ID: 1103074837

View in Genome Browser
Species Human (GRCh38)
Location 12:117973710-117973732
Sequence TGTCATCAATTTCAAAGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103074834_1103074837 15 Left 1103074834 12:117973672-117973694 CCTCTGGTGTAGGGTTTTGCACC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1103074837 12:117973710-117973732 TGTCATCAATTTCAAAGAACGGG 0: 1
1: 0
2: 1
3: 48
4: 476
1103074835_1103074837 -6 Left 1103074835 12:117973693-117973715 CCTCAAACTAATAAGAATGTCAT 0: 1
1: 0
2: 1
3: 23
4: 300
Right 1103074837 12:117973710-117973732 TGTCATCAATTTCAAAGAACGGG 0: 1
1: 0
2: 1
3: 48
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103074837 Original CRISPR TGTCATCAATTTCAAAGAAC GGG Intergenic
905087787 1:35398695-35398717 GTTCATCAGTCTCAAAGAACTGG - Intronic
905739698 1:40359737-40359759 TGTCATCAGTTTAAAATAATGGG - Intronic
905841983 1:41188847-41188869 TGTTAAGTATTTCAAAGAACAGG + Intronic
906756432 1:48320940-48320962 TGTCATCAGTTTAAAACAAAGGG + Intronic
908301962 1:62771058-62771080 TGTCATCAGTTTAAAATAATGGG - Intergenic
909760060 1:79275209-79275231 TGTCAGCTATGTCAAAGATCTGG - Intergenic
910054581 1:83017048-83017070 TTTCATCAAATTCATCGAACTGG - Intergenic
910191283 1:84598590-84598612 TGGGATCACTTTCAAAGAGCTGG + Intergenic
910266409 1:85342454-85342476 TGTTATCATTTTCTGAGAACAGG - Intronic
910330866 1:86071166-86071188 TGTCATCAGTTTAAAATAATGGG + Intronic
910565856 1:88642121-88642143 ATTCATCAGTTTCAAAGCACTGG + Intergenic
910634591 1:89393579-89393601 TGTCATCAGTTTAAAATAATAGG + Intergenic
910639550 1:89444741-89444763 AGTCATCAATTTAAAATAATGGG - Intergenic
910716193 1:90233906-90233928 TGTCATCAGTTTAAAATAACGGG - Intergenic
911020106 1:93377589-93377611 TGTCATCAGTTTAAAATAATGGG + Intergenic
911310155 1:96282675-96282697 TGTGATTAGTATCAAAGAACTGG - Intergenic
911927552 1:103853958-103853980 TGTCATCAGTTTAAAATAATGGG + Intergenic
912018210 1:105069647-105069669 TGTCATCAATTTAAAATAATGGG - Intergenic
912046955 1:105470813-105470835 GGTCACCAATTACAGAGAACAGG + Intergenic
912142027 1:106741975-106741997 TGTCAGCTTTTTCAAAGAAATGG - Intergenic
912279654 1:108299534-108299556 TGTCAACTTTTTCAAAGATCAGG + Intergenic
912288572 1:108394823-108394845 TGTCAACTTTTTCAAAGATCAGG - Intronic
912606837 1:111000027-111000049 TGTCATCAGTTTAAAATAATGGG - Intergenic
912871896 1:113314428-113314450 TGTCATCAGTTTAAAATAATGGG + Intergenic
913032286 1:114921195-114921217 TGTCATCAGTTTAAAATAATGGG - Intronic
915178633 1:154038818-154038840 TGTCATCAGTTTAAAGTAACAGG - Intronic
915753118 1:158230714-158230736 TGTCATCAGTTTAAAATAATGGG + Intergenic
915863467 1:159472746-159472768 AGAGATAAATTTCAAAGAACTGG + Intergenic
915975180 1:160381142-160381164 TATCATCAACTTCAAATAATAGG - Intergenic
916322031 1:163515194-163515216 TGTCATCACTTTAAAATAATAGG + Intergenic
916616172 1:166442999-166443021 TGTCATCAGTTCAAAAGAAGGGG - Intergenic
916784968 1:168080258-168080280 AGTCATCAGTATCACAGAACAGG - Exonic
917300368 1:173567876-173567898 TGTCATCAATTTTAAATGATGGG - Intronic
917364416 1:174213909-174213931 TGTTATCAATCTCAGAGAAAAGG - Intronic
918475970 1:184925630-184925652 TGTCATCAGTTTAAAATAATGGG - Intronic
918617640 1:186564539-186564561 TGTCATCAGTTTAAAATAATGGG + Intergenic
919104631 1:193133812-193133834 TGTCATAAAATTCACAGAAAAGG + Intronic
919269708 1:195324443-195324465 TGTCATCAGTTTAAAATAATGGG - Intergenic
919287813 1:195586928-195586950 TGTCATCAAGTTAAAATAATGGG + Intergenic
919400509 1:197110817-197110839 TGTCAACTATGTCAAAGATCAGG - Intronic
919514670 1:198508568-198508590 TGTCATTAATTTAAAATAATGGG + Intergenic
919574116 1:199285442-199285464 TGTCTTGAATTTCAAACAAAAGG - Intergenic
921586007 1:216947125-216947147 TGTAATCATTTTCCAAGAAGAGG - Intronic
922065689 1:222138976-222138998 TGTCATCAGTTTGAAATAATGGG - Intergenic
922065692 1:222139050-222139072 TGTCATCAGTTTGAAATAATGGG - Intergenic
922065695 1:222139124-222139146 TGTCATCAGTTTGAAATAATGGG - Intergenic
922065716 1:222139652-222139674 TGTCATCAGTTTGAAATAATGGG + Intergenic
922319891 1:224477464-224477486 TGTCATCAGTTTAAAATAATGGG - Intronic
923960262 1:239073732-239073754 TGTCATCAGTTTAAAATAATGGG + Intergenic
924490582 1:244533574-244533596 TGTCATCAGTTTAAAATAATGGG - Intronic
1064596878 10:16954292-16954314 TGTGATCAATTTCTGAGCACAGG + Intronic
1066508457 10:36068414-36068436 AGTCTGCAAATTCAAAGAACAGG + Intergenic
1067779760 10:49191258-49191280 TCTCAAAAATTTCAAAGAAAAGG + Intergenic
1068392178 10:56412485-56412507 TGTCATCAATTTAAAATAATGGG - Intergenic
1069168396 10:65193619-65193641 TTTCATCAATGATAAAGAACAGG - Intergenic
1069395262 10:67980824-67980846 TGTTATCAATTTAAAATAATGGG + Intronic
