ID: 1103074952

View in Genome Browser
Species Human (GRCh38)
Location 12:117974561-117974583
Sequence CCTTCACCTGCTCTCCGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103074952_1103074955 7 Left 1103074952 12:117974561-117974583 CCTCAACGGAGAGCAGGTGAAGG No data
Right 1103074955 12:117974591-117974613 ATGCCCTACTGTGTCCTGCCAGG No data
1103074952_1103074958 17 Left 1103074952 12:117974561-117974583 CCTCAACGGAGAGCAGGTGAAGG No data
Right 1103074958 12:117974601-117974623 GTGTCCTGCCAGGCACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103074952 Original CRISPR CCTTCACCTGCTCTCCGTTG AGG (reversed) Intergenic
No off target data available for this crispr