ID: 1103070303

View in Genome Browser
Species Human (GRCh38)
Location 12:117935799-117935821
Sequence TTGTGTGACCAGAGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103070303_1103070307 7 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070307 12:117935829-117935851 AGCTGTTCCTCAGACACCTCAGG 0: 1
1: 0
2: 5
3: 38
4: 310
1103070303_1103070314 26 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070314 12:117935848-117935870 CAGGGGCTTGGCACATGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 167
1103070303_1103070308 8 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070308 12:117935830-117935852 GCTGTTCCTCAGACACCTCAGGG 0: 1
1: 0
2: 5
3: 23
4: 204
1103070303_1103070311 14 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070311 12:117935836-117935858 CCTCAGACACCTCAGGGGCTTGG 0: 1
1: 0
2: 9
3: 244
4: 8454
1103070303_1103070313 23 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070313 12:117935845-117935867 CCTCAGGGGCTTGGCACATGCGG 0: 1
1: 0
2: 2
3: 45
4: 229
1103070303_1103070309 9 Left 1103070303 12:117935799-117935821 CCCACTCCACTCTGGTCACACAA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1103070309 12:117935831-117935853 CTGTTCCTCAGACACCTCAGGGG 0: 1
1: 0
2: 4
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103070303 Original CRISPR TTGTGTGACCAGAGTGGAGT GGG (reversed) Intronic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
904895087 1:33811134-33811156 TTGCATGATCATAGTGGAGTCGG - Intronic
906938661 1:50236610-50236632 TTTTGGGGCCAGAGTGGAATAGG - Intergenic
907609299 1:55851779-55851801 TTGTGTTTTCAGAGTGGAGGTGG - Intergenic
908897641 1:68918403-68918425 TTCTGTATCCAGAGTAGAGTGGG + Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
916723939 1:167506169-167506191 TTCTGTGACCAGAGTGGGACTGG - Intronic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
922492674 1:226030967-226030989 TTGTATGCCCAGAGTGTATTAGG + Intergenic
922754742 1:228089397-228089419 CTGACTGACCAGAGTGGGGTGGG + Intronic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
1064314018 10:14237942-14237964 TTGAGTGACCCAAGTGGAGTAGG - Intronic
1067283222 10:44888707-44888729 TTGTGGAACCAGAGTGCAGATGG - Intergenic
1068800166 10:61131704-61131726 TTGTGGGACCTCAGTGGAGAGGG - Intergenic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1070020455 10:72580323-72580345 TTGGGTGAGTAGAGTGGGGTGGG - Intronic
1073122902 10:101132933-101132955 TTGAGTGCCCAGAGTGGAAACGG - Intronic
1073237272 10:102028260-102028282 ATGTGTGGCCTGAGTGCAGTGGG + Intronic
1075713205 10:124541790-124541812 GTTGGAGACCAGAGTGGAGTGGG + Intronic
1076080372 10:127575214-127575236 TGGTGTGACCAGATTTCAGTGGG + Intergenic
1077790478 11:5434316-5434338 TTGTAGGTCCAGAGTGGAGTAGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1080820671 11:35803168-35803190 TTGTGTCACCAGACTGAACTAGG - Intronic
1081962804 11:47150767-47150789 TAGTGTGGCCAGAATGCAGTGGG + Intronic
1085415081 11:76314282-76314304 ATGTGAAACCAGAGTGGAATGGG + Intergenic
1086558929 11:88144938-88144960 TTATGTGAGCAGAATGGAGCAGG + Intronic
1087880682 11:103412253-103412275 ATGTGTGACACGATTGGAGTAGG + Intronic
1088634543 11:111807265-111807287 TGGTGTGGTCAGAGTGCAGTAGG - Intronic
1089954218 11:122555645-122555667 TTCTGTGACCAGAGTGGGTAGGG + Intergenic
1090481548 11:127073387-127073409 GTGTGTGACTAGAGTGGGGTTGG + Intergenic
1091968690 12:4767175-4767197 TTCTGTGACCCCAGAGGAGTCGG + Intronic
1092944661 12:13441568-13441590 TTGAGTGACGGGAGAGGAGTGGG - Intergenic
1093373053 12:18387621-18387643 TGGTGTGAGAAGAGTGGAGGGGG - Intronic
1095414544 12:41962137-41962159 TTCTGTCTCCAGAGTGGAATGGG - Intergenic