1072155546 10:92720401-92720423 TGTCATCTTTTTAAAAAAACAGG + Intergenic
1072344190 10:94487528-94487550 TGTCATCAGTTTAAAATAATGGG - Intronic
1072492050 10:95917612-95917634 TGTCATCAATTTGAAATAATGGG - Intronic
1073517749 10:104092719-104092741 TAACACAAATTTCAAAGAACTGG - Intergenic
1073766852 10:106691990-106692012 TGTTATTAATTTTAAAGAGCAGG - Intronic
1073907635 10:108302274-108302296 TGTGATCAATTTCTAAGAATGGG - Intergenic
1074254099 10:111783114-111783136 TGTCATCAATATCCAAAAGCTGG + Intergenic
1074626537 10:115194906-115194928 TGTCATCAGCTTAAAATAACTGG - Intronic
1074834960 10:117282041-117282063 TATCTTCATTTTCAGAGAACTGG + Exonic
1075830371 10:125405420-125405442 TGTCATCAGTTTAAAATAATAGG - Intergenic
1076608443 10:131704415-131704437 TGTCATCTATTTCGAAGACATGG - Intergenic
1077859500 11:6162554-6162576 TGTCATCAGTTTAAAATAATGGG + Intergenic
1078244346 11:9560299-9560321 TGTCATCAGTTTAAAATAATGGG - Intergenic
1079035626 11:17017030-17017052 TGTCAGTAATTACAAAGAACTGG + Intergenic
1079068914 11:17325887-17325909 TGTCATCAATTTAAAATAATGGG - Intronic
1079530320 11:21444987-21445009 TGTCATCAGTTTAAAATAATGGG - Intronic
1079798416 11:24837124-24837146 TGTCAGAAATGTCAGAGAACTGG - Intronic
1080065442 11:28006857-28006879 TGCTATCAATTTCAAAGTGCTGG - Intergenic
1080351356 11:31388932-31388954 TGTCATCAGTTTAAAATAATAGG + Intronic
1080357754 11:31471514-31471536 TATCTTCAATTTAAAAAAACAGG + Intronic
1082824108 11:57565713-57565735 TGTCATCAGTTTAAAATAACAGG + Intronic
1085007900 11:73111813-73111835 TGTCATCAGTTTAAAATAATTGG - Intronic
1085178735 11:74513762-74513784 TGTCATCAGTTTAAAATAATGGG + Intronic
1085223668 11:74898188-74898210 TGTCATCAGTTTAAAATAACGGG + Intronic
1086118790 11:83284439-83284461 TGTCAGGAATTCAAAAGAACAGG + Intronic
1086150914 11:83609697-83609719 TGTCATGAATTTCAAATTTCAGG - Intronic
1086990752 11:93301481-93301503 TGTCATCAGTTTAAAATAATGGG + Intergenic
1087031740 11:93713017-93713039 TGTCATCAGTTTTAAATAATGGG - Intronic
1087135552 11:94714628-94714650 ATTCAACAATTTCAAAGAAATGG - Intronic
1087299538 11:96415866-96415888 TGTCATCAGTTTAAAATAATAGG + Intronic
1087366325 11:97224389-97224411 TATCTTGAATTTCAAACAACAGG + Intergenic
1087370894 11:97282113-97282135 TGTCATCAATTTAAAATAATGGG + Intergenic
1087875884 11:103356342-103356364 TATCATAATTTTTAAAGAACAGG - Intronic
1088095088 11:106090196-106090218 TGTTATAAATTTTAAATAACAGG - Intronic
1090065036 11:123495781-123495803 TGTCATCAGTTTAAAATAATGGG - Intergenic
1090111408 11:123913329-123913351 TGTCATCAGTTTAAAATAATGGG + Intergenic
1090210142 11:124914504-124914526 TGTCATCAGTTTAAAACAACAGG - Intergenic
1090222092 11:125035791-125035813 TGTCATCAGTTTAAAACAACAGG - Intronic
1090822450 11:130355890-130355912 TGTCAATGTTTTCAAAGAACCGG + Intergenic
1092497873 12:9014932-9014954 TGTCATCAGTTTAAAATAATGGG + Intergenic
1093346791 12:18047081-18047103 TGTAATGAATTTGAAAGAAAAGG - Intergenic
1093399390 12:18726096-18726118 TTTCATCAGTTTCATAAAACTGG - Intronic
1094655558 12:32416583-32416605 TGTCATCCATTTAAAATAATGGG - Intronic
1094787162 12:33861736-33861758 TGTCATCAGTTTAAAATAATGGG - Intergenic
1095181488 12:39151857-39151879 TGTCATCAGTTTTAAATAATGGG - Intergenic
1096451092 12:51742007-51742029 TGTCATCAGTTTAAAATAATGGG - Intronic
1097355892 12:58601399-58601421 AGGCATGAAATTCAAAGAACAGG + Intronic
1097425831 12:59443649-59443671 TGTCATCAGTTTAAAATAATGGG - Intergenic
1098060555 12:66556748-66556770 TGTCATCAGTTTAAAATAATGGG + Intronic
1098333506 12:69378588-69378610 TGTCATCAGTTTAAAACAACGGG - Intronic
1098504139 12:71229230-71229252 TGTCATCAGTTTAAAACAATGGG + Intronic
1099118893 12:78663433-78663455 TGACATCACTTTCAAAGTAGAGG - Intergenic
1099465344 12:82979391-82979413 TGTCATCAGTTTAAAATAATGGG - Intronic
1099882448 12:88482819-88482841 TGTCATCAATTTAAAATAATGGG + Intergenic
1100875948 12:98961829-98961851 TGTCATCCATTTAAAATAATGGG + Intronic
1100961099 12:99963581-99963603 TATCATTAATTGCAAAGAAATGG - Intronic
1103074837 12:117973710-117973732 TGTCATCAATTTCAAAGAACGGG + Intergenic
1103817145 12:123667691-123667713 TGTCATCAGTTTAAAATAATGGG - Intergenic
1105422604 13:20266354-20266376 TGTCTTCAATTTCATAGCCCCGG + Intergenic
1107292952 13:38877863-38877885 TGTGAATAATTTCAAAGATCTGG - Intronic
1107750672 13:43562305-43562327 TGTCATCAATTTAAAATAATGGG + Intronic
1108328807 13:49363420-49363442 TGTCATCAATTTAAAACAATGGG + Intronic
1108961961 13:56245642-56245664 GTTCATCAATTTGAAAGAAAAGG - Intergenic
1109046068 13:57412231-57412253 TGTCATAAATTCAAAATAACAGG + Intergenic
1109273574 13:60280389-60280411 TGTCATCAACTTTGAAGAAAGGG - Intergenic
1109816836 13:67595961-67595983 TGTCAGCGATTTCATACAACAGG + Intergenic
1110640304 13:77816083-77816105 TTTCATTAATGTCAAAGAAGAGG + Intergenic
