ID: 1103089681

View in Genome Browser
Species Human (GRCh38)
Location 12:118088846-118088868
Sequence CTGTGCTGTGATTCATAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103089681_1103089685 10 Left 1103089681 12:118088846-118088868 CCATACTATGAATCACAGCACAG 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1103089685 12:118088879-118088901 ATGCACAGGACTTCCCTGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 202
1103089681_1103089688 28 Left 1103089681 12:118088846-118088868 CCATACTATGAATCACAGCACAG 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1103089688 12:118088897-118088919 GAGGGAGTACAAAGTGCCACTGG 0: 1
1: 0
2: 2
3: 11
4: 168
1103089681_1103089684 9 Left 1103089681 12:118088846-118088868 CCATACTATGAATCACAGCACAG 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1103089684 12:118088878-118088900 CATGCACAGGACTTCCCTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 199
1103089681_1103089683 6 Left 1103089681 12:118088846-118088868 CCATACTATGAATCACAGCACAG 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1103089683 12:118088875-118088897 AGACATGCACAGGACTTCCCTGG 0: 1
1: 0
2: 2
3: 23
4: 209
1103089681_1103089682 -4 Left 1103089681 12:118088846-118088868 CCATACTATGAATCACAGCACAG 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1103089682 12:118088865-118088887 ACAGTAACTAAGACATGCACAGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103089681 Original CRISPR CTGTGCTGTGATTCATAGTA TGG (reversed) Intronic
900361704 1:2292335-2292357 CTGAGCTGTGCTGCATGGTAGGG + Intronic
900750184 1:4390765-4390787 CTGTGCTGGGATTCCTAAAACGG + Intergenic
905953791 1:41975182-41975204 CTGTGATGTTATTCACAGTGAGG - Intronic
907794984 1:57707371-57707393 CTGTGTAGTATTTCATAGTACGG + Intronic
907987954 1:59551668-59551690 CTGGGCTGTGATTCACATTCAGG - Intronic
909626451 1:77721568-77721590 CTGTTCTGAGATCCATAGAAGGG - Intronic
910708455 1:90154671-90154693 CTGTGATGTGATTCATCTTCAGG + Intergenic
911513952 1:98844081-98844103 CTGTTCTATCATTCATAGTTGGG + Intergenic
913525270 1:119685619-119685641 CTGTGTAGTGTTTCATCGTATGG + Intronic
917978168 1:180253349-180253371 CTGTGCTGTGCTCCAGAGGAAGG - Intronic
921788505 1:219262674-219262696 CTGTGATGTGATTCATCTTCAGG + Intergenic
1065219688 10:23483667-23483689 CTGTTCTGTTTTTCATAGTTTGG + Intergenic
1067341010 10:45403691-45403713 CTGTGCTGTGGGTCATGTTAAGG + Intronic
1068304801 10:55194561-55194583 CTGTGCTTTCATTCAAAGCAAGG + Intronic
1068731549 10:60363737-60363759 TTGTTCTGTGATTCATGTTAAGG - Intronic
1070897791 10:79999876-79999898 CTATGCTGTGGTTAAAAGTAAGG + Intergenic
1072007050 10:91261952-91261974 CTATGCTGTGATTAATATCAGGG - Intronic