1096519138 12:52174309-52174331 GGGAGTGACCAGGGTGGAGTGGG + Intronic
1098190830 12:67946642-67946664 TTGTGTCACCACAGTGAACTGGG + Intergenic
1098418025 12:70258909-70258931 ATGTGTGGCTAGAGTGTAGTGGG + Intronic
1099437575 12:82661950-82661972 TGCTGAGAGCAGAGTGGAGTGGG + Intergenic
1099866274 12:88286046-88286068 TTGTGGTACTAGAGTAGAGTTGG + Intergenic
1101575617 12:105993947-105993969 GTGCGTGACCAGAGCCGAGTTGG + Intergenic
1101673438 12:106897313-106897335 TTGACTGCCCATAGTGGAGTTGG + Intergenic
1102290190 12:111692921-111692943 TTGTGGGACTAGAGTGGTGGTGG + Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1103586904 12:121962916-121962938 TGGTGAGGCCAGAGTGGAATGGG + Intronic
1103950492 12:124548410-124548432 AGGTGTGACCAGAGTGGACTGGG + Intronic
1108839632 13:54596066-54596088 TTGTGTTACAAGAGAGTAGTTGG - Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1117798544 14:59419428-59419450 TGGTGTGACCACACAGGAGTAGG - Intergenic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1118974142 14:70663078-70663100 TTGTGAGGCAAGAGTGGATTTGG - Intronic
1119327697 14:73771196-73771218 TTCTGTGATCAGATTGAAGTAGG - Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121758529 14:96423584-96423606 TTGTCTGTCCAAAGGGGAGTGGG + Intronic
1123932733 15:25179612-25179634 TGGTGTGACCTTAGTGGGGTTGG + Intergenic
1123996823 15:25724498-25724520 TTCTGTGACCAGACAGGTGTGGG - Intronic
1126368211 15:47917840-47917862 TTGTGAGACCAGTGTGTTGTGGG + Intergenic
1126872066 15:53000577-53000599 TTGTGTCACCAGTGTGCAGGGGG + Intergenic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1128235850 15:66066614-66066636 TGGTGTGACCACAGTGCAGCAGG - Intronic
1128894825 15:71363209-71363231 TTGTGTGACCACAGCAGAGTTGG - Intronic
1130128788 15:81118466-81118488 TTGTGGGACCGGAGCGGGGTGGG + Intronic
1131349654 15:91687256-91687278 TTGTGTGTACAGGGTGGGGTTGG - Intergenic
1131404512 15:92153624-92153646 TAGTGTGACAAGATTCGAGTTGG + Intronic
1133056159 16:3146363-3146385 AGGTGTGAGGAGAGTGGAGTGGG - Intronic
1136060899 16:27725807-27725829 TGGTGTGACCAGGCTGGAGGCGG - Intronic
1136229094 16:28876605-28876627 TGCTGTGACCTGAGGGGAGTGGG - Intergenic
1138338690 16:56272946-56272968 TTGGGTGACCTGAGTGGTGCAGG - Intronic
1141525482 16:84608462-84608484 TTGTGTGTCCACAGGGGCGTGGG - Intronic
1143485246 17:7250754-7250776 TTGTGTGTCAAGGGTGGAGGTGG - Intronic
1143858217 17:9868490-9868512 TTTTGTGACCAGATGGGGGTGGG - Intronic
1144535161 17:16081660-16081682 TTATTTGACCTGACTGGAGTGGG + Intronic
1144760883 17:17706612-17706634 TTGAGGGATCAGAGTAGAGTTGG + Intronic
1148059796 17:44828540-44828562 TTTTGTGCCCAGAGTGCTGTAGG - Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149270130 17:54968521-54968543 TTCTTAGGCCAGAGTGGAGTGGG - Exonic
1150811003 17:68357122-68357144 TTGAGTGCCCAGAGTGCAGTGGG - Intronic
1153514119 18:5889629-5889651 TTGGGTGAGCACAGTGGGGTGGG + Exonic
1156478801 18:37423388-37423410 TTGTGGGGCCAGAGTGGGATGGG + Intronic
1157279925 18:46340072-46340094 TTGTGTGACAGTTGTGGAGTAGG - Intronic
1157353706 18:46914566-46914588 TTGTGTGTCGGGGGTGGAGTTGG - Intronic
1157426143 18:47585944-47585966 GTGAGGGACCAGCGTGGAGTAGG - Intergenic
1158222263 18:55161790-55161812 TTGTGTGAACAGAGAGGATTGGG - Intergenic
1160399582 18:78600242-78600264 TTGTCTGTTCAGAGTGGAGCTGG - Intergenic
1160955251 19:1688313-1688335 CTGTGGGACCAGAATGGGGTGGG + Intergenic
1161993132 19:7696692-7696714 TTGTGTGACCCGAGTGTCATCGG - Intronic
1163649311 19:18507944-18507966 TTGTGTGTCCCTTGTGGAGTTGG - Intronic
1164123514 19:22288986-22289008 TTAAGTGAGCAGAATGGAGTGGG + Intronic