1110665540 13:78113621-78113643 TGTCATAAATTTAAAATAATAGG - Intergenic
1111442787 13:88303040-88303062 TATCATCAATTTGAAAAAAATGG + Intergenic
1112003209 13:95231075-95231097 AGTCATCAAATTCATAGAGCTGG + Intronic
1113734200 13:112665523-112665545 TCTCAGCAATTTCAAAGGGCAGG - Intronic
1114130518 14:19786614-19786636 TCTCATTAATTTCAAAGGAAAGG + Intronic
1114251112 14:20961598-20961620 TGTCATCAGTTTAAAATAATGGG + Intergenic
1114820542 14:26013346-26013368 TGTCATCAGTTTAAAATAATAGG + Intergenic
1115930366 14:38484497-38484519 TGTCATCATTTTAAAATAATGGG + Intergenic
1116031214 14:39575006-39575028 TGTCATCCCTTTAAAATAACTGG - Intergenic
1116085654 14:40234645-40234667 TGTCATCAGTTTAAAATAATGGG - Intergenic
1116203488 14:41830803-41830825 TGTCAGCAGTTGGAAAGAACTGG + Intronic
1116257411 14:42573596-42573618 TGCCATCATTTTAAAATAACTGG + Intergenic
1116330489 14:43591696-43591718 TTTCATAAATTTCACACAACTGG + Intergenic
1116355034 14:43917034-43917056 TGTCCTCAATTTAAAATAATGGG + Intergenic
1117606722 14:57437642-57437664 TGTCATCAGTTTAAAATAATGGG - Intergenic
1117795185 14:59386311-59386333 TGTCATCAGTTTAAAATAATAGG - Intergenic
1118694331 14:68369612-68369634 TGGCACCTATTTGAAAGAACAGG - Intronic
1120100328 14:80437449-80437471 TGTCATCCATTTAAAATAATGGG + Intergenic
1120100530 14:80439720-80439742 TGTCATCAGTTTAAAATAATAGG + Intergenic
1120340480 14:83215004-83215026 TGTCATGAATTTAAAACAATGGG - Intergenic
1120361126 14:83503624-83503646 AGTCATTAATTTCAAAGGAATGG - Intergenic
1122473261 14:101986742-101986764 TGTCTTCAACTTCCAAGAAAAGG + Exonic
1123111823 14:105874418-105874440 TGTCATCAGTTTAAAATAATGGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125821126 15:42632637-42632659 TGTCATCAGTTTAAACGAATGGG - Intronic
1125997159 15:44173385-44173407 TGTCATCTATTTGAAAGAGGAGG + Intronic
1127297734 15:57624578-57624600 TGTCATCAAAGCCAAAGAATTGG + Intronic
1127657412 15:61069298-61069320 TGTCATCGTTTTTAAAGAAATGG - Intronic
1128486276 15:68093031-68093053 AGTCATCACTGTCAAAGAAAAGG - Intronic
1129561975 15:76579451-76579473 TGTCATCAGTTTAAAATAATGGG + Intronic
1129835195 15:78700159-78700181 TGTCATCAGTTTAAAATAATGGG - Intronic
1130419392 15:83728561-83728583 TGTCATCAGTTTAAAATAATGGG - Intronic
1131240906 15:90742531-90742553 TGTCACTTATTTCAAAGAAAAGG + Intronic
1131582257 15:93655925-93655947 TGTGATCTATGTCAAAGCACAGG + Intergenic
1131954065 15:97712510-97712532 TGTTATAAATTTCAGAGCACAGG + Intergenic
1134888531 16:17817454-17817476 TTTCAACAATTTGAAAGATCTGG - Intergenic
1135523514 16:23195808-23195830 TGTAAACAATTGCAAAGAATTGG - Intronic
1136002344 16:27304401-27304423 TGTCAACAATGGCACAGAACTGG + Intergenic
1136988563 16:35137625-35137647 TGACATCAATTGCAAAGAGAGGG - Intergenic
1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG + Intergenic
1137882178 16:52061490-52061512 TGTCTTCAATTTCATAAATCTGG + Intronic
1138844737 16:60552024-60552046 TGTCATCAGTTTAAAATAACAGG - Intergenic
1139324615 16:66142644-66142666 AGTCATGAATTTCAAGAAACCGG - Intergenic
1140762068 16:78118724-78118746 TGATATCACTTTCAATGAACTGG - Intronic
1141341527 16:83208336-83208358 TGTCTTCAATTTCAAAGGCATGG + Intronic
1142938168 17:3356044-3356066 TGTCATCAGTTTAAAATAATGGG - Intergenic
1146086431 17:29834088-29834110 TGTCATCAGTTTAAAATAACGGG - Intronic
1149068518 17:52509923-52509945 TGTGATTAATGACAAAGAACAGG + Intergenic
1149973298 17:61240805-61240827 TGAGATCAATTTAAAAGAAATGG - Intronic
1150517931 17:65834061-65834083 TGTCATCTTTGTCAAAGATCAGG - Intronic
1152112202 17:78363187-78363209 TGTCATGATTTTGAAAGCACTGG + Intergenic
1153356313 18:4140328-4140350 TGTCATCAGTTTAAAATAATGGG - Intronic
1154325216 18:13385882-13385904 AGTCCTCAAGTTTAAAGAACAGG - Intronic
1155282373 18:24252889-24252911 TGTCATCAGTTTAAAATAATGGG + Intronic
1156055804 18:33001139-33001161 TATCATCAATTTAAAATAATGGG + Intronic
1156156070 18:34303257-34303279 TGTCATCAATTTAAAATCATGGG + Intergenic
1156697646 18:39786403-39786425 TATCATCACTATCAAAAAACAGG - Intergenic
1157200118 18:45652934-45652956 TGTCATTAATTTGAAAAGACAGG - Intronic
1157910023 18:51608210-51608232 TGTCATCTGTGTCAAAGAATAGG + Intergenic
1158531892 18:58270208-58270230 TTTCATGAATTTCAGAGAAGTGG + Intronic
1159091803 18:63858250-63858272 TGTCATCACTTTAAAACAATGGG - Intergenic
1159775148 18:72596233-72596255 TGTCATCAGTTTCAAATCATGGG - Intronic
1160111903 18:76040570-76040592 TGACATCTACTTCAAAGAAATGG + Intergenic
1160153868 18:76417201-76417223 TATTCTCAACTTCAAAGAACAGG + Intronic
1162611008 19:11752760-11752782 TGTCATCAGTTTAAAATAATGGG - Intergenic
1163200696 19:15766772-15766794 CATCATCATTTTCACAGAACTGG - Intergenic
1164547091 19:29175672-29175694 TGTCATCAGTTTAAAATAACAGG + Intergenic
