ID: 1103072897

View in Genome Browser
Species Human (GRCh38)
Location 12:117959552-117959574
Sequence CAGGGTAAACAGACTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103072897_1103072902 22 Left 1103072897 12:117959552-117959574 CCTCCTACAGTCTGTTTACCCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1103072902 12:117959597-117959619 AAATATAACCCCTGGTTCAAAGG 0: 1
1: 0
2: 1
3: 10
4: 144
1103072897_1103072901 14 Left 1103072897 12:117959552-117959574 CCTCCTACAGTCTGTTTACCCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1103072901 12:117959589-117959611 TCATTTAAAAATATAACCCCTGG 0: 1
1: 0
2: 7
3: 52
4: 433
1103072897_1103072903 23 Left 1103072897 12:117959552-117959574 CCTCCTACAGTCTGTTTACCCTG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1103072903 12:117959598-117959620 AATATAACCCCTGGTTCAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103072897 Original CRISPR CAGGGTAAACAGACTGTAGG AGG (reversed) Intronic
901445714 1:9306747-9306769 CTGGGTAAATAGGCTGCAGGGGG + Intronic
903168326 1:21536767-21536789 AAGGGGAAACAGACTCTGGGTGG + Intronic
906780261 1:48567075-48567097 GAAGGTAAACAGACAGTAAGTGG - Intronic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
916016819 1:160757149-160757171 TATGGGAAACAGATTGTAGGGGG + Intergenic
916058072 1:161081630-161081652 CAGGGACAACACACTGTTGGGGG - Intronic
919885972 1:201935136-201935158 TCAGATAAACAGACTGTAGGAGG + Intronic
919886133 1:201936281-201936303 TCAGATAAACAGACTGTAGGGGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923459912 1:234200014-234200036 CAGGGACAACACACTGTTGGTGG + Intronic
1065761885 10:28990338-28990360 CCAGGTAAAGAGACTGTATGTGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068724720 10:60288492-60288514 CTGGGAAAACAGCCAGTAGGAGG + Intronic
1070895229 10:79978026-79978048 AAAGGTAAACAGACTGCAAGTGG - Intronic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1074763133 10:116682441-116682463 CTGGGTAAATAGACTGGGGGGGG + Intronic
1077977364 11:7261994-7262016 CATAGAAAACAGACTATAGGAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1085163091 11:74367154-74367176 CAGAGATAACAGACTGAAGGAGG + Intronic
1085771739 11:79331596-79331618 CAGTGTAAGGAGACTGTGGGAGG + Intronic
1088207872 11:107415091-107415113 CAGGTTAGAGAGACTATAGGTGG - Intronic
1088830658 11:113533492-113533514 CAGGGGAAAGAGATCGTAGGAGG + Intergenic
1089332859 11:117701924-117701946 CAGGGTAAACAGACAGCGCGTGG + Intronic
1090830072 11:130415068-130415090 CTGGGTACACAGAATGTCGGGGG - Intronic
1093513899 12:19962350-19962372 CAGGGTAAGCAGACTGTCATTGG + Intergenic
1093970096 12:25368723-25368745 CTGAGGAAACAGACTGGAGGTGG - Intergenic
1094264752 12:28544031-28544053 CGTGGAAAACAGACTGTAGCGGG - Intronic
1095378156 12:41556719-41556741 GATAGTAAGCAGACTGTAGGAGG + Intronic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1096808889 12:54157340-54157362 CAGGGTACACAGACTGTGTGGGG - Intergenic
1100407878 12:94286822-94286844 TAGGGCAAACAGAGTGTAGCTGG + Intronic
1102251774 12:111392214-111392236 CAGGGGAAACAGACTGGGCGCGG + Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1106405629 13:29470574-29470596 CATGGAGAACAGACTGTAGGAGG - Intronic
1111283662 13:86061407-86061429 CAGAGGATACAGACCGTAGGAGG - Intergenic
1112376068 13:98842253-98842275 CTGTGCAAACAGACTGGAGGAGG - Intronic
1113553212 13:111209302-111209324 CAAAGTAAACAGACAGTAAGAGG - Intronic
1119900197 14:78253101-78253123 CAGAGCAAACATACTGTGGGAGG - Intronic
1121643596 14:95502404-95502426 CAGGACACACAGGCTGTAGGCGG - Intergenic
