192010 GTGGCTGGAGAGGAGGAGCAGGG - Intronic
1020511423 7:9061689-9061711 GTGGAAGGATAACTTGAGCCTGG - Intergenic
1020882444 7:13779008-13779030 TTGGATGGAGCACTGGAGCTGGG + Intergenic
1021724115 7:23533051-23533073 TAGGAGGGGGAACTGGAGCAGGG - Intergenic
1022315156 7:29238873-29238895 GTGGCTGGAGAAAATGAGCAAGG + Intronic
1022624963 7:32025806-32025828 GTGAACAGAGAAGTGGAGCAGGG - Intronic
1022642732 7:32203522-32203544 GTGGATGGGGGAGTGAAGCAAGG - Intronic
1024301935 7:47893490-47893512 GTGGATGGAGAAGAGGACCAAGG + Intronic
1024998605 7:55295211-55295233 ATGGAGGGTGAACTGAAGCAGGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026134427 7:67646940-67646962 GTGGATGGAATACTGGAACACGG - Intergenic
1026377061 7:69762398-69762420 GTGGAAGGATCACTGGAGCCAGG - Intronic
1026536641 7:71243993-71244015 TTGGATTGAGAACTGGGGAAAGG + Intronic
1026550426 7:71363774-71363796 GTGGACGGAAAACAGAAGCAAGG + Intronic
1026903437 7:74049455-74049477 GTGGATGGATGAATGGAGCGAGG - Intronic
1027143707 7:75679295-75679317 GTGGAAGGATCACTGGAGCCAGG - Intronic
1032219143 7:129980827-129980849 GTGAATGGAGGCCTGGATCACGG - Intergenic
1033285484 7:140037519-140037541 GTGGAGGAAGAACTGCATCAAGG - Intronic
1033411282 7:141119863-141119885 GTGTTTGGAGGCCTGGAGCAGGG + Intronic
1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG + Intronic
1034267096 7:149786322-149786344 GTGGAGGGAGACCAGGAGGAGGG - Intergenic
1034295946 7:149972578-149972600 ATGGGTGGAGAGCGGGAGCAGGG - Intergenic
1034810105 7:154124324-154124346 ATGGGTGGAGAGCGGGAGCAGGG + Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1037662874 8:20942175-20942197 ATGCATGGAGAAAAGGAGCAAGG + Intergenic
1037773701 8:21818733-21818755 ATGCATGGATAACTGTAGCAGGG + Intergenic
1038479138 8:27889525-27889547 GTAGATGGAGAACTGGCCCGAGG - Intronic
1038882011 8:31625248-31625270 GTGGAAGGAGAAATGGAAAATGG + Intergenic
1039434005 8:37547243-37547265 GTCGGTGGAGACCTGGAGCGTGG - Intergenic
1039573117 8:38602689-38602711 CTTTATAGAGAACTGGAGCAGGG + Intergenic
1039785292 8:40829387-40829409 GTGGACGCAGTACTAGAGCAGGG + Intronic
1040354928 8:46608291-46608313 ATGGAGGGAGAGCTGAAGCAGGG + Intergenic
1043521459 8:81050471-81050493 GTGGCTTGAGAACTGCAACATGG - Intronic
1045020593 8:98040347-98040369 GGGGAGGGAGAAAAGGAGCAAGG + Intronic
1045975186 8:108123324-108123346 ATGGAGGGAGAGCTGAAGCAGGG - Intergenic
1046029624 8:108768079-108768101 GGGTCTGGAGAACTGGAGTAAGG - Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046475609 8:114738742-114738764 GAGGATGGAGGATTGGAGGAGGG + Intergenic
1046855144 8:119022873-119022895 GAGGATGGAAAACTGGGGTATGG - Intronic
1047585807 8:126271156-126271178 GTGGATGGAAACCAGCAGCATGG + Intergenic
1047762493 8:127964382-127964404 GTGGGAGCAGAACTGGAGGATGG + Intergenic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1050497974 9:6264283-6264305 ATGGATTGTGAACTGAAGCAGGG - Intergenic
1051548650 9:18305049-18305071 ATGGATGGGGAGCTGAAGCAGGG + Intergenic
1052074598 9:24125385-24125407 GTAGAAAGAGAACAGGAGCAAGG - Intergenic
1053017072 9:34667934-34667956 GTGAATGGAGACCTGGATGATGG + Intergenic
1053047814 9:34935180-34935202 GTGGATTGAGAACTGAATCCTGG + Intergenic
1057141147 9:92727526-92727548 ATGGCTGGAGGAGTGGAGCATGG - Intronic
1057973297 9:99577776-99577798 GTGGATGGATCCCTTGAGCACGG + Intergenic
1059150930 9:111949134-111949156 GTGAGTGGGAAACTGGAGCAGGG - Intergenic
1059388977 9:113986955-113986977 GTAGATGGAGGACTGGAGCCTGG + Intronic
1060853194 9:126894574-126894596 GTGGATGGAGCACAGGAGAGCGG + Intergenic
1061956238 9:133962576-133962598 GTGCTTGGAGAGCTGGAGCCAGG - Intronic
1062052102 9:134452913-134452935 GAGGAGGCAGCACTGGAGCAGGG + Intergenic
1062271238 9:135710426-135710448 GTTGATGGAGAAATGGAGGCCGG - Intronic
1062373986 9:136253807-136253829 GTGGATGGAGGACGGGAGGTCGG + Intergenic
1186293955 X:8128517-8128539 GAGGATGGAGCATTTGAGCAGGG - Intergenic
1186575177 X:10758055-10758077 GTGGAAGGATAACTTGAGCCTGG - Intronic
1186701528 X:12095282-12095304 GTGGGAGGATCACTGGAGCAGGG + Intergenic
1187363204 X:18646685-18646707 GTGGATGGGGAACATAAGCAGGG - Intronic
1187513985 X:19948871-19948893 GGGGAAGGAGAAATGGGGCAGGG + Intronic
1188985486 X:36765021-36765043 GTAGATGGAGCACTGCTGCAGGG - Intergenic
1189230104 X:39445432-39445454 GTAGATCGAGAACTGGAGGCTGG - Intergenic
1189937072 X:46080573-46080595 ATGGAGGGCGAGCTGGAGCAGGG - Intergenic
1191207697 X:57851800-57851822 GTGGATGCAGCACAGCAGCATGG + Intergenic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193001523 X:76568184-76568206 ATGGAGGGTGAACTGAAGCAGGG + Intergenic
1193659493 X:84239576-84239598 GTGGAAGAGGAACTGGGGCATGG - Intergenic
1194158459 X:90422261-90422283 CTGGATGGTGAGCTGAAGCAAGG + Intergenic
1195605745 X:106803498-106803520 GAGGAGGGAGAACTGGAGTCAGG + Intronic
1196683991 X:118495600-118495622 GGGGAGGGAGAACTGGAGGTGGG - Intergenic
1198041317 X:132855573-132855595 GGGGCTGGAGGACTGGAGAAGGG + Intronic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198725867 X:139676298-139676320 ATGGAGGGTGAACTGAAGCAGGG - Intronic
1200582628 Y:4968809-4968831 GTGGATGGAGGACAGGAACCAGG + Intergenic
1201065895 Y:10093297-10093319 CTGGAGGAAGAACTGGAGCGTGG - Intergenic