1168602935 19:57734194-57734216 TGTCATCAGTTTAAAATAATGGG + Intronic
927439556 2:23103298-23103320 TGTCATAATTTTCAAAGAGTGGG - Intergenic
928218594 2:29383245-29383267 GATAATCAATTTCAAAGAGCTGG - Intronic
928377453 2:30787268-30787290 CATCATCAAGTTCAAAGACCAGG - Exonic
928484342 2:31714270-31714292 TGTCATCAGTTTAAAATAATAGG + Intergenic
928846112 2:35674853-35674875 TGTCATCAGTTTAAAATAATGGG - Intergenic
929529072 2:42734768-42734790 TGGCATCAGTTTAAAATAACAGG - Intronic
930230471 2:48838864-48838886 TGTCATCCGTTTAAAATAACAGG - Intergenic
930475700 2:51878424-51878446 TGTCATCAATTTCAAATAATGGG + Intergenic
930662325 2:54066658-54066680 TGTCTTCAATTTCAAAATAATGG - Intronic
930853275 2:55984983-55985005 TGTCATTAATTAAAAATAACAGG + Intergenic
931011916 2:57927083-57927105 TGTCATCCATTTAAAATAATGGG - Intronic
931406641 2:61985688-61985710 TGTCATCAGTTTAAAATAATGGG - Intronic
932920846 2:75913769-75913791 TGTCACCAATTTAAAATAATGGG - Intergenic
933086787 2:78063404-78063426 TGTCATCAGTTTAAAATAATTGG + Intergenic
933601208 2:84332579-84332601 TGTCATCAGTTTAAAATAATGGG + Intergenic
937613388 2:123891072-123891094 TGTCATCAGTTTAAAATAATGGG - Intergenic
938043496 2:128095879-128095901 TGTAACCAATATTAAAGAACTGG + Intronic
939110993 2:138007439-138007461 TGTCATCAATTTAGTAGAACTGG + Intronic
939226308 2:139369391-139369413 TGTCATCATATTGGAAGAACAGG - Intergenic
939546480 2:143560888-143560910 TGTCACCAAATTCAACAAACAGG - Intronic
939725195 2:145711349-145711371 TGTAACCAATCTCAAAGAAATGG - Intergenic
939913305 2:148009085-148009107 TGTCATCAGTTGCAAATAATTGG + Intronic
940468874 2:154067074-154067096 TGTCATCAGTTTAAAATAATGGG + Intronic
940795653 2:158074506-158074528 TGACATCACTTTAAAACAACGGG + Intronic
940838963 2:158557615-158557637 TGACATAAATATCAAACAACAGG - Intronic
941742450 2:169049350-169049372 TGTCATCAGTTTAAAATAATGGG + Intergenic
942569630 2:177300859-177300881 TGTCATCAGTTTTAAATAATGGG - Intronic
942834303 2:180275374-180275396 TGTCATCAGTTTAAAATAATGGG - Intergenic
943099400 2:183470565-183470587 TGTCATCAGTTTAAAATAATGGG - Intergenic
943104844 2:183531587-183531609 TGACTTAAATTTCAAAGAATAGG + Intergenic
943331397 2:186563646-186563668 TGTCAACAGTTTAAAATAACGGG + Intergenic
943574840 2:189619169-189619191 TGTCATCAGTTTAAAGTAACGGG - Intergenic
943932471 2:193871693-193871715 TTTCTTCAATATCAAAGGACAGG - Intergenic
944078868 2:195762168-195762190 TGTCATCAGTTTAAAATAATGGG + Intronic
944524385 2:200603666-200603688 TGTCATGAAAATAAAAGAACAGG + Intronic
944963136 2:204899436-204899458 TGTCATCAGTTTAAAATAATGGG - Intronic
945378252 2:209105660-209105682 TGTCATCAGTTTAAAATAATGGG + Intergenic
945619185 2:212111958-212111980 TGCCATGAATTTCAAAGAGTTGG + Intronic
945838053 2:214855893-214855915 TTGCAGCAATTGCAAAGAACAGG + Intergenic
946508859 2:220332695-220332717 TGTCATCAGTTTAAAAGAATTGG - Intergenic
947008928 2:225544482-225544504 TGTCATCAGTTTAAAATAATGGG - Intronic
947370211 2:229438090-229438112 CAGCATCAATTTCAAAGAAGTGG + Intronic
947686878 2:232095372-232095394 TGTTATCAGTTTCAAATAATGGG - Intronic
947917389 2:233842017-233842039 TGTCATCATCTTCAAAGGGCTGG + Exonic
1168744039 20:221146-221168 TGTCATCAGTTTAAAATAAGTGG + Intergenic
1168899731 20:1352889-1352911 TGTCATCAGTTTAAAATAATGGG - Intronic
1169624136 20:7543133-7543155 TGTCATCAGTTTAAAATAATGGG + Intergenic
1170175651 20:13466350-13466372 TGTCATCAATGTCAAAATAAAGG - Intronic
1170231241 20:14049379-14049401 TGTTACCAGTTTGAAAGAACTGG + Intronic
1170863875 20:20135573-20135595 TGTCATCAGTTTAAAATAATGGG - Intronic
1170949977 20:20927608-20927630 TCTTCTCAATTTCAAAGAAGAGG + Intergenic
1172517706 20:35546699-35546721 TGTCAGCAGTGTCAAAGAATTGG + Intronic
1172825807 20:37784544-37784566 TGTCATCAGTTTAAAATAATGGG - Intronic
1174883787 20:54309312-54309334 TGTCTACATTTTTAAAGAACCGG + Intergenic
1176929717 21:14794428-14794450 TATAAACAATTTCAGAGAACAGG - Intergenic
1176939614 21:14908897-14908919 TATCATCAGTTTAAAATAACAGG - Intergenic
1177222026 21:18207289-18207311 TGTCATCAATTTAAAATAATGGG - Intronic
1178212080 21:30547113-30547135 TGTCATCAACTTAAAATAATGGG - Intronic
1179203607 21:39251354-39251376 TGTGACCAATTTCAAAGCAAAGG + Intronic
1180015104 21:45076554-45076576 TGTCATCAATTTCTCAGAGCTGG - Intronic
1182201675 22:28578183-28578205 TGTCATCAGTTTAAAATAATGGG - Intronic
1183502844 22:38191372-38191394 TATCATTAGTTTCTAAGAACAGG - Intronic
1184433480 22:44455536-44455558 TGTTTTCAGTTGCAAAGAACAGG - Intergenic
1184683087 22:46082976-46082998 AGTCGACAATTTCGAAGAACTGG + Intronic
1185371704 22:50463998-50464020 TTCCATCAAGTACAAAGAACAGG + Intronic
1203325682 22_KI270738v1_random:13733-13755 TGTCAAGAATTTGAAAGAAAAGG - Intergenic