1128242584 15:66111012-66111034 CAGAGAAAACCCACTGTAGGAGG + Intronic
1134507018 16:14816114-14816136 GAGGTTAAACAGACTGTTGTTGG + Intronic
1134573541 16:15312712-15312734 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1134666037 16:16019479-16019501 CAGGGTAAACAGAGTCTGGTTGG + Intronic
1134728881 16:16443603-16443625 GAGGTTAAACAGACTGTTGTTGG + Intergenic
1134938563 16:18268321-18268343 GAGGTTAAACAGACTGTTGTTGG - Intergenic
1137691984 16:50434855-50434877 CAGGGGAAACTGTGTGTAGGGGG + Intergenic
1144246780 17:13374090-13374112 CAGATAAAACAGAGTGTAGGGGG - Intergenic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1152432229 17:80254884-80254906 GAAGGTAAACAGACTGTGGCGGG + Intergenic
1156412552 18:36846605-36846627 AAGGGGAAACAGACTGTAAAAGG - Intronic
1157391790 18:47309287-47309309 GTGAGTAAATAGACTGTAGGAGG + Intergenic
1157522142 18:48352596-48352618 CAGGGTGAGCAGGCTGGAGGAGG + Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160746986 19:716476-716498 CATGGTCAACAGACTGGTGGTGG + Intronic
1161273145 19:3401308-3401330 CAGGGAGGACAGACTGTGGGGGG + Intronic
1161847727 19:6721236-6721258 CAGGGAAAACTTCCTGTAGGAGG + Intronic
1166255829 19:41603839-41603861 CAGGGTACACAGACTACAGATGG + Intronic
932214574 2:69958574-69958596 GAGGGTAAAGAGTCTGTAAGTGG - Intergenic
933096472 2:78189469-78189491 CAGTGTACACAGCCTGTATGAGG - Intergenic
935145366 2:100391749-100391771 CAGGGTAAGCAGACCGCAGGAGG - Intergenic
941203455 2:162542997-162543019 CAGGCTAAACAGACTATACATGG - Intronic
943814460 2:192234986-192235008 CAGGTTAAACAGAGTGAATGTGG - Intergenic
945929300 2:215839413-215839435 CAGGGTAAAAAGACAGGTGGAGG + Intergenic
1170505921 20:17025781-17025803 CATTGGAAATAGACTGTAGGGGG - Intergenic
1170675024 20:18471085-18471107 CAGTATAAACAAATTGTAGGTGG - Intronic
1172075799 20:32296344-32296366 AAGGGTAAACACACTTTGGGAGG + Intronic
1175604427 20:60300488-60300510 CAGGATAAACAAACTGGAGGTGG + Intergenic
1178869031 21:36356206-36356228 AAGCATATACAGACTGTAGGTGG - Intronic
1181402987 22:22662636-22662658 CAGGATATACAGATTGGAGGTGG - Intergenic
1183456377 22:37925384-37925406 CAGGGTACATGGATTGTAGGTGG + Intronic
1183589547 22:38771852-38771874 CAGGGTACACAGACTCTAAAGGG - Intronic
1185031876 22:48448322-48448344 CATGGGAAGCAGACTGTTGGTGG - Intergenic
949812073 3:8016637-8016659 CAGGGTAGACAGGGTGTATGTGG - Intergenic
958907743 3:99960596-99960618 GCAGGTAAAAAGACTGTAGGAGG - Intronic
960205575 3:114893354-114893376 CAGGCTAGACAGACAGTGGGTGG + Intronic
961362414 3:126376194-126376216 CAGAGGAAACAGAGTGGAGGCGG + Intergenic
968874997 4:3262049-3262071 CAGGGAAATAAGGCTGTAGGGGG + Intronic
969858258 4:10017103-10017125 CAGGGAAGACAGCCTGGAGGAGG - Intronic
970224710 4:13845636-13845658 CTGGGAAAATAGGCTGTAGGTGG + Intergenic
975355361 4:73396294-73396316 CAGGGTAAATTGCCTGTAGTGGG - Intergenic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
983475348 4:168205926-168205948 CATGAGAAACAGACTGGAGGAGG - Intergenic
983735067 4:171046857-171046879 CTGGGTAAGCAGATTTTAGGAGG + Intergenic
984432468 4:179666094-179666116 CAGAGTACACAAAATGTAGGGGG - Intergenic
985007836 4:185551936-185551958 AAGGGTAAACTGACTGTTAGAGG + Intergenic
985296050 4:188438495-188438517 TAGGGTAAACAGACTTAAGTGGG - Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986636854 5:9831153-9831175 CAGGGGAAACAGATTGCAGTTGG + Intergenic
986982961 5:13470018-13470040 CAGGGTAAAGAGACTGAAACAGG + Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990372717 5:55136885-55136907 CAGGGTCAAAAGACTTTGGGAGG + Intronic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