1072379469 10:94852612-94852634 CTGTTCGGTGAATCATAGGAGGG - Intronic
1072649051 10:97279355-97279377 CTGTGCAATGTTTTATAGTATGG + Intronic
1074781576 10:116806149-116806171 CTGTGCTGTCACTCATGCTAGGG - Intergenic
1076018515 10:127050033-127050055 CTGTGCAGTATTTCATTGTAGGG + Intronic
1076771320 10:132666915-132666937 GTGTGCTGGGAATCATAGGAGGG + Intronic
1079613418 11:22461241-22461263 CTTTTCTGTGATTCCCAGTAGGG - Intergenic
1081565043 11:44255268-44255290 CTGAGCTGTATTTCATTGTATGG - Intergenic
1085943236 11:81231567-81231589 CTGTGATGACATACATAGTACGG - Intergenic
1087987808 11:104706600-104706622 CTGTGATGTGCATCATATTATGG - Intergenic
1091380863 12:57724-57746 CTGTGATGTGATTCATCTTCAGG - Intergenic
1093469121 12:19482247-19482269 CTGTGATGTGATTCATCTTCAGG + Intronic
1093506761 12:19875708-19875730 CATTGCCTTGATTCATAGTAAGG - Intergenic
1095357385 12:41291895-41291917 CTGTGCTGAGACTCCTAGTAAGG - Intronic
1095510678 12:42948646-42948668 CTGTCTTGTGTGTCATAGTAAGG - Intergenic
1095587942 12:43869399-43869421 CAGAGATGTGATTCATAGTAAGG + Intronic
1095775467 12:46004783-46004805 CTGTGTTGTGATTCTTCGAATGG + Intergenic
1098017130 12:66117499-66117521 CTGTGCTGTCAGTCATATAAAGG + Exonic
1098942434 12:76552932-76552954 CAGTGCTGTGCATCATAGTGTGG - Intronic
1099066974 12:77993132-77993154 CTGTGCTAAGATTTATATTATGG + Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102766838 12:115440677-115440699 CTTTGCTCTGAGTCATGGTATGG - Intergenic
1103089681 12:118088846-118088868 CTGTGCTGTGATTCATAGTATGG - Intronic
1106423921 13:29607656-29607678 GTTTGCTGTGATTCACAGCATGG + Intergenic
1107516095 13:41131421-41131443 CTCTGCTGTGATCCATACTCGGG - Exonic
1108712815 13:53050567-53050589 CTGTTCTGGTGTTCATAGTACGG - Exonic
1109748628 13:66660343-66660365 CAGTGCAGTGATTCATTATAAGG - Intronic
1110960844 13:81623309-81623331 CTGTCCTGTGCCTCATAGGATGG + Intergenic
1112566830 13:100559083-100559105 CTGTGCTCTGACTCATAAAATGG - Intronic
1114017238 14:18442015-18442037 GTGTGCTGGAATTCATAGTGAGG + Intergenic
1114730412 14:24987048-24987070 CTGTGCAGTGTTTGATAGGAAGG + Intronic
1116018593 14:39434524-39434546 CTGAGCTATGATTCAGAGTGTGG + Intergenic
1116611239 14:47074809-47074831 CTGTGCTGAGATACAGACTATGG - Intronic
1116895432 14:50311475-50311497 GTGTCCTGTGATTTATAGTTTGG - Intronic
1117619254 14:57567758-57567780 CTCTGCTGAGCTCCATAGTATGG + Intronic
1117824851 14:59690737-59690759 CTGTACTGTGGTCCAGAGTATGG - Intronic
1119565930 14:75629497-75629519 CTTTGGTGTGTTTCACAGTAGGG + Intronic
1119565943 14:75629570-75629592 CTCTGGTGTGTTTCACAGTAGGG + Intronic
1119591743 14:75895306-75895328 GTGAGCTGTGATTCATAATTGGG - Intronic
1121848382 14:97196077-97196099 CTGTGCTGTGATCCATCTTTAGG + Intergenic