950774676 3:15339126-15339148 TCTGATCCCTTTCAAAGAACTGG - Intronic
951016736 3:17740410-17740432 TGTCATAAATATCAAAGGACTGG + Intronic
951171886 3:19552236-19552258 TGTCATCAACTTAAAATAATAGG - Intergenic
951475032 3:23095968-23095990 TTTCATCAGGTTTAAAGAACAGG - Intergenic
951585975 3:24214955-24214977 TCAAATCAATTTCAAACAACAGG + Intronic
951854800 3:27183620-27183642 TGTCATTAATTTAAAAAAACAGG + Intronic
952008663 3:28873718-28873740 TGTCATCAGTTTAAAATAACAGG - Intergenic
952661354 3:35853137-35853159 TGACATCAATTGCAAAGTATTGG - Intergenic
952725980 3:36585018-36585040 TGTCATTAATTTAAAATAATGGG + Intergenic
954096233 3:48330983-48331005 TGTCATCAATATCACAGCATGGG + Intergenic
954918223 3:54166480-54166502 TGTCATTAATTTCAAGATACAGG + Intronic
955580694 3:60417613-60417635 TGTCATCATTCTCAATGATCAGG + Intronic
956174148 3:66457404-66457426 TCTCATCCATCTCACAGAACAGG + Intronic
956693267 3:71897457-71897479 TGTAATCAATTTGCAAGAAGTGG - Intergenic
956762774 3:72458590-72458612 TGTGATGAAGTACAAAGAACTGG - Intergenic
957167144 3:76689970-76689992 AGTAATCAATTTCAACGACCAGG - Intronic
957369449 3:79273434-79273456 TGTCATCAGTTTTAAATAATGGG + Intronic
957925673 3:86807357-86807379 TGTCATCAGTTTAAAATAATGGG + Intergenic
958052045 3:88360895-88360917 TGTCATCAGTTTAAAATAATTGG - Intergenic
958683058 3:97355450-97355472 TGTCATCAGTTTAAAATAATGGG + Intronic
958839710 3:99188917-99188939 TGTCATCAGTTTAAAATAATGGG + Intergenic
959191341 3:103115263-103115285 TGTCATCAGTTTAAAATAATAGG + Intergenic
959646056 3:108702781-108702803 TGTCATCAGTTTAAAATAATGGG - Intergenic
959717350 3:109447200-109447222 TGTCATAAATTTAAAATAATGGG + Intergenic
960035604 3:113099789-113099811 TGGCTTCAACTTCAAAGGACAGG - Intergenic
962015378 3:131434117-131434139 TGTCATCAGTTTAAAATAATGGG + Intergenic
962625441 3:137221225-137221247 TTACATAAATCTCAAAGAACAGG + Intergenic
962934453 3:140066982-140067004 TTTCATCAATCTCAACGAAGAGG + Intronic
963483678 3:145908062-145908084 TTTTATCTATTTCAAAGAAATGG - Intergenic
963996305 3:151713321-151713343 TGTCATCGATTTAAAACAATGGG + Intergenic
964258685 3:154809258-154809280 TGTCATCAGTTTAAAATAATGGG - Intergenic
964350125 3:155794308-155794330 TGTCATCGGTTTAAAATAACAGG + Intronic
965507094 3:169528734-169528756 TATCAAAACTTTCAAAGAACTGG + Intronic
965943891 3:174216767-174216789 AGTCATCAATTTCACATGACAGG - Intronic
967197267 3:187039241-187039263 CATCATCACCTTCAAAGAACTGG - Intronic
967696722 3:192541347-192541369 TGTCATTAATTTAAAATAATGGG - Intronic
968618003 4:1590246-1590268 TGTGATAAATTTCAAAGAATTGG - Intergenic
970379033 4:15487864-15487886 TGTCATCAGCTTAAAATAACTGG - Intronic
970432773 4:16003952-16003974 TGTCACCATTTTTAAAGAGCAGG + Intronic
970821636 4:20222837-20222859 TGTCATCAGTTTAAAATAATGGG - Intergenic
970837392 4:20426750-20426772 TATCATCATTATCAAATAACAGG - Intronic
970882027 4:20943829-20943851 TGTCAATAATTTGACAGAACTGG - Intronic
971174792 4:24271742-24271764 TGTTTTCCATTTTAAAGAACAGG - Intergenic
971828529 4:31659837-31659859 TGTCATCAATCTGAAATACCTGG - Intergenic
971937239 4:33167482-33167504 TTTCAACATTTTAAAAGAACAGG - Intergenic
972243613 4:37221260-37221282 TTACATCAATTTCACAGCACAGG - Intergenic
972435152 4:39026495-39026517 TTTCATCACTTTGACAGAACTGG - Intronic
972579535 4:40382856-40382878 TGTCATCAGTTTAAAATAATGGG + Intergenic
972663825 4:41144816-41144838 TGTCACTAAGTTAAAAGAACGGG + Intronic
972998457 4:44913583-44913605 TGTATTGTATTTCAAAGAACTGG - Intergenic
973540621 4:51931734-51931756 TGTCAGGGATCTCAAAGAACAGG + Intergenic
973763532 4:54142662-54142684 TGTCATCAGTTTGAAACAATGGG + Intronic
974285558 4:59862550-59862572 TGTCATCAATTTAAAATAAATGG - Intergenic
975285651 4:72616259-72616281 TGTCACCAGTTTAAAATAACGGG + Intergenic
975675033 4:76819001-76819023 TGTCATCAGTTTAAAATAATGGG - Intergenic
976161427 4:82203651-82203673 TGTCATCAGTTTAAAATAATGGG + Intergenic
976345971 4:84001745-84001767 TGTCATCAACTTTTTAGAACTGG - Intergenic
976453717 4:85221436-85221458 TGTCATCAGTTTAAAACAATGGG - Intergenic
976722340 4:88181096-88181118 TGTCATCAGTTTAAAAGAATGGG + Intronic
976908415 4:90268467-90268489 TGTCATCAGTTTAAAATAATGGG + Intronic
976982323 4:91246289-91246311 TGTCATCAGTTTAAAATAATGGG + Intronic
977037523 4:91973982-91974004 TGTCATCAGTTTAAAATAATTGG - Intergenic
977642666 4:99374732-99374754 TGTCATCAGTTTAAAATAATGGG - Intergenic
977937258 4:102821193-102821215 TTTCATTAATTTCAAAATACTGG + Intronic
978862992 4:113473182-113473204 TTACATCAATTTCACACAACTGG + Intronic
979111615 4:116764164-116764186 TGTCATCAGTTTAAAATAATGGG + Intergenic
979128977 4:117015553-117015575 TGTCATCAGTTTAAAATAATGGG + Intergenic
979564867 4:122143495-122143517 TGCCATCAATTTCAAATAATGGG - Intergenic