1165955275 19:39498730-39498752 TTGTGTGGCTAGGGTGGGGTGGG - Intergenic
1166326873 19:42056472-42056494 TGGTGTGGCCAGAGTGGTGTGGG + Intronic
928534645 2:32228237-32228259 TTCTGGGAACAAAGTGGAGTGGG - Intronic
932761216 2:74440326-74440348 TTGTGAGCCCAGGGTGGAGCGGG - Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
935704026 2:105840409-105840431 TTGTGAGAGTAGAGTAGAGTAGG - Intronic
936547953 2:113409099-113409121 TTGTGAGTCCAGAGAGGAGAAGG + Intergenic
938068032 2:128292407-128292429 TTCTGTGTCCAGACTGGTGTGGG - Intronic
939081972 2:137673524-137673546 TTCTGAAACCAGAGTGGAGGAGG + Intronic
940488246 2:154324099-154324121 GTGTGGGAAAAGAGTGGAGTAGG - Intronic
942019807 2:171855848-171855870 TTGTTTGACAAGAGTGGAAATGG - Exonic
942808150 2:179960098-179960120 TTGAGTGACCAGTTTGTAGTGGG - Intronic
943982443 2:194572095-194572117 TTTTGGGATCCGAGTGGAGTAGG - Intergenic
944344988 2:198652642-198652664 TTGTGTGACAAGGGGGGAGCTGG - Intergenic
945913622 2:215679171-215679193 TTGTGTGTACATAGTAGAGTAGG - Intergenic
946065806 2:216986169-216986191 TTATGTGAATGGAGTGGAGTAGG - Intergenic
946936742 2:224729493-224729515 TTGAGTGACCAGACCAGAGTGGG - Intergenic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1170843909 20:19946196-19946218 AAGTCTGACCAGAGTGGAATGGG + Intronic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1171421656 20:25021574-25021596 TGGTGTGAACATGGTGGAGTGGG - Intronic
1172429176 20:34876197-34876219 TGGAGTGACCAGAGTGGGGTGGG - Intronic
1173099623 20:40073640-40073662 TTGTGTTACCAGAGTTCAGCAGG - Intergenic
1176992654 21:15517422-15517444 TAGTGGGGGCAGAGTGGAGTGGG + Intergenic
1177410400 21:20722315-20722337 TTGTGTGTACAGTGTGAAGTAGG + Intergenic
1179607758 21:42528502-42528524 CTGTGTGTCCAGAGAGGGGTGGG - Intronic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1184245135 22:43231923-43231945 TTGTGTGACCAGCGGGGGGACGG + Intronic
955344810 3:58153196-58153218 TTCTGTGGCCAGCATGGAGTGGG - Intronic
956256256 3:67286171-67286193 GTGTGGGACCAGTGTGGATTTGG - Intergenic
960349618 3:116576410-116576432 GTGGGTGACCACAGTGGAGGAGG + Intronic
960501868 3:118447497-118447519 TTGTGTGACAAGAGTGGATATGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
963280724 3:143382495-143382517 TTGTGTGCCCAGCCTGGAGCAGG + Intronic
965890257 3:173504660-173504682 GTGTGAAACCAGACTGGAGTGGG - Intronic
968074730 3:195810098-195810120 TTGTGTGGCCAGGGTGGGGTGGG + Intronic
973204019 4:47539849-47539871 TTCAGTGACTAGAGTGGAGGAGG - Intronic
973533386 4:51855625-51855647 TTGTGTGGCTAGAATGGAGTAGG + Intronic
975536818 4:75459793-75459815 TTTGGTGACCAGAGGGGAATAGG + Intergenic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
977790786 4:101099998-101100020 TTATGTGACCTGAGGAGAGTGGG + Intronic
981637806 4:146900043-146900065 ATATGTGACTAGAGTGGAGTGGG - Intronic
984604268 4:181766525-181766547 TGGGGTGAGCAGAGTGGAGGTGG + Intergenic
984833904 4:184001173-184001195 TTCTGTGTTCAGAGTGGAATTGG + Intronic
984937194 4:184899623-184899645 TTGAGAGGCCAGAGAGGAGTGGG - Intergenic
985121187 4:186643696-186643718 TTGTATGGCCAGAGTGCAGGGGG - Intronic
986006452 5:3672608-3672630 ATGTGTGAGCATAGTGCAGTGGG - Intergenic
986150547 5:5126072-5126094 ATGTGTCACCAGGGTGGATTGGG + Intergenic
988917241 5:35906777-35906799 TGGGGTGACCTGAGTTGAGTTGG + Intronic
993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG + Intronic
994840628 5:104920799-104920821 TTGTTTTAGCAGAGTGGAGAGGG - Intergenic
996428206 5:123338217-123338239 TTGTGTATACAGAGTGTAGTTGG + Intergenic
996537303 5:124591915-124591937 TGGGGTTACCAGAGTGGAGGCGG - Intergenic
996678155 5:126200618-126200640 TTATATGACCAGAGAGGAATTGG - Intergenic
