ID: 1103075350

View in Genome Browser
Species Human (GRCh38)
Location 12:117977971-117977993
Sequence TAAAAAGCACACATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103075349_1103075350 -2 Left 1103075349 12:117977950-117977972 CCACAGCAATGGCATACTTCTTA No data
Right 1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103075350 Original CRISPR TAAAAAGCACACATGCAGCC AGG Intergenic
No off target data available for this crispr