979913015 4:126394691-126394713 TGTCATTAATTTAAAATAATGGG - Intergenic
980146284 4:128988408-128988430 TGTCATCAGTTTAAAACAATTGG + Intronic
980442823 4:132870225-132870247 TGTCATCAGTTTAAAATAATGGG + Intergenic
980597126 4:134968893-134968915 TGTCATCACTTTAAAACAATTGG + Intergenic
980693237 4:136322658-136322680 TGTCATCAGTTTTAAATAATAGG + Intergenic
981317983 4:143360229-143360251 TCACATCAATTTTAAAAAACCGG + Intronic
981829174 4:148980549-148980571 AGTCATCATTCTCAAGGAACTGG + Intergenic
981870851 4:149484518-149484540 TGTCATCAGTTTAAAATAATGGG - Intergenic
982571252 4:157052896-157052918 TTTCATCAAGTTCAAAGTGCAGG + Intergenic
982658716 4:158180415-158180437 TGGCATCAATCTCATAGAGCTGG + Intergenic
984408711 4:179367868-179367890 TGTCCTGAATCTCAATGAACTGG - Intergenic
984778259 4:183503412-183503434 CGTCAACTATTTCAAAGGACTGG - Intergenic
986651005 5:9963373-9963395 TGTCAGGAATTTCAGAGACCAGG - Intergenic
988217186 5:28290040-28290062 TGTCCTCAGTTTCAAGGGACAGG + Intergenic
988386757 5:30575068-30575090 TGTCAACATTTTGAAAGAATGGG + Intergenic
988939666 5:36130352-36130374 TGTCATCAGTTTAAAATAACAGG + Intronic
989751073 5:44894655-44894677 TGTTATCAATTTAAAATAACTGG - Intergenic
989812266 5:45693528-45693550 TATTATCCATTTCAAAGAAATGG - Intronic
990393479 5:55352820-55352842 TGTCATCAGTTGCAAAGGCCAGG + Intronic
990793399 5:59510009-59510031 TTTCAACAATGTCAAAGAATAGG + Intronic
990795831 5:59539551-59539573 CTTCATCAAGTTCAAAGAAATGG - Intronic
990860625 5:60322892-60322914 TGTCAATAACTCCAAAGAACTGG + Intronic
991693436 5:69247796-69247818 TGTCATCAGTTTAAAATAATGGG - Intronic
991739145 5:69653153-69653175 TGTCTTCAATTTCACTGCACAGG + Intergenic
991759053 5:69903278-69903300 TGTCTTCAATTTCACTGCACAGG - Intergenic
991788283 5:70214844-70214866 TGTCTTCAATTTCACTGCACAGG + Intergenic
991790720 5:70232894-70232916 TGTCTTCAATTTCACTGCACAGG + Intergenic
991815471 5:70507981-70508003 TGTCTTCAATTTCACTGCACAGG + Intergenic
991818606 5:70529270-70529292 TGTCTTCAATTTCACTGCACAGG + Intergenic
991838282 5:70778344-70778366 TGTCTTCAATTTCACTGCACAGG - Intergenic
991880730 5:71215208-71215230 TGTCTTCAATTTCACTGCACAGG + Intergenic
991883167 5:71233229-71233251 TGTCTTCAATTTCACTGCACAGG + Intergenic
992045300 5:72882027-72882049 TATCAACAATTTCAAGGAAATGG - Intronic
992259791 5:74958247-74958269 TGTCATTACTTTCAAAGATGTGG - Intergenic
992531562 5:77657249-77657271 TGTCATCAGTTTAAAATAATGGG - Intergenic
994320033 5:98384305-98384327 TGTCATCAGTTTAAAATAATGGG - Intergenic
994344320 5:98666738-98666760 TGTCATCAGTTTTAAATAATGGG + Intergenic
994428513 5:99626018-99626040 TGTTATCAAGTTAAAATAACTGG - Intergenic
995310828 5:110708649-110708671 TGTCATCAGTTTAAAATAATGGG + Intronic
996303774 5:122022364-122022386 TTTTAGAAATTTCAAAGAACAGG + Exonic
996467191 5:123816542-123816564 TGTCTTCAAGTTAAAAGTACTGG - Intergenic
996763585 5:127011747-127011769 TGTTAACAATTTCAAACACCAGG + Intronic
997060068 5:130490402-130490424 TGTCATCAGTTTAAAATAACAGG + Intergenic
997076934 5:130690020-130690042 TGTTTTCAATTTCTAAGAACTGG - Intergenic
998570340 5:143251234-143251256 TGCCATCAGTTTCAAAGGACTGG - Intergenic
998784999 5:145699552-145699574 TTTCATCAATGTCAATGAGCAGG - Intronic
1000155244 5:158544499-158544521 TGTCAGCATTTACAAAGAAATGG - Intergenic
1000178247 5:158780101-158780123 TTTGATCAATTTGAAAGCACAGG + Intronic
1002986774 6:2197510-2197532 TGTCATCATTTTTATAGACCTGG - Intronic
1003224160 6:4189664-4189686 AGTCATCAATTTCAAACTGCAGG - Intergenic
1004479847 6:16008438-16008460 TTTCATTCATTTCTAAGAACGGG - Intergenic
1006553916 6:34849376-34849398 TGTCATCAGTTTAAAATAATGGG - Intronic
1007022158 6:38531778-38531800 TGTCATCAGTTTAAAATAATGGG + Intronic
1008100832 6:47389425-47389447 TGCCATCAATTTAAAATAATGGG - Intergenic
1009282251 6:61767691-61767713 TGTCATCAGTTTAAAATAATTGG - Intronic
1009671306 6:66754607-66754629 TATCATCAATGTCAAAGAAATGG + Intergenic
1009745090 6:67801573-67801595 TGTCATAAATTTAAAATAATGGG + Intergenic
1009847137 6:69148349-69148371 TGTCATCAGTTTAAAACAATGGG - Intronic
1009893881 6:69722612-69722634 TGTCATCAGTTTAAAATAATGGG + Intronic
1010717249 6:79243823-79243845 TGGCATCAATTTCAAAACCCAGG - Intergenic
1010772706 6:79849924-79849946 TGTCATCAACTTAAAATAATGGG + Intergenic
1010775630 6:79881587-79881609 TGCCATCAATTTAAAATAATGGG + Intergenic
1010837270 6:80604753-80604775 TGTCATCAGTTTAAAATAATGGG - Intergenic
1011520660 6:88201327-88201349 TGTCATCAGTTTAAAATAATGGG + Intergenic
1012800625 6:103822387-103822409 TGTCATCAGTTTAAAACAATGGG + Intergenic
1012903066 6:105030542-105030564 TGTATTGTATTTCAAAGAACAGG + Intronic
1013572457 6:111443058-111443080 TGTGATCAAATTCAAATAAAAGG - Intronic
1013908758 6:115248911-115248933 TGTCATCAGTTTAAAATAATGGG + Intergenic
1014332174 6:120082795-120082817 TGTGATAAATTTCTAAGCACTGG + Intergenic
1014542194 6:122690462-122690484 TGTCATCAGTTTAACATAACGGG - Intronic
1015618332 6:135103105-135103127 TGACACCCACTTCAAAGAACAGG - Intergenic
1015907607 6:138133414-138133436 TGTCATCAGTTTAAAATAATGGG - Intergenic
1016054344 6:139563714-139563736 TGTCATCAGTTTAAAATAATGGG - Intergenic
1017285146 6:152666185-152666207 TGTCATCAATTTAAAATAGATGG - Intergenic
1017302625 6:152880080-152880102 TCTCATTGGTTTCAAAGAACTGG - Intergenic
1017327594 6:153157799-153157821 TGTCATCACTTTCAAAGAGATGG - Intergenic
1017924395 6:158898337-158898359 TGTCATCAGTTTAAAATAATGGG - Intronic
1019044609 6:169134137-169134159 TTTCATCAGTTTAAAAGAATTGG + Intergenic
1019201188 6:170317447-170317469 AGTAGTAAATTTCAAAGAACTGG + Exonic
1021303991 7:19008974-19008996 TCTCATCAATGTGAAAGACCAGG - Intergenic
1021580198 7:22144249-22144271 TGTGTTCGCTTTCAAAGAACAGG - Intronic
1021884645 7:25126494-25126516 TGTCATCAGTTTAAAACAATGGG - Intergenic
1022366752 7:29728624-29728646 TGTCATCAGTTTAAAATAATGGG - Intergenic
1022405068 7:30081500-30081522 TGTAATCACTTTCCAAGAAGAGG + Exonic
1022655863 7:32318974-32318996 TCTCATCATTTCAAAAGAACCGG + Intergenic
1022749659 7:33211379-33211401 TGTCATCAATTTAAAATAATGGG - Intronic
1023006980 7:35881355-35881377 TGTGACCAATTTGAAAGAAGAGG - Intronic
1023234836 7:38074120-38074142 TGTCAGCTTTTTCAAAGATCAGG + Intergenic
1023716426 7:43048428-43048450 TGTCATCAGTTTAAAATAATGGG + Intergenic
1024368840 7:48557009-48557031 TGTCATCAATTTAAAATAGTGGG - Intronic
1024724989 7:52183823-52183845 TGGCATCTTTATCAAAGAACAGG + Intergenic
1024956733 7:54928927-54928949 TGTCATCAGTTTCAAATAATGGG + Intergenic
1025617275 7:63131817-63131839 TGTCATCAGTTTAAAATAATGGG + Intergenic
1027405127 7:77852431-77852453 TGTCATCAGTTTAAAACAATGGG - Intronic
1027605115 7:80290310-80290332 TGTCATCAATTTAAAATAAAGGG + Intergenic
1028186468 7:87791637-87791659 TGTCATCAGTTTAAAATAATGGG + Intronic
1028950344 7:96628457-96628479 TGTCATCAGTTTAAAATAATGGG - Intronic
1028972912 7:96878630-96878652 TGTCATCCATTTAAAATAATAGG + Intergenic
1029825526 7:103188929-103188951 TGTCATCAGTTTAAAATAATGGG + Intergenic
1030345778 7:108431480-108431502 TGGCATCAAATTCACAGGACTGG + Intronic
1030506412 7:110429487-110429509 TGTCATTAATCTCAGAAAACAGG + Intergenic
1031044484 7:116872613-116872635 TGTCATAAAGTTCAAAAAAGTGG + Intronic
1031263518 7:119553246-119553268 TATCAGCATTTTCAAAGATCAGG - Intergenic
1031272408 7:119668248-119668270 TGTCATCAGTTTAAAATAACAGG + Intergenic
1031407290 7:121401447-121401469 TGTGAACAATTTCAAGGAAAGGG - Intergenic
1031412291 7:121454603-121454625 TGTCATCAGTTTTAAATAATGGG - Intergenic
1032138520 7:129305104-129305126 TGTCATCAGTTTAAAATAATGGG - Intronic
1032939396 7:136771160-136771182 TGTCATCAGTTTAAAATAATGGG + Intergenic
1033542535 7:142370424-142370446 TGTCAATAATATCAAAGAACAGG - Intergenic
1033837541 7:145333984-145334006 TGTCATTTTTTTCACAGAACTGG + Intergenic
1034249413 7:149676287-149676309 TGTCATCAACATCAAAGCATGGG - Intergenic
1034526228 7:151664581-151664603 TGTCACCAATTTCAAAGCCAGGG - Intronic
1034752111 7:153578827-153578849 TGTCATCAGTTTTAAATAATGGG + Intergenic
1035753816 8:2015719-2015741 TGTCATCAGTTTAAAATAATGGG - Intergenic
1035961985 8:4147670-4147692 TGTCAGATATTTCAAAGAATGGG - Intronic
1036100011 8:5770289-5770311 TGTCATCAGTTTGAAATAATGGG - Intergenic
1036985735 8:13528291-13528313 TTTCATGAATTTCAATGACCAGG + Intergenic
1037406514 8:18548319-18548341 AGTAACCAATTTCAAAGAAATGG - Intronic
1039190252 8:34965543-34965565 TGGAATCAAATTCAAAGAATGGG + Intergenic
1039368360 8:36957416-36957438 AGTCATCAATTACAAGAAACAGG - Intergenic
1040808150 8:51418704-51418726 TTTCATTAACTTCAAAGAAAAGG + Intronic
1041549317 8:59081730-59081752 TGGCATCAAGTTCAAAGAGATGG + Intronic
1042829797 8:73014460-73014482 TGGCATCAAGTTCAAATAAAAGG - Intronic
1042967182 8:74366454-74366476 TGTAATCCCTTTCAAAGCACTGG - Exonic
1043144904 8:76641155-76641177 TGTCATCAGTTTAAAATAATAGG + Intergenic
1043311791 8:78869832-78869854 TGTCATCAGTTTAAAATAATGGG - Intergenic
1043567558 8:81564611-81564633 TGTCATCAGTTTAAAATAATGGG + Intergenic
1044689423 8:94861906-94861928 TGTCTGAAATTTCAAAGAAAAGG - Intronic
1045838245 8:106548945-106548967 TGTGATCAATTTCAGTGAAAGGG - Intronic
1046778220 8:118186571-118186593 AGTCATCAATTTCACAGCCCTGG + Intergenic
1046811350 8:118536578-118536600 TGTCATCAGTTTAAAATAATGGG - Intronic
1047183727 8:122613611-122613633 TTCCATCAATTTCAAAGAAGAGG - Intergenic
1047456263 8:125015596-125015618 TGTCATCAGTTTAAAATAATCGG - Intronic
1047910345 8:129521014-129521036 TGTCATCAGTTTAAAATAATGGG + Intergenic