1128628385 15:69236124-69236146 CTGTGTTGTGTTCCATTGTATGG + Intronic
1128831219 15:70770961-70770983 ATTTGCTGTGATTCATATTTGGG - Intergenic
1131146519 15:90017275-90017297 CTGTGCTGTTTTTCAAAGTAGGG + Intronic
1133349546 16:5092413-5092435 CTGCCCTGTGAATCATAGGACGG - Intronic
1135679308 16:24443191-24443213 ATCTGTTGTTATTCATAGTAAGG + Intergenic
1136286890 16:29249431-29249453 CTGAGCTGAGATCCACAGTAAGG + Intergenic
1139668167 16:68472697-68472719 CTGGGCTGTGATGCACAGCATGG + Intergenic
1139764811 16:69218811-69218833 TTGTTCTGTTATTCATAATAAGG + Intronic
1140924094 16:79566359-79566381 CTGGGCTGGGATTCACAGCAGGG + Intergenic
1142092490 16:88222066-88222088 CTGAGCTGAGATCCACAGTAAGG + Intergenic
1142382473 16:89740908-89740930 CTGTGCTGTCATTCTAAATAAGG + Intronic
1143666698 17:8366317-8366339 CTGGGCCATGATTCAGAGTAAGG - Intergenic
1146983328 17:37187204-37187226 TTGTGCTTTGATTCCTAGTGAGG - Intronic
1150141989 17:62737985-62738007 CTGTGTAGGAATTCATAGTAGGG - Intronic
1154310129 18:13260909-13260931 CTGGGCTGGGATTCAGAGCAGGG + Intronic
1157858738 18:51122969-51122991 CTGTGCTGAGATTCATACACAGG - Intergenic
1160255217 18:77243013-77243035 GTCTGCTGTGTTTCAGAGTATGG + Intergenic
1161909995 19:7186262-7186284 CTGTGCTGAGAATCACAGTCTGG - Intronic
1163106862 19:15128602-15128624 CTGAGCAGTGTTTCATGGTATGG - Intergenic
1167669741 19:50843847-50843869 CTGTGATGTGATTCATCTTCAGG + Intergenic
926075175 2:9936948-9936970 CTGAGCAGTGTTTCATTGTATGG - Intergenic
926536997 2:14125329-14125351 CTGTTCTGTCATTTATAGCATGG - Intergenic
935268780 2:101416066-101416088 CTGTGCAGTCATTCACAGTTTGG - Intronic
936979842 2:118254397-118254419 CTCTGTTGGGATTAATAGTAAGG - Intergenic
937032090 2:118749370-118749392 CTGTGTGATGATTCATCGTATGG + Intergenic
939071341 2:137547796-137547818 CTCTGATGTGCTTCAGAGTAGGG + Intronic
944887134 2:204074652-204074674 CTGTCCTCTGATTCATAGACTGG + Intergenic
1173856233 20:46252167-46252189 CTGTGCTGCGATGGATAGGAAGG - Intronic
1174690095 20:52495604-52495626 TTGGACTGTGATTCACAGTAAGG + Intergenic
1174863025 20:54110476-54110498 CTGTGGTGTGATGCATATCAGGG + Intergenic
1176223762 20:63982573-63982595 CTGTGATGGGAGTCATAGTCTGG + Intronic
1180441745 22:15372884-15372906 GTGTGCTGGAATTCATAGTGAGG + Intergenic
1182032839 22:27173693-27173715 CAGTGCTGTGACTCATGGGAGGG - Intergenic
949145974 3:700701-700723 CTGTGATGTGATTCATCTTCAGG + Intergenic
951302606 3:21017228-21017250 CTGTGATGTGATCCATCGTCAGG + Intergenic
952044717 3:29304760-29304782 ATGTGCTGTGTTTCATAGTGGGG + Intronic
954386166 3:50245297-50245319 CAGTGCCGTGATTCTTAGCATGG + Intronic
956114207 3:65902529-65902551 TTCTGCTGTGATTCTTAGGAGGG - Intronic
956184860 3:66552779-66552801 CTGTGCTGTTCTTCCTAATAAGG + Intergenic