999418836 5:151422941-151422963 TTGTGTGTGGGGAGTGGAGTGGG - Intergenic
999961726 5:156763150-156763172 TTGTGTAATGAGAGTGAAGTAGG + Intronic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1001494629 5:172179222-172179244 TTGTGTCTGCAAAGTGGAGTTGG - Intronic
1001803498 5:174563941-174563963 TTGTGGGACTGGAGTGGAGGTGG + Intergenic
1002322944 5:178386572-178386594 GTGTGTCACCAGAGGGGGGTCGG + Intronic
1004691764 6:17998243-17998265 TTGTGGGTCCAGTGTGGAGAAGG + Intergenic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005705437 6:28447076-28447098 TTCTTAGGCCAGAGTGGAGTGGG + Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1007388441 6:41535436-41535458 TTGTGTGACCGGGGCAGAGTTGG - Intergenic
1008136471 6:47783261-47783283 TTGGGTGACCAGTGTGAAGGTGG + Intronic
1010716522 6:79236005-79236027 CTGTGTTACCAAAGTGGATTTGG - Intergenic
1013941574 6:115669475-115669497 TTAGGAGACCAGAGTGAAGTGGG + Intergenic
1015289359 6:131520596-131520618 TCCTGTGACCAGATTAGAGTGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018182121 6:161233057-161233079 GTGTGTGACCAGGGTGTGGTGGG - Intronic
1024933799 7:54691334-54691356 ATCTGTGACTCGAGTGGAGTGGG - Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1029448599 7:100628143-100628165 GTGGGTGACCAGTGTGGAGTGGG + Intronic
1030951932 7:115801879-115801901 TTGTGTGACAAGAGAGGAAAAGG - Intergenic
1031928148 7:127657738-127657760 TTGGGAGGCCAGAGTGGAGAAGG - Intronic
1034362697 7:150514570-150514592 TTGTCTTCCCAGGGTGGAGTGGG - Intergenic
1035529657 8:341067-341089 TTGTGAGACCATGGTGGAGATGG - Intergenic
1035529672 8:341207-341229 TTGTGAGACCATGGTGGAGATGG - Intergenic
1035529703 8:341477-341499 TTGTGAGACCATGGTGGAGATGG - Intergenic
1037643447 8:20769551-20769573 TTGTGTGGACAGTGTGGAGCTGG - Intergenic
1038528379 8:28296404-28296426 AGGTGTCAGCAGAGTGGAGTGGG - Intergenic
1038892945 8:31747384-31747406 TTATGTGACAAGAGTGGTATAGG - Intronic
1038918852 8:32059319-32059341 TTGTAAGTCCAGTGTGGAGTAGG - Intronic
1039032409 8:33324720-33324742 TTGTGGGAGAAGAGTGGGGTTGG - Intergenic
1040054928 8:43049262-43049284 TGGAGTGACCAGATGGGAGTGGG - Intronic
1040525020 8:48214579-48214601 TTGTGGGGCCAGGGGGGAGTTGG - Intergenic
1043562738 8:81513845-81513867 ATCTGTGGCCAGAGTGGAGATGG - Intergenic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1049133834 8:140875457-140875479 TGATGTCACCAGAGTGGAGGAGG + Intronic
1053117752 9:35520421-35520443 TTGTGGGGCCAGGGTGGAGGAGG - Intronic
1055551906 9:77439336-77439358 GTGTATTACAAGAGTGGAGTTGG + Intronic
1056307564 9:85305194-85305216 TTGATTGACCAGAATGGAGGTGG + Intergenic
1060420048 9:123461905-123461927 TAGTGTTACCAGGGTGGGGTGGG + Intronic
1060895845 9:127216802-127216824 TGGTGTGACCAGTATGGAGGAGG - Intronic
1061113593 9:128593260-128593282 CTGTGTGTTCAGAGTGGTGTTGG + Intronic
1062488405 9:136792273-136792295 CGGGGTGACGAGAGTGGAGTCGG + Exonic
1062605805 9:137348474-137348496 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1062606209 9:137349981-137350003 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1185507542 X:642019-642041 TTGGGTGCCCAGCGTGGATTTGG + Intronic
1187389079 X:18874030-18874052 TTGAGTAACCAGAGTGGAAGAGG + Intergenic
1194607387 X:95997705-95997727 TTGTGTAACCTGTGTGGTGTAGG - Intergenic
1195803410 X:108736472-108736494 TCGTGCGCTCAGAGTGGAGTGGG - Intergenic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1199323017 X:146463332-146463354 GTGTTTGACTGGAGTGGAGTGGG - Intergenic
1200154054 X:153965914-153965936 GGGTGGGACCAGAGTGCAGTGGG - Intronic
1201367747 Y:13227373-13227395 GTGTGTGACCAGGGTGGGATGGG - Intergenic