1047937115 8:129792907-129792929 TGTCATCAGTTTAAAATAATGGG - Intergenic
1048198951 8:132355512-132355534 TCTCATCAATTTCCAGGAAAGGG - Intronic
1048646932 8:136431432-136431454 TGTCATAAATTTAAAATAATAGG + Intergenic
1048911432 8:139139155-139139177 TGTTATAGACTTCAAAGAACAGG + Intergenic
1051047450 9:12891468-12891490 TGTCATCAGTTTAAAATAATGGG + Intergenic
1051449165 9:17176920-17176942 TGTTATCAATATCAAGAAACAGG - Intronic
1051965927 9:22829808-22829830 TGCCATCAGTTTAAAATAACAGG - Intergenic
1052752853 9:32509539-32509561 TATCATCAATATCAACGAAAAGG + Intronic
1055157723 9:73084775-73084797 AGTCATTAATTTAAAAGAAAGGG - Intergenic
1055684010 9:78751056-78751078 TGTTATCAGCTTGAAAGAACTGG - Intergenic
1056334556 9:85554216-85554238 TTTCAGCAATTTCAAAGGATTGG + Intronic
1056339058 9:85605823-85605845 TGTCATCAGTTTAAAATAATGGG + Intronic
1056516956 9:87361761-87361783 TGTCATCAGTTTAAAATAATTGG + Intergenic
1057288846 9:93786625-93786647 TGTCATCAGTTTAAAATAATGGG - Intergenic
1058589474 9:106547270-106547292 TGTCAGCTATATCAAGGAACAGG + Intergenic
1059041997 9:110824969-110824991 TGTCATCACTTTAAAATAATAGG + Intergenic
1059555188 9:115273657-115273679 TGTCATCAGTTTAAAATAATGGG - Intronic
1060166427 9:121420508-121420530 TGTCATCAGTTTAAAATAATGGG - Intergenic
1061638474 9:131930935-131930957 TGTCATCAGTTTAAAATAACAGG + Intronic
1062609163 9:137366106-137366128 TGTCAGCAATTACAGAGAAAAGG - Intronic
1187836888 X:23440513-23440535 TGTCATCACTTTAAAATAATGGG + Intergenic
1188161629 X:26812092-26812114 TGTCATCACTTTAAAATAATGGG - Intergenic
1188528420 X:31111430-31111452 TGTCATCACTTTAAAGGCACAGG + Intronic
1188992526 X:36839837-36839859 TGTCATCAGTTTAAAATAATGGG + Intergenic
1189013219 X:37068478-37068500 TGTCATCAGTTTAAAATAATGGG - Intergenic
1189053791 X:37676686-37676708 TATCACTAATTTCAAAGATCAGG + Exonic
1189405953 X:40723305-40723327 TGTCATCAGTTTAAAATAATGGG + Intronic
1190038095 X:47044853-47044875 TGTCATCAGTTTAAAATAATGGG + Intronic
1190978828 X:55436101-55436123 TGTCATCACTTTAAAATAATGGG + Intergenic
1191646826 X:63490751-63490773 TGTCATCAGTTTTAAGTAACAGG + Intergenic
1191811590 X:65195378-65195400 TGTCATCAATTTAAAATAATGGG - Intergenic
1192135324 X:68591801-68591823 TGTCATCAGTTTAAAATAATGGG + Intergenic
1192790471 X:74377779-74377801 TGTCATCAGTTTAAAATAATGGG - Intergenic
1192891136 X:75392022-75392044 TGTCATCAGTTTAAAATAATGGG + Intronic
1192971134 X:76231867-76231889 TGTCATCAATTTAAAATGATGGG + Intergenic
1192986179 X:76401117-76401139 TGTCATCAGTTTGAAATAATTGG + Intergenic
1193163347 X:78254760-78254782 TGTCATCAGTTTAAAATAATGGG - Intergenic
1193192951 X:78594642-78594664 TGTCATCAGTTTAAAATAATGGG - Intergenic
1193205633 X:78744604-78744626 TGCCAACAATATCAAAGGACTGG - Intergenic
1193310586 X:80004655-80004677 TGTCAGCAATTTCAAAAGAATGG + Intergenic
1193676282 X:84456309-84456331 TGTCATCAGTTTCAAATAATGGG + Intronic
1193894038 X:87088572-87088594 TGTTATCAAATTAAAATAACGGG + Intergenic
1193897826 X:87135020-87135042 TGTCATCAGTTTAAAATAATAGG + Intergenic
1194096072 X:89640359-89640381 TGTCATCAGTTTAAAATAATGGG + Intergenic
1194327506 X:92538586-92538608 TGTCATCAGTTTAAAATAATGGG - Intronic
1194336449 X:92653260-92653282 TGTAATGAATTTCAAAGAAATGG + Intergenic
1194415669 X:93608571-93608593 TGTCATCAGTTTAAAATAATGGG + Intergenic
1195312552 X:103645893-103645915 TGTCATCAGTTTAAAATAATGGG + Intergenic
1195396362 X:104414631-104414653 TTTCATCAATTTAAAGGAATAGG + Intergenic
1195489173 X:105446613-105446635 TGTCATCAGTTTAAAATAATGGG - Intronic
1196163198 X:112508861-112508883 TGTCATCAGTTTAAAATAATAGG - Intergenic
1196269193 X:113691095-113691117 TGTCATCAGTTTAAAATAATAGG - Intergenic
1196289900 X:113927761-113927783 TTTCATCCATTTAAAATAACTGG - Intergenic
1196473318 X:116053166-116053188 TGTCATCAGTTTAAAATAATGGG - Intergenic
1196982985 X:121236479-121236501 TGTCATTAATTTAAAATAATGGG - Intergenic
1197511067 X:127370005-127370027 GGTCATCAATGTTAAAGACCAGG - Intergenic
1197670422 X:129271156-129271178 TGTCATCAGTTTAAAACAATAGG - Intergenic
1198695099 X:139327289-139327311 TGTCATCAGTTTAAAATAATAGG + Intergenic
1198964423 X:142212547-142212569 TGTTATCAGTTTAAAATAACGGG - Intergenic
1199037253 X:143066030-143066052 TGTCATCAGTTTAAAATAATGGG + Intergenic
1199165939 X:144675290-144675312 TGTCATCAGGTACAAAGAGCTGG + Intergenic
1199485358 X:148340996-148341018 TGTCATCAGTTTAAAACAATTGG + Intergenic
1199795781 X:151194809-151194831 TGTCATCACTTTCAAATAATGGG + Intergenic
1200636221 Y:5657804-5657826 TGTCATCAGTTTAAAATAATGGG - Intronic
1200644878 Y:5770008-5770030 TGTAATAAATTTCAAAAAAATGG + Intergenic
1201780691 Y:17718364-17718386 TGTTATCAATTTCATATAAAAGG - Intergenic
1201820862 Y:18187626-18187648 TGTTATCAATTTCATATAAAAGG + Intergenic