957270851 3:78028491-78028513 CTTTGCTTTGCTTGATAGTAAGG + Intergenic
959125847 3:102290012-102290034 CTGTGATGTGATTCATCTTCAGG + Intronic
962034505 3:131636840-131636862 CTGTGATGTGATTCATCTTCAGG - Intronic
965429087 3:168564467-168564489 CTGTGCTTTGATTTTCAGTAGGG + Intergenic
966635124 3:182124385-182124407 TTGTGCAGTGATTCAGTGTAGGG + Intergenic
966890502 3:184404358-184404380 CTGAGCTGGGATTCAAAGGAAGG + Intronic
967385121 3:188903602-188903624 CTCTGCTGTGCTCCATAGCATGG + Intergenic
968788181 4:2640158-2640180 CTGTGGTGTGGTTCATGCTATGG + Intronic
969897057 4:10315273-10315295 GTGTGCTGAGCTTCATATTATGG + Intergenic
970525900 4:16931708-16931730 CTGACCTGTAATTTATAGTATGG - Intergenic
970835671 4:20403279-20403301 CTGAGCAATGATTCATTGTAAGG - Intronic
971994268 4:33943866-33943888 CTGTGCAGTGGTTTATAGTCTGG + Intergenic
973273972 4:48289529-48289551 GTGTGCTGTGTATCATACTAAGG + Intergenic
976766161 4:88599947-88599969 CTATGCTGTGCTGTATAGTAAGG - Intronic
977295717 4:95206690-95206712 CTGCGCAGTGATGCATAGTGAGG + Exonic
978196452 4:105978070-105978092 CAGTGCTGGGATTCAAACTAGGG + Intronic
979876787 4:125901977-125901999 CTGTGGTGTGAATCAGAGCATGG - Intergenic
981417209 4:144507173-144507195 CTGTGCTGTGGTTCACAGGATGG - Intergenic
981796477 4:148600843-148600865 CTGTGATGTGATTCATCTTCAGG + Intergenic
983582667 4:169324735-169324757 CTCTGCTGTGATTCAACCTATGG - Intergenic
986561964 5:9069273-9069295 CAGTCCTGTGATTCTTAGAAAGG - Intronic
988485394 5:31664586-31664608 CTGTCTTGTGATTCATACGACGG + Intronic
990748328 5:58983618-58983640 CTGTGCTGTGATTCACACAGAGG + Intronic
993323899 5:86510460-86510482 CTGTCCTGTGTTACATAGGATGG - Intergenic
996111776 5:119574024-119574046 CTGAGCTATGATTCCTAATATGG + Intronic
997312014 5:132894344-132894366 CTGTGCTATGATCAAAAGTATGG - Intronic
998391021 5:141787073-141787095 GTGTGCTGTGATTCATGGCTGGG - Intergenic
998758667 5:145407951-145407973 CTGTGATGTGATTCATCTTCAGG - Intergenic
999185336 5:149703211-149703233 CTGTGGTGTGATGCATAGGTGGG - Intergenic
1001186726 5:169581089-169581111 GAGTGCTGTGATTTATAGGATGG - Intergenic
1003712889 6:8613511-8613533 CTGTGCTGTGATGCCCAGAAGGG + Intergenic
1007944348 6:45811988-45812010 GTGGGCTGTGATTCAGAGCAGGG + Intergenic
1008579658 6:52895490-52895512 CTGTGCTGTGATTACGGGTATGG - Intronic
1010358511 6:74965117-74965139 CTGTGATGTGATTCATCTTCAGG + Intergenic
1011156569 6:84340471-84340493 CTGTGATGTGATCCATCTTAAGG + Intergenic
1011305228 6:85918251-85918273 CTGTGATGTGAATCATACAAAGG - Intergenic
1014425078 6:121294313-121294335 CAGTTCTTTGATTCATACTAGGG - Intronic
1014792708 6:125692971-125692993 CTGTGATGTGATCCATATTCGGG + Intergenic
1015198304 6:130549036-130549058 TAGTGCTGTGGTTCTTAGTATGG + Intergenic
1015348849 6:132193166-132193188 CTGTGCTGTAAGTCAGAGCACGG - Intergenic
1015559779 6:134502177-134502199 TTGTGCTGTGATTCTCAGGAAGG - Intergenic
1017636132 6:156444733-156444755 ATGGGGTGTGATTGATAGTATGG - Intergenic
1018951712 6:168382630-168382652 CTGTGCTGGGATTCAAAGCCAGG + Intergenic
1019823912 7:3267725-3267747 CTTTGCTTTGATTCCTATTATGG - Intergenic
1021340176 7:19455418-19455440 CTGTGATGTGATTCATCTTCAGG + Intergenic
1022925480 7:35052260-35052282 ATGGGCTGTGATTCTTAGCATGG - Intergenic
1025066688 7:55862878-55862900 CTGTGCTGTGTTCAAAAGTAGGG - Intergenic
1026724832 7:72863229-72863251 CAGTGATGTGCTTCATAGCAAGG + Intergenic
1028503989 7:91551483-91551505 TAATGCTGTGAATCATAGTAAGG - Intergenic
1028822637 7:95229965-95229987 CTGTGATGTGATTCATCTTCAGG - Intronic
1029858957 7:103548775-103548797 CTGTGCTGTGTTTCCACGTAAGG - Intronic
1033717836 7:144021319-144021341 CTGTGCTGTGTATCATATAAAGG + Intergenic
1035906418 8:3515239-3515261 CAGTGCTGTTATTTATATTAAGG - Intronic
1038682056 8:29677909-29677931 CTGTGCTGTGTTTCCTAGTACGG - Intergenic
1040399396 8:47033429-47033451 CTGTGATGTGATTCATCTTCAGG + Intergenic
1040523814 8:48200531-48200553 CTGTTCTGTGATTAATGATACGG + Intergenic
1041832105 8:62165350-62165372 CTGTGATGTGATTCATCTTCAGG - Intergenic
1043448462 8:80342171-80342193 CTGTCTTGTTTTTCATAGTATGG + Intergenic
1046673155 8:117079681-117079703 CAGTGCTGGGCTTCATAGTCTGG - Intronic
1046793789 8:118348738-118348760 CCTTCCTGTGATTCATAGCACGG - Intronic
1051247345 9:15125190-15125212 CTCAGCTGTAATTCATAGAAGGG + Intergenic
1055137974 9:72844684-72844706 CTGTGATGTGATTCATCTTCAGG - Intergenic
1056758172 9:89395729-89395751 CTGGGGTGAGATTCATAGTAGGG - Intronic
1188701266 X:33267606-33267628 CTGTGGTGTGAATTATTGTAGGG - Intronic
1192054553 X:67760007-67760029 TTTTACTGTGACTCATAGTAAGG - Intergenic
1192667571 X:73103483-73103505 CTGTAATGTGATTCAAAGCAAGG + Intergenic
1192673946 X:73175328-73175350 CTGTGATGTGATTCATCTTCAGG + Intergenic
1192991780 X:76467208-76467230 CTGTGATGTGATTCATCTTCAGG + Intergenic
1194076356 X:89399646-89399668 CTGTGATGTGATTCATCTTTAGG + Intergenic
1194967141 X:100301319-100301341 CTTTACTGTGATTCAGAGTTTGG + Intronic
1195438512 X:104873965-104873987 CTGTTCTGGCATTCATAGCAAGG - Intronic
1196140763 X:112260881-112260903 CTTTGCTTTGATTCATAGGCAGG + Intergenic
1197081689 X:122426091-122426113 CTGTGATGTGATTCATCTTCGGG + Intergenic
1198217218 X:134566581-134566603 CTGTGCTGTGCTCCATAGACTGG - Exonic
1199768175 X:150955623-150955645 CTGTGCTGTCCTTCATGGAAAGG - Intergenic
1200428996 Y:3055166-3055188 CTGTGATGTGATTCATCTTTAGG + Intergenic
1201096511 Y:10624169-10624191 CTGTGCTTTGATTCCTATTGTGG - Intergenic