995951000 5:117713865-117713887 CTGGGTAAAGAAAATGTAGGTGG - Intergenic
996455486 5:123676555-123676577 CAGGGTAATCAGACAGGAGTAGG - Intergenic
1001415118 5:171540192-171540214 CAGGGAAGACAGCCTGGAGGAGG - Intergenic
1002184791 5:177449268-177449290 CAGTGTACACAGCCTGGAGGCGG - Intronic
1003231400 6:4256932-4256954 AAGATTAAACAGCCTGTAGGTGG + Intergenic
1004360655 6:14967896-14967918 TGGGGTAAACAGAGTGCAGGAGG + Intergenic
1005651550 6:27889784-27889806 CTGGGAAAACAGATTATAGGAGG - Intergenic
1005817930 6:29571962-29571984 CAGAGTAAAAAGAATATAGGAGG + Intronic
1006915230 6:37589666-37589688 TGGGGTGATCAGACTGTAGGAGG - Intergenic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1008499256 6:52164398-52164420 GAGGGTGGACAGACTGTGGGAGG + Intergenic
1010510250 6:76709299-76709321 TATTGTTAACAGACTGTAGGGGG + Intergenic
1014897665 6:126922953-126922975 CAGGGTCAACTGACTGGAGGTGG - Intergenic
1014942056 6:127453217-127453239 CAGGGTCAACGGACTGAGGGAGG + Intronic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1017045785 6:150346083-150346105 AAGGCCAAACAGCCTGTAGGTGG + Intergenic
1017281718 6:152633016-152633038 CTAGGTAAACAGTCTGTTGGAGG - Intronic
1018148219 6:160913126-160913148 CAGGCTGTACAGGCTGTAGGTGG - Intergenic
1020920430 7:14257329-14257351 CTTGGAAAACAGACTGTAAGTGG + Intronic
1021474064 7:21040894-21040916 CTGGGTAATTAGACTGTAGTAGG - Intergenic
1021649213 7:22816843-22816865 CAGGTTATACAGTCAGTAGGTGG - Intronic
1022757581 7:33310149-33310171 AAGATTAAACACACTGTAGGAGG - Intronic
1024063020 7:45713133-45713155 TAGGGCATACAGAATGTAGGGGG - Intronic
1025780641 7:64598993-64599015 AAGGGTACACAGTCTGCAGGAGG + Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1030105288 7:105982049-105982071 TATGGAAAACAGACTGCAGGGGG - Intronic
1030700250 7:112630282-112630304 CAGGATAAAAAGAATGGAGGAGG - Intergenic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG + Intronic
1034762888 7:153690067-153690089 CAGGGTAAACAGACTTAACTGGG - Intergenic
1036210922 8:6840797-6840819 CAGGGCAAACACCCAGTAGGTGG + Intergenic
1040727082 8:50394294-50394316 CAGGGAAAACAGAATATAAGCGG + Intronic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048801068 8:138194144-138194166 CAGGGCCAGCAGACTGTAGGAGG - Intronic
1050259158 9:3823034-3823056 CAGGCAAAACAGAGTTTAGGTGG - Intergenic
1050317923 9:4422500-4422522 CAGGGGAAACAGAATCCAGGTGG - Intergenic
1055941254 9:81652170-81652192 CTGGTTATACACACTGTAGGAGG + Intronic
1056819467 9:89828147-89828169 CTGGATAAAAATACTGTAGGTGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057524592 9:95787133-95787155 CAGGATAAAGAGAGTGGAGGGGG - Intergenic
1059217979 9:112584329-112584351 CATGGTAAACATACTCTAGCTGG + Intronic
1060465604 9:123902116-123902138 AAGGGTAAAATGACTGAAGGTGG - Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1189832735 X:44991388-44991410 CTGGACAAAAAGACTGTAGGAGG - Intronic
1190461515 X:50681185-50681207 TATGGGAAACAGACTGTAGGGGG - Intronic
1191136758 X:57072514-57072536 CAGGGAAATCAGACTGGAGTAGG - Intergenic
1193769726 X:85574478-85574500 CAGGGTAAACAGACTTACAGTGG - Intergenic
1194501535 X:94687515-94687537 CAGGGTAAACAGACATTACAAGG + Intergenic
1196003879 X:110814794-110814816 CAGGTTCAAGAGAGTGTAGGAGG + Intergenic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic
1197896914 X:131325954-131325976 CAGGGTACACAGCCAGTAAGTGG - Intronic
1198991206 X:142516512-142516534 CAGGGTGAGGAGACTGAAGGTGG - Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic