ID: 1103093673

View in Genome Browser
Species Human (GRCh38)
Location 12:118116079-118116101
Sequence GCTTAAGCATGTGCATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 1, 2: 39, 3: 129, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103093673_1103093677 7 Left 1103093673 12:118116079-118116101 CCTCTTCATGCACATGCTTAAGC 0: 1
1: 1
2: 39
3: 129
4: 339
Right 1103093677 12:118116109-118116131 CCCACCTCCTGAGATCTTACTGG 0: 2
1: 32
2: 177
3: 225
4: 344
1103093673_1103093679 8 Left 1103093673 12:118116079-118116101 CCTCTTCATGCACATGCTTAAGC 0: 1
1: 1
2: 39
3: 129
4: 339
Right 1103093679 12:118116110-118116132 CCACCTCCTGAGATCTTACTGGG 0: 1
1: 30
2: 146
3: 385
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103093673 Original CRISPR GCTTAAGCATGTGCATGAAG AGG (reversed) Intronic
901729251 1:11266978-11267000 GCTCAAGCATGGGCACTAAGAGG - Intergenic
902772196 1:18651839-18651861 GCCTCAGCAGGTGCATGAAGAGG - Intronic
902975059 1:20082450-20082472 GCTCACACATGTGCATGAAGAGG - Intronic
903309644 1:22444538-22444560 GTTCAAGCATGTGCACTAAGAGG + Intergenic
905466489 1:38158158-38158180 GCTCAAGTAAGTGCATGAACAGG + Intergenic
905485346 1:38292210-38292232 ACCTAAGCATATGTATGAAGCGG + Intergenic
905610312 1:39344767-39344789 GCTCAAGCATGCGCACTAAGAGG - Intronic
905690911 1:39941999-39942021 GGTCAAGCATGTGCACTAAGAGG - Intergenic
908384172 1:63625170-63625192 GCTGAAGAATGTGGAAGAAGTGG + Intronic
908489802 1:64632106-64632128 GCTAAAGGATGTGGATGTAGTGG - Intronic
909084333 1:71153909-71153931 GCTCAAGCACGTACATTAAGAGG + Intergenic
909099823 1:71336594-71336616 GCTCAAGCATGTGCATTAAGAGG - Intergenic
909100543 1:71342979-71343001 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
910024108 1:82628384-82628406 ACTCAAGCATGCGCATTAAGAGG - Intergenic
910365444 1:86460254-86460276 GCTCAAGCATGTGCACTAAGAGG - Intergenic
910486130 1:87716344-87716366 GCTTAGGCTTGTGCATGACTAGG + Intergenic
911854429 1:102858983-102859005 GCTCAAGCATGTGCACTAAGAGG + Intergenic
912940146 1:114037547-114037569 GCTCAAGCATGTGCACTAAGAGG - Intergenic
913367024 1:118049990-118050012 GCTCAAATATGTGCATTAAGAGG + Intronic
913997105 1:143660637-143660659 ACTTAAACATGTGCATCAACTGG - Intergenic
914505149 1:148282149-148282171 ACTTAAGCATGTGCATCAACTGG + Intergenic
914507416 1:148301999-148302021 ACTTAAGCATGTGCATCAACTGG - Intergenic
915605043 1:156945120-156945142 TCTCAAGTATGTGAATGAAGCGG - Exonic
915641706 1:157232578-157232600 GCTTAAGCATGTGCATTAAGAGG - Intergenic
915666974 1:157453960-157453982 GCTCAAGCATATGCAGTAAGAGG + Intergenic
916816862 1:168362613-168362635 GCTCAAGCATGTGCATTAAGAGG + Intergenic
917103137 1:171465738-171465760 GCTCAAGCATGTTCACTAAGAGG - Intergenic
917314527 1:173710655-173710677 GCTCCAGCATGTGCATTAAAGGG - Intergenic
918264203 1:182825299-182825321 GCATAAGAATCTGCATGAAATGG - Intronic
918324501 1:183396447-183396469 GCTCAAGCATGTGCACTAAGAGG + Intronic
920132243 1:203741269-203741291 GCTGGAGCATGTGGCTGAAGCGG - Exonic
920521978 1:206634856-206634878 GCTTCCTCATGAGCATGAAGCGG - Intergenic
920798107 1:209160188-209160210 GCTCAAGCATGTGCACTAAGAGG - Intergenic
920832031 1:209474145-209474167 GCTCAAGCATGTACAGTAAGAGG + Intergenic
920861087 1:209707472-209707494 GCTTACTCATATGCATGAATGGG + Intronic
921294933 1:213692723-213692745 GCTCAAGCATGTGCATTAAGAGG - Intergenic
921522007 1:216167415-216167437 GCTCAAGCATGCGCACTAAGAGG + Intronic
922333758 1:224601399-224601421 GCTCAAGCATGTGCACTAAGCGG - Intronic
922334660 1:224608914-224608936 GCTCAAACATGTGCACTAAGAGG - Intronic
922337527 1:224629842-224629864 ACTTAAGCAAATGCATGAAGTGG - Intronic
922875348 1:228936056-228936078 GCTCAAGCATGCGCACTAAGAGG + Intergenic
923698493 1:236278488-236278510 GCTTTAGCAGTTGCATGGAGTGG - Intronic
923707537 1:236356781-236356803 GCTTAAGAATGTTCTTGATGAGG + Intronic
924144300 1:241058160-241058182 GCTCAAACATGTGCATTAAGAGG + Intronic
924194930 1:241596595-241596617 GCTCAAGAATGTGGAAGAAGAGG - Intronic
924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG + Intergenic
924812094 1:247412015-247412037 GCTTTAGCAGGTGGAAGAAGTGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1062956922 10:1546638-1546660 GCTTTAGCATCTGCCTTAAGGGG - Intronic
1062986755 10:1776324-1776346 ACTCAAGCATGTGCACTAAGAGG + Intergenic
1063018865 10:2105741-2105763 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
1063752339 10:8964588-8964610 GCATAAGCAAGTGCATAAAATGG + Intergenic
1065506462 10:26434720-26434742 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1066018135 10:31269173-31269195 GCGAAAGGATGTGCATGATGTGG + Intergenic
1066289362 10:33999702-33999724 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1067343827 10:45424062-45424084 ACTGGAACATGTGCATGAAGCGG - Exonic
1067893898 10:50159511-50159533 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1067954947 10:50780753-50780775 GCTGAAGCATGTGCATTAAGAGG - Intronic
1068497047 10:57795999-57796021 GCTAAAACATGTGCACTAAGAGG + Intergenic
1071155015 10:82678075-82678097 GCTCAAGCATGAGCACTAAGAGG - Intronic
1071409400 10:85374000-85374022 GCTCAAGCATGTGCCCTAAGAGG + Intergenic
1071828977 10:89353260-89353282 GCTCAAGCATGTGCACTAAGAGG + Intronic
1072520026 10:96223070-96223092 GCTCAAGCATGCGCATTAAGAGG + Intronic
1073360064 10:102891098-102891120 GCTCAAGCATGCACATTAAGAGG - Intronic
1073849562 10:107599062-107599084 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1073865108 10:107793630-107793652 GCTTAATTATCTGCATGAATGGG + Intergenic
1073931989 10:108586792-108586814 CCTCAAGCTTGTGCATTAAGAGG + Intergenic
1075021107 10:118953046-118953068 GCTTAGGCATCTGCTTGCAGGGG - Intergenic
1075240211 10:120771589-120771611 GCTCAAGCATGTACACTAAGAGG + Intergenic
1075347010 10:121690188-121690210 GCTGAAGCATTTGTATGAAAAGG - Intergenic
1075491576 10:122875817-122875839 GTTCAAGCATGTGCACTAAGAGG + Intronic
1078454660 11:11465656-11465678 GGTGAAGCAAGTGTATGAAGTGG - Intronic
1078819357 11:14862067-14862089 GCTCAAGCATGTGCACTAAGAGG - Intronic
1079234593 11:18679088-18679110 GCTCAAGCATGCACATTAAGAGG + Intergenic
1079328551 11:19514856-19514878 GCTGAAGCAGGGGCATGAGGAGG + Intronic
1079405944 11:20145845-20145867 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1080967878 11:37234691-37234713 GCTCAAGCATGTGCATTGAGAGG - Intergenic
1082908238 11:58337255-58337277 GCTGAAGCATGTACATGACCTGG + Intergenic
1082942773 11:58725989-58726011 GCTTAAGCATGTGCATTCAGAGG - Intronic
1085010712 11:73140393-73140415 GATTGAGCTTGTGCATGAAATGG - Intronic
1085751533 11:79166491-79166513 GCTTAAGAATATCCATGATGAGG + Intronic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1086303669 11:85457546-85457568 GCTTAAGCATGTTTTTGTAGTGG + Intronic
1086349608 11:85932450-85932472 GCTCAAGCATGTACATTGAGAGG - Intergenic
1086737066 11:90320058-90320080 GCTCAAGCATGTGCACTGAGAGG + Intergenic
1086974383 11:93115581-93115603 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1087066542 11:94032828-94032850 GCTCAAGCAAGTGCATTGAGGGG + Intronic
1087701873 11:101444102-101444124 GCTCAAGCATGCACATTAAGAGG + Intergenic
1089009855 11:115123401-115123423 GTTTAAATCTGTGCATGAAGAGG - Intergenic
1089574861 11:119434827-119434849 GCTTAAGCAATTGCATGCATGGG - Intergenic
1090980272 11:131714103-131714125 GCTTAAGCATGTGCCCTATGAGG - Intronic
1092974849 12:13734884-13734906 GCCTATGCAAATGCATGAAGGGG + Intronic
1094324407 12:29221160-29221182 GCTTGAGCATGCGCACTAAGAGG - Intronic
1097493725 12:60301490-60301512 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1098437768 12:70486186-70486208 GCTGAAGCATGTACATTAAGAGG + Intergenic
1099437474 12:82660969-82660991 GCTCAAGCATGTGCAGTAAGAGG - Intergenic
1100027395 12:90147175-90147197 GCTCAAGCAGGTGCACTAAGAGG + Intergenic
1100758364 12:97777281-97777303 GCTCAAGCATGTACACTAAGAGG + Intergenic
1101516838 12:105444135-105444157 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1101990561 12:109480762-109480784 GCTTCACCATGTGCATGCTGTGG + Intronic
1102905274 12:116669854-116669876 GCTCCAGCATGTGCATTAAGAGG - Intergenic
1103093673 12:118116079-118116101 GCTTAAGCATGTGCATGAAGAGG - Intronic
1106627602 13:31436501-31436523 GCTCCAGCATGTGCATTAAGAGG + Intergenic
1106891602 13:34252210-34252232 GCAGGAGCATGTGCATGCAGAGG + Intergenic
1107684733 13:42885689-42885711 GCTCAAGCATGTACATTAAGGGG - Intergenic
1107934714 13:45335917-45335939 GCTTGAACATGTGAATGTAGTGG - Exonic
1108718441 13:53105406-53105428 GCTCAAGCATGCACATTAAGAGG - Intergenic
1109661123 13:65462001-65462023 GCTCAAGCATGTGTATTAAGAGG - Intergenic
1109797402 13:67334476-67334498 GCTTGAGCATGTACATTAATAGG + Intergenic
1110930673 13:81212142-81212164 GCTAAAGCATGTGCATTACAAGG + Intergenic
1111122232 13:83868066-83868088 GCTCAAGCATGTACACTAAGAGG + Intergenic
1111127376 13:83929139-83929161 GCTCAAACATGTACATTAAGAGG + Intergenic
1111389767 13:87577910-87577932 GCTTCAGCATGTGAATTTAGAGG - Intergenic
1111934661 13:94546789-94546811 GCTGAAGCATGCGCACTAAGAGG + Intergenic
1113535845 13:111065764-111065786 GCTTAGGCCTGTGCACTAAGAGG + Intergenic
1114564679 14:23621651-23621673 GCTCAAGCATGCACATCAAGAGG + Intergenic
1114644602 14:24247967-24247989 GGCAAAGGATGTGCATGAAGAGG - Intergenic
1114878229 14:26750497-26750519 GCTCAAGCATGTGCACCAAGAGG + Intergenic
1115147143 14:30238994-30239016 GCTCAAGCATGTCCACTAAGAGG + Intergenic
1115336818 14:32250432-32250454 GCTCAAGCATTTGCACTAAGAGG - Intergenic
1116464151 14:45212638-45212660 GCTCAAGCATGTGCATTAAGAGG + Intronic
1116796467 14:49396135-49396157 GCTTATCCATGTCCCTGAAGAGG - Intergenic
1117099762 14:52334267-52334289 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1117528089 14:56631746-56631768 GCTCAAGCATGTGCACTAAGAGG - Intronic
1117543842 14:56774644-56774666 GATTAAGCAGGTGGATGGAGAGG - Intergenic
1117976221 14:61299401-61299423 GCTCAAGCATGTGCATTAGGAGG - Intronic
1119064809 14:71514420-71514442 CCTCAAGCATGTGCATTAAGAGG - Intronic
1119597084 14:75944842-75944864 GCTTGAGCATGTGCACTAAGAGG + Intronic
1119692549 14:76687825-76687847 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1119692907 14:76690865-76690887 GCTTCAGTATGTACTTGAAGTGG + Intergenic
1120525959 14:85577386-85577408 AGTTAAGCACATGCATGAAGAGG + Intronic
1120652797 14:87154961-87154983 GCCCAAGCATGTGCATTAAGAGG + Intergenic
1120705624 14:87742559-87742581 GATCAAGCAGGGGCATGAAGGGG + Intergenic
1121044241 14:90776349-90776371 GCTCAAGCATGCGCACTAAGGGG + Intronic
1121261875 14:92572365-92572387 GCTCAAGCATGAGCACTAAGAGG - Intronic
1121721561 14:96112469-96112491 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1121815079 14:96923051-96923073 GCTCAAGCATGTGCACTAACAGG + Intronic
1121891005 14:97590501-97590523 GCTTATGCATGGGCAGGAATTGG + Intergenic
1122630476 14:103105398-103105420 GTTTATGCATGTGCGTGTAGGGG + Intronic
1123126229 14:105948046-105948068 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123406738 15:20024100-20024122 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123516067 15:21030748-21030770 GCTCAAGCATATGCACTAAGAGG - Intergenic
1123825133 15:24073609-24073631 ACTCAACCATGTGCATTAAGAGG - Intergenic
1124821590 15:33051613-33051635 GCTCAAGCATGGGCATGAAGAGG + Intronic
1126899219 15:53294973-53294995 GCTTCATCACTTGCATGAAGTGG + Intergenic
1127226803 15:56939839-56939861 GCTCAAGGATGAGCAAGAAGTGG + Intronic
1128596649 15:68957829-68957851 GCTCAAGTATGTGCACTAAGAGG + Intronic
1128822330 15:70670166-70670188 GCTCAAGCATGCGCACTAAGAGG + Intronic
1128849884 15:70943698-70943720 GCTCAAGCATGTGCATTAAGAGG - Intronic
1129055830 15:72819594-72819616 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1129180458 15:73871155-73871177 GCTTAAGCTTGTGCGTCATGTGG - Intergenic
1129522527 15:76194885-76194907 GCTTCAACATGTGAATGAAGAGG + Intronic
1130058187 15:80547369-80547391 ACTTAAGAATGTCCCTGAAGAGG + Intronic
1130768331 15:86896943-86896965 CCTTAGGAATGTGCATGTAGTGG - Intronic
1131547805 15:93330499-93330521 GCTCCAGCATGTGCATTATGAGG - Intergenic
1131661665 15:94523958-94523980 GCACAAGCATGTTCACGAAGGGG - Intergenic
1132166913 15:99602457-99602479 GCTCCAGCATGCGCATTAAGAGG - Intronic
1132461202 16:55841-55863 GCTCAAGCAGGAGCGTGAAGGGG + Exonic
1132894226 16:2220312-2220334 GCTTAAGCAGAAGCAGGAAGGGG - Intergenic
1134135993 16:11676669-11676691 GCTTAAGCACGTGCTTCCAGGGG - Exonic
1134606815 16:15577871-15577893 GCTCAAGCATGCACATTAAGAGG - Intronic
1135042594 16:19129469-19129491 GCTCAAGCATGAGCTTTAAGAGG + Intronic
1136910016 16:34136921-34136943 GCTCATGCATATTCATGAAGGGG - Intergenic
1137671115 16:50279843-50279865 GCTTAACCAAATGAATGAAGTGG + Intronic
1137746237 16:50822278-50822300 GCTTAAGCATGAGCACTTAGAGG - Intergenic
1138711016 16:58970399-58970421 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1139099685 16:63750355-63750377 ACTCAAGCATGGGCATTAAGAGG - Intergenic
1140323547 16:73977796-73977818 GCTTAAGCATGCGCACTAAGAGG + Intergenic
1141119125 16:81337190-81337212 GCATAAGCAGGTAAATGAAGAGG + Intronic
1141251553 16:82363561-82363583 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1144777930 17:17794118-17794140 GATTGAGCAGGGGCATGAAGTGG - Exonic
1146823376 17:36002299-36002321 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1148657523 17:49298778-49298800 CCTTAAGCATGTTCGAGAAGCGG + Exonic
1149258072 17:54849600-54849622 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1149290797 17:55215831-55215853 GTTCAAGCATGTGCACTAAGAGG + Intergenic
1149304233 17:55333031-55333053 GCTCAAGCATGTGCGCTAAGAGG - Intergenic
1150513177 17:65777637-65777659 GATTAAGAATATTCATGAAGGGG - Intronic
1150616565 17:66776962-66776984 GCTCAAGCACGCGCATGAAAAGG - Intronic
1150907027 17:69348726-69348748 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1151051158 17:70979769-70979791 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1152125029 17:78441442-78441464 GCCTAAGCAGGTGCAGGGAGAGG + Intronic
1153101540 18:1476068-1476090 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1153227847 18:2911412-2911434 GCTCATGCATGTGCATTAAGAGG - Intronic
1153746054 18:8180740-8180762 GCTCAAGCATGTGCACTAAGAGG - Intronic
1154040722 18:10853033-10853055 GCTCAAGCATGTGCAGTAAGAGG + Intronic
1154044720 18:10894141-10894163 GCTCAAGCATGTGCATTAAGAGG + Intronic
1154112920 18:11585784-11585806 GCTCAAGCATGCGCACTAAGAGG + Intergenic
1154276031 18:12961245-12961267 GCTCAAGCATGTGCACTAAGAGG - Intronic
1155014405 18:21818511-21818533 GCTTCAGCATGTGCCAGGAGTGG + Intronic
1155939489 18:31789456-31789478 GCTCGAGCATGTGCACGAAGAGG + Intergenic
1156679984 18:39576594-39576616 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1156878424 18:42044866-42044888 GCTTAAGCATAGGCATAAATAGG - Intronic
1158180509 18:54710187-54710209 GCTCAAGCATGCACATTAAGAGG + Intergenic
1159054872 18:63453540-63453562 GCTCAAGCATGCACACGAAGAGG - Intergenic
1159670739 18:71217745-71217767 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1159864841 18:73691640-73691662 GCTTAAGCATGTGCACTAAGAGG + Intergenic
1159892777 18:73968311-73968333 GCTCAAACATGTGCACTAAGGGG - Intergenic
1160054989 18:75470711-75470733 GCTTAACCAAGTGCAAGAACGGG + Intergenic
1160628982 18:80232298-80232320 GCTGAAGCAAGTGGATGAGGTGG + Intronic
1162005211 19:7773954-7773976 GCTCAAGCATGTGCACCAAGAGG - Intergenic
1163890486 19:20008225-20008247 GTTTATTCATGTGAATGAAGGGG - Intronic
1164028934 19:21382469-21382491 GCTGAAGCATGTGGATCATGAGG - Intergenic
1164863836 19:31587323-31587345 GCTTAAGCATGCCCACTAAGAGG - Intergenic
1164863940 19:31588240-31588262 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1165692462 19:37874235-37874257 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1166418464 19:42613785-42613807 GCTCAAGCATGTGCATTAAGAGG + Intronic
1166498119 19:43320000-43320022 GCTAAAACATGTGCATTAAGAGG + Intergenic
1167302003 19:48683372-48683394 GCACAAGCATGTGCACTAAGAGG + Intergenic
925553024 2:5096549-5096571 GCTTGAGCATGCGCACTAAGAGG - Intergenic
925680345 2:6414451-6414473 GCTTGGGCAGGAGCATGAAGAGG + Intergenic
925751571 2:7094473-7094495 GCTCAAGCATGTGCATTAAGAGG + Intergenic
926374173 2:12210185-12210207 GCTTGAGCATGAGCACTAAGAGG + Intergenic
926439671 2:12874805-12874827 GCTCAAGCATGCGCACTAAGAGG - Intergenic
926637301 2:15195756-15195778 GCTCAAGCATGTACACTAAGAGG + Intronic
926651619 2:15352762-15352784 GCTCAAGCATGTTCACTAAGAGG - Intronic
926686427 2:15701910-15701932 GCTGAAGCATGTGCACTAAGAGG - Intronic
926769778 2:16359743-16359765 GCTTAAGTATGACCATTAAGAGG - Intergenic
929009243 2:37424729-37424751 GCTACAGCATGCGCATTAAGAGG - Intergenic
931014373 2:57959662-57959684 TCTTGAGCTTCTGCATGAAGAGG - Intronic
931114386 2:59148683-59148705 GTTCAAGCATGTGCATTAAGAGG + Intergenic
931884988 2:66607511-66607533 ACTCAAGCATGCGCATTAAGAGG + Intergenic
932870275 2:75391329-75391351 GCTCAAGCACGTGCATTAAGAGG - Intergenic
933064600 2:77778200-77778222 GCTTAAGCATGCACATTAAAGGG - Intergenic
933064854 2:77780326-77780348 GCTCAAGCATGTGCATTAAGAGG - Intergenic
933515187 2:83291387-83291409 GCTTAAGCATGTACATTAAAAGG - Intergenic
935286468 2:101568054-101568076 GCTTAAGCATGTGCATTGAGAGG - Intergenic
935350149 2:102145494-102145516 GCTCCTGGATGTGCATGAAGAGG - Intronic
936035151 2:109105206-109105228 ACTCAAGCATGTGCATTAAGAGG + Intergenic
936746466 2:115582352-115582374 GCTCAAGCATGTGCAGTAACAGG - Intronic
936837748 2:116728168-116728190 GCTCAAGCATGTACACTAAGAGG + Intergenic
937556868 2:123168698-123168720 GCTCAAGCATATGCACTAAGAGG - Intergenic
937629932 2:124089863-124089885 TTTGAAGCATGTGCATGAAAGGG - Intronic
939195067 2:138961537-138961559 GCTCAAGCATGTGCACTAAGAGG - Intergenic
939446835 2:142321296-142321318 GCTCAAGCATGCACATTAAGAGG + Intergenic
939497643 2:142942998-142943020 GCTCAAGCATGTACATTAAGAGG - Intronic
939577110 2:143909119-143909141 GCTTAAGCATGCACACTAAGAGG + Intergenic
939755612 2:146105525-146105547 GCTCAAGTATGTGCACTAAGAGG - Intergenic
939956361 2:148530690-148530712 GCTGGAGCATGGGCATGAAAGGG - Intergenic
940398402 2:153220380-153220402 GCTGGAGCATGTGCATTAAGAGG + Intergenic
940656597 2:156494649-156494671 GCCAAAGCATGTGCAAGAGGAGG - Intronic
940857639 2:158741974-158741996 GCTCCAGCATGCGCATTAAGAGG + Intergenic
941421478 2:165287435-165287457 GCTCAAGCATGCACATTAAGAGG - Intronic
941998398 2:171623138-171623160 GCTCAAGCATGGGCATTAAGAGG - Intergenic
942439630 2:176019333-176019355 GCTTCAGCCTGTGTCTGAAGGGG - Intergenic
942751925 2:179297757-179297779 ACTCTATCATGTGCATGAAGAGG - Intergenic
942925350 2:181425703-181425725 GTTAAAGCATGTGCACTAAGAGG + Intergenic
943725728 2:191249493-191249515 GTTTAGGCATCTGCATGAAAAGG + Intronic
944377829 2:199068672-199068694 GCTTAAACATCTGAATTAAGGGG - Intergenic
944662831 2:201935402-201935424 ACTTGAGCATGTGCACTAAGAGG - Intergenic
945139710 2:206671431-206671453 GTTTAAGTATTTGAATGAAGAGG - Intronic
945342557 2:208674338-208674360 GCTCAAGCATGTGCATTAAGAGG - Intronic
945392005 2:209275914-209275936 GCTCAAGCATGTGCACTAAGAGG + Intergenic
945555604 2:211271548-211271570 GCTCACACATGTGCATTAAGAGG - Intergenic
945838234 2:214857701-214857723 GCTCAAGCATGTGCACCAAGAGG + Intergenic
946391726 2:219420325-219420347 CCTTAAGAAAGTGCATGAAGAGG + Exonic
946780327 2:223188115-223188137 GCTCAAGGATGTGCATGAAGAGG - Intronic
947156939 2:227172113-227172135 GCTCAAGCATGCACATTAAGAGG - Intronic
947219800 2:227781342-227781364 GCTCAAGCATGCGCACTAAGAGG + Intergenic
947282347 2:228469515-228469537 GCTTGAGCATGCGCACTAAGAGG - Intergenic
948230671 2:236346856-236346878 GTTCAACCATGTGCATTAAGAGG + Intronic
1168757657 20:327396-327418 CATTAAGCATGCGCACGAAGGGG - Exonic
1169988239 20:11470801-11470823 GCTTAGGCTTGTTCATGAGGTGG - Intergenic
1170101670 20:12708034-12708056 GCTTAAGAATGGGGATGATGAGG - Intergenic
1171771044 20:29323919-29323941 GCTCATGCATATTCATGAAGGGG + Intergenic
1171905490 20:30895645-30895667 GCTCACGCATATTCATGAAGGGG - Intergenic
1172530919 20:35630851-35630873 GCTGAAGCATCTGCAGGGAGCGG + Intronic
1172715593 20:36961100-36961122 GCTTCAGCATATGAATGCAGGGG - Intergenic
1173490832 20:43479856-43479878 GTCTAAGCATGTGCATTAAGAGG - Intergenic
1174013142 20:47467005-47467027 GCTCAAGCATGGGAATTAAGAGG - Intergenic
1176291287 21:5046272-5046294 GCTCAAGCATGTGTATTAAAAGG - Intergenic
1177609160 21:23423384-23423406 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1177730547 21:25023238-25023260 GCTTAAGCATGCACATTAAGAGG - Intergenic
1177939057 21:27386226-27386248 GCTCAAGCATGCACATTAAGAGG - Intergenic
1177965530 21:27722114-27722136 GCTTGGGCATGTGCACTAAGAGG - Intergenic
1178837505 21:36111283-36111305 GCTCAATCATGTGCATTAAGAGG + Intergenic
1179010001 21:37549179-37549201 GCTCAGGCATGTGCACTAAGAGG - Intergenic
1179865968 21:44217369-44217391 GCTCAAGCATGTGTATTAAAAGG + Intergenic
1180338905 22:11601760-11601782 GCTCATGCATATTCATGAAGGGG - Intergenic
1181455297 22:23056124-23056146 GCTGGAGCAGGTGAATGAAGGGG + Intergenic
1181525312 22:23481177-23481199 ACTTATGCATGAGCCTGAAGTGG - Intergenic
1181965949 22:26657024-26657046 CCATAACCATGTGCATAAAGAGG + Intergenic
1182739868 22:32559918-32559940 GCTCAAGCCTGTGCACTAAGAGG + Intronic
949591963 3:5504058-5504080 GCTCAAGCATGTGCACTAAGAGG + Intergenic
949642220 3:6049475-6049497 ACTTAAGCATGCACATTAAGAGG - Intergenic
950628115 3:14263362-14263384 GCTCAAGCATGTGCATTAAGAGG - Intergenic
950869543 3:16216828-16216850 GCTCAAGCATGTGCACTAAGAGG - Intronic
951111835 3:18812977-18812999 AGGTAAGCATGTGCAGGAAGAGG - Intergenic
951756989 3:26101852-26101874 GCTCAAGCATGTGCACTAACGGG - Intergenic
951775827 3:26309305-26309327 GCTCAAGTATGCACATGAAGAGG + Intergenic
953194497 3:40719840-40719862 GCTCAAGCATGCGCACTAAGAGG + Intergenic
953259239 3:41321686-41321708 GCTCAAGCATGTGCACTAAGAGG + Intronic
953615098 3:44482830-44482852 GCTTAAACATGTGCATCATATGG - Intergenic
953745707 3:45572418-45572440 GCTCAAGCATGTGCACTAATAGG + Intronic
954891910 3:53938453-53938475 GCTTAAGGATGTGCAGGATAGGG - Intergenic
955293345 3:57713101-57713123 CCTCAAGCATGTGCACTAAGAGG - Intergenic
955825287 3:62939694-62939716 GCCCAAGCATGTGCACTAAGAGG + Intergenic
956552468 3:70477037-70477059 GCTCAAGCATGTGCACTAGGAGG + Intergenic
957275036 3:78080367-78080389 GCTTAAGCATGAGTAGTAAGAGG + Intergenic
957315413 3:78570035-78570057 GCTCAAGCATGCGCACTAAGAGG - Intergenic
957315869 3:78575776-78575798 ACTCAAGCATGTGCATTAAGAGG - Intergenic
957512582 3:81208390-81208412 GCTTAAGCATGTTCATCATATGG - Intergenic
957610848 3:82463335-82463357 GCTCAAGCATGTGCATTAAGTGG - Intergenic
957674132 3:83345460-83345482 GCTGAAGCACGTGCACTAAGAGG - Intergenic
958492711 3:94797770-94797792 GCTCATGCATGTGCATTAAGAGG - Intergenic
958929861 3:100197493-100197515 GCTCAAGCATGGGCACTAAGAGG - Intergenic
959401267 3:105904892-105904914 GCTCAAGCATGTGCACTAAGAGG + Intergenic
959585621 3:108022549-108022571 GCTCAAGCATGTGCACTAAGAGG - Intergenic
960481557 3:118197586-118197608 GCTCAAGCATGTGCACTAAGAGG + Intergenic
961394048 3:126573782-126573804 GTTCAAGCATGTGCACTAAGAGG - Intronic
961480955 3:127180421-127180443 GCTCAAGCATGTGCACTAAGAGG + Intergenic
961815386 3:129547575-129547597 GCTTCAGCAGGTACTTGAAGCGG - Exonic
962474688 3:135744934-135744956 GCTTAAGTATATGCATCATGTGG - Intergenic
963023643 3:140897500-140897522 GCTCAAGCACGTGCACTAAGAGG - Intergenic
964249753 3:154699346-154699368 GCTCAAGCATGTGTATTAAGAGG + Intergenic
965376104 3:167926297-167926319 GCTTGAGCATGTGTATTAAGAGG + Intergenic
965867678 3:173225356-173225378 GCTCAAGCATGTTCACTAAGAGG - Intergenic
965945427 3:174234517-174234539 GCTCAAGCATGTGCATTAAGAGG - Intronic
966269171 3:178083942-178083964 GCTGACTCATGTGCAAGAAGAGG + Intergenic
967120827 3:186381340-186381362 GCTCAAGCATGTACACTAAGAGG + Intergenic
967461933 3:189757938-189757960 GCTCAAGCATGTGTACTAAGGGG + Intronic
967587981 3:191237647-191237669 GCTCAAGCATGCGCTTTAAGAGG - Intronic
967747586 3:193075749-193075771 GCTTAAGCTTGTACCTTAAGAGG + Intergenic
967751379 3:193119903-193119925 GCTCAAGCATGCACATTAAGAGG + Intergenic
967827105 3:193885825-193885847 GCTCAAGCATGTGCATTGAGAGG + Intergenic
967961503 3:194928898-194928920 GCTCAAGCATGCGCACTAAGAGG + Intergenic
967994177 3:195154304-195154326 GCTCAAGCATGTGCACTAGGAGG + Intronic
969850822 4:9954961-9954983 GCTCAAGCATATGCACGAAGAGG + Intronic
969947455 4:10799105-10799127 GCTCATGCATGTGCACTAAGAGG - Intergenic
970370296 4:15399110-15399132 TCTCAAGCATGTGCATTAAGAGG - Intronic
971671030 4:29558324-29558346 GCTCAAGCATGCGCATTAAGAGG + Intergenic
972062794 4:34899557-34899579 GGCTAAGCATGTGTATGAACAGG + Intergenic
972329864 4:38055030-38055052 GCTCAAGCATGCGCATTAAGAGG - Intronic
972865073 4:43221916-43221938 GCTCAAGCATGCACATTAAGAGG - Intergenic
972912172 4:43830984-43831006 GCTCAAGCATGGGCACCAAGAGG + Intergenic
973812659 4:54586898-54586920 GCTTGAGCATGTACACTAAGAGG - Intergenic
974039185 4:56843334-56843356 GCTCAAGCGTGTGCACTAAGAGG + Intergenic
974166973 4:58215864-58215886 GCTCAAGCATGTGCACTAAGAGG - Intergenic
974170806 4:58264793-58264815 GCTCAAGTATGTGCACTAAGAGG + Intergenic
974882317 4:67774848-67774870 GCTCAAGCATGAGCACTAAGAGG + Intergenic
975222882 4:71833531-71833553 GGTCAAGCATGTACATTAAGGGG - Intergenic
975703554 4:77089713-77089735 GCTCAAGCATGCACATTAAGAGG - Intergenic
975916388 4:79330774-79330796 GCTTAAGCATGTAAACTAAGGGG + Intergenic
976005008 4:80419478-80419500 ACTCAAGCATGTGCATTAGGAGG - Intronic
976798610 4:88962342-88962364 GAACAAGCATTTGCATGAAGGGG + Intronic
977051090 4:92129214-92129236 GTTCAAGCATGTGCCAGAAGTGG - Intergenic
977108945 4:92925802-92925824 GCTTAATGATGTCCATGGAGTGG - Intronic
977867722 4:102049811-102049833 GCGCAAGCATGTGCACTAAGAGG + Intronic
979038711 4:115759302-115759324 GCTCAAGCATGTGCACTAAGAGG + Intergenic
979065251 4:116123263-116123285 GCTCAAGCATGTGCACTAAGAGG - Intergenic
979695006 4:123603147-123603169 GCTCAAGCATATGCACTAAGAGG + Intergenic
980072145 4:128254668-128254690 GCGCAAGCATGTGCATTAAGAGG + Intergenic
980252496 4:130335769-130335791 GCTCAAGCATGAGCATTAAGAGG + Intergenic
980259689 4:130432596-130432618 GATCAAGCATGTGCACTAAGAGG + Intergenic
980571622 4:134627364-134627386 GCTCAAGCATGTGCATTAAGAGG - Intergenic
980621785 4:135316716-135316738 GCTCAAGCATGATCATTAAGAGG - Intergenic
980810759 4:137876071-137876093 GCTCAAGCATGCACATTAAGAGG - Intergenic
981323738 4:143423461-143423483 GCTGAGGCATGTGGATGATGAGG + Intronic
981450043 4:144886216-144886238 GCTCAAGCATGTGAACTAAGAGG + Intergenic
981756375 4:148145164-148145186 GCTCAAGCACGCGCATGAAGAGG + Intronic
981928747 4:150167806-150167828 GCTCAAGCATGTGCACTAAGAGG + Intronic
982103797 4:151993997-151994019 TCTCAAGCATGTGCACTAAGAGG - Intergenic
982439894 4:155423044-155423066 GCTCAAGCATGCACATTAAGAGG - Intergenic
983847856 4:172541842-172541864 GCTCAAGCATGTGCACTAAAAGG - Intronic
984086947 4:175325255-175325277 GCTCAAGCATGTGCATTCAGAGG + Intergenic
984351458 4:178600179-178600201 TCTCAAGTATGTGCATTAAGAGG - Intergenic
984422789 4:179546515-179546537 GCTCAAGCATGCCCATGAAGAGG + Intergenic
985230840 4:187814811-187814833 GCTCAAGCATGCGCATTAAGAGG + Intergenic
985924653 5:3006412-3006434 GCTTGAGCATGTGCACTAAGAGG - Intergenic
986040004 5:3984231-3984253 GCTTAAGCTTGAGGAAGAAGGGG - Intergenic
986538033 5:8813146-8813168 GCTCAAGCATGTGCACTAAGAGG + Intergenic
986685034 5:10269066-10269088 GCTCAAGCATGCGCATTAAGAGG - Intergenic
987681798 5:21145463-21145485 GCTCAAGCATGTGCATTAAGAGG + Intergenic
988098311 5:26645848-26645870 GCTCAAGCATGTACATTAAGAGG - Intergenic
988629629 5:32914923-32914945 GCTTAAGCATGAACATTAAAAGG + Intergenic
988737674 5:34039033-34039055 GCTCAAGCATGTGCATTAAGAGG + Intronic
988783588 5:34545555-34545577 GCTCAAACATGTACATTAAGAGG - Intergenic
988882159 5:35515525-35515547 GCTCAAACATGTGCATTAAGAGG + Intergenic
990018625 5:51098332-51098354 GCTCAAGCATGCACATTAAGAGG - Intergenic
990213171 5:53502454-53502476 GCTCAAGCATGTGCATTCAAAGG - Intergenic
990358501 5:54995143-54995165 GATTAAGCAGGTGGATGAAGGGG - Intronic
990444516 5:55881673-55881695 GCTCAAGCATGGCCATTAAGAGG - Intronic
990594154 5:57296257-57296279 GCTCAAGCATGTGCACTAAGAGG + Intergenic
991267851 5:64744061-64744083 ACACAAGCATGTGCATTAAGAGG + Intronic
991657665 5:68920288-68920310 GCCCAAGCATGCGCATTAAGAGG - Intergenic
993364828 5:87022443-87022465 GCTTGAGCATGTGCAATAAGAGG + Intergenic
994196533 5:96928900-96928922 GCTCAAGCATGTGCACTAAGAGG + Intronic
994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG + Intergenic
995582113 5:113613229-113613251 GCTCAAACATATGCATTAAGAGG - Intergenic
995918175 5:117276491-117276513 GCTCAGGCATGTGCACTAAGAGG + Intergenic
996280930 5:121728322-121728344 GCTCAAGCATGTGCACTATGAGG + Intergenic
996289450 5:121834769-121834791 GCTCAAGCATATACATTAAGAGG + Intergenic
996906808 5:128610275-128610297 GCTCAAGCATGAGCATTAAGAGG - Intronic
996998243 5:129725499-129725521 GCTCAAGCATAAGCATTAAGAGG - Intronic
997065727 5:130556451-130556473 GCTCAAGCATGTGCACTAAGAGG + Intergenic
997415982 5:133729059-133729081 GCTTCAGCATGTGGCTGAACTGG - Intergenic
998459030 5:142295675-142295697 GCTTAAGCAAGAGCAGGAAGGGG - Intergenic
1000042829 5:157497989-157498011 GCCTAAGCATAAGCATGGAGTGG - Intronic
1000233299 5:159335227-159335249 GCTTAAGCATGAGCACTAGGAGG + Intergenic
1003783913 6:9461511-9461533 GCTCAAGCATGTTCACTAAGAGG - Intergenic
1004271070 6:14195970-14195992 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1004474279 6:15956720-15956742 GCTTAAGCATGCACACTAAGAGG - Intergenic
1005158270 6:22833509-22833531 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1005621389 6:27623794-27623816 GGTCAAGCATGTGCACTAAGAGG - Intergenic
1005812208 6:29526311-29526333 ACTTAAGCATGTGCACTAACAGG - Intergenic
1011186478 6:84682220-84682242 GCTCAAGCATGCGCATTCAGAGG - Intergenic
1011478729 6:87773282-87773304 GCTCAAGCATGCGCACTAAGGGG + Intergenic
1014524952 6:122491347-122491369 GCTCAAGCATGCACATTAAGAGG - Intronic
1014768433 6:125434104-125434126 GCTCAGGCATGTGCACTAAGGGG - Intergenic
1016193999 6:141309296-141309318 ACTCAAGCATGTGCACTAAGAGG - Intergenic
1016235405 6:141857786-141857808 GCTCAAGCATGTGCATTAAAAGG - Intergenic
1017426926 6:154331658-154331680 GCTCAAGCATGTGCACTAAGAGG + Intronic
1018089940 6:160337644-160337666 GATTAAGCACATGTATGAAGTGG + Intergenic
1018587708 6:165380923-165380945 GCTGAAACATGTTCATGAAGTGG - Intronic
1018664823 6:166125965-166125987 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1021506345 7:21389657-21389679 GCTCAAGCGTGTGCGTTAAGAGG + Intergenic
1021598170 7:22339031-22339053 GCTCAAGCATGCGCACTAAGAGG + Intronic
1022229887 7:28404543-28404565 GGTGGAGCATGTGCATGAGGAGG - Intronic
1023156197 7:37255116-37255138 GCTTAAACATGTGAATTATGAGG - Intronic
1023190018 7:37570364-37570386 GCTCAAGCATGCGCACTAAGAGG - Intergenic
1024016803 7:45324734-45324756 GCTCATGCATGTGCACTAAGAGG + Intergenic
1024193986 7:47040856-47040878 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1024542274 7:50486607-50486629 GCTTCAACATGTGAATGAGGAGG - Intronic
1026130494 7:67616703-67616725 GCTCAAGCATGCGCATTAAGAGG + Intergenic
1026156047 7:67826732-67826754 GCTCAAGCATGTGCACTCAGAGG + Intergenic
1026741100 7:72979110-72979132 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1026800929 7:73399424-73399446 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1027102634 7:75385968-75385990 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1027589644 7:80101522-80101544 GCTTAAGCATGTTCATAATATGG + Intergenic
1027596837 7:80184552-80184574 GCTCAAGCATGCACATTAAGAGG - Intronic
1027643448 7:80766785-80766807 GCTCAAGCATGTCCATTAACAGG + Intronic
1028077858 7:86536697-86536719 GCTTAAGCATGTACACTAAGAGG - Intergenic
1029499260 7:100917819-100917841 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1029912997 7:104174740-104174762 GCTCAGGCATGTGCAGTAAGAGG + Intronic
1030414842 7:109230073-109230095 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1030515509 7:110533435-110533457 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1030558255 7:111053440-111053462 GCTCAAGCATGTACATTAAGAGG - Intronic
1030825795 7:114156097-114156119 GAGGAAGCATGTGCATTAAGAGG - Intronic
1031779836 7:125947264-125947286 GTTCAAGCATGCGCATTAAGAGG - Intergenic
1033095285 7:138425190-138425212 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1033722367 7:144075053-144075075 GATTAAGCATGGGATTGAAGAGG - Exonic
1034685578 7:152967976-152967998 GCTCAAGCATATGCATTAAAAGG + Intergenic
1034690644 7:153010865-153010887 TGTTCGGCATGTGCATGAAGAGG - Intergenic
1034731343 7:153390027-153390049 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1035157765 7:156928264-156928286 GCTCAAGTATGTGCACTAAGAGG + Intergenic
1035785133 8:2254022-2254044 GGTGAAGAATATGCATGAAGTGG - Intergenic
1035807678 8:2467694-2467716 GGTGAAGAATATGCATGAAGTGG + Intergenic
1036441193 8:8782405-8782427 GCTGAAGCATGCGCATTAAGAGG + Intergenic
1036626017 8:10472176-10472198 GCCCAAGCATGTGCACGAAGAGG - Intergenic
1037135382 8:15453946-15453968 GCTCAAGCATGTACACTAAGAGG + Intronic
1038869845 8:31481965-31481987 GCTCAAGCATGAGCACTAAGAGG - Intergenic
1039687844 8:39826006-39826028 GATAAAGCATGTTCATGAACTGG - Intronic
1039959287 8:42233412-42233434 GCTCAAGCATGCACATTAAGAGG - Intergenic
1041605600 8:59779431-59779453 GCTTGAGCATGTGCATTAAGAGG + Intergenic
1041810499 8:61903140-61903162 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1042397107 8:68305711-68305733 GCTCAAGCATGCACATTAAGAGG + Intronic
1042397347 8:68307633-68307655 GCTCAAGCATGCGCACTAAGAGG - Intronic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1044139910 8:88637537-88637559 GCTCAAGCATCTGCACTAAGAGG + Intergenic
1044362869 8:91309184-91309206 GCTCAAGCATGTGTATTAAGAGG - Intronic
1045977770 8:108148964-108148986 GCTTGAGCATGCACATTAAGAGG - Intergenic
1048473957 8:134726504-134726526 GCTCAAGCATGTGCACTAAGAGG - Intergenic
1048831512 8:138482070-138482092 GCTGAAGCTTGGGCATGATGTGG - Intronic
1049933126 9:475149-475171 GCTCAAGCATGTGCACTAAGAGG + Intronic
1050204858 9:3185932-3185954 GCTCAAGCATGCGCATTAAGAGG + Intergenic
1051179067 9:14391534-14391556 GCTCAAGCATGTGCACTAAGAGG + Intronic
1051261194 9:15266655-15266677 GCTTGAACATGTGCATGTACAGG - Intronic
1051868417 9:21708609-21708631 GCTGCAGCATCTGTATGAAGGGG + Intergenic
1051991212 9:23154459-23154481 ACTCAAGCATGCGCATTAAGAGG + Intergenic
1053451207 9:38195654-38195676 GCTCAAGCATGTGAACTAAGAGG + Intergenic
1055015740 9:71616023-71616045 GCTTCAGCATGTGAATTTAGGGG + Intergenic
1056303546 9:85267597-85267619 GCTCAAGCATGAGCATTAGGGGG - Intergenic
1056739709 9:89243865-89243887 GCTCAAGCATGTACAATAAGAGG - Intergenic
1057333110 9:94134530-94134552 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1057479899 9:95436610-95436632 GCTTCAGCATGAGCAAGCAGTGG + Intergenic
1059901393 9:118930349-118930371 GCTCAAGCATGTGCATTAAGAGG + Intergenic
1060768991 9:126317143-126317165 GCTCAAGCATAAGCATTAAGAGG - Intergenic
1060777835 9:126389528-126389550 GCTTAAGCATGTGTAATCAGTGG + Intronic
1061554921 9:131361571-131361593 GCTCGAGCATGTGCATTAAGAGG - Intergenic
1061673097 9:132200269-132200291 GCTTAGGCAGGTGCAGGCAGGGG + Intronic
1185969659 X:4648399-4648421 GCTCAAGCATGCACATTAAGAGG - Intergenic
1186035785 X:5421979-5422001 GCTCAAGCATGTGCACTAAAAGG - Intergenic
1187387563 X:18862371-18862393 GCTGGAGCATGTGCATTAAGGGG + Intergenic
1187613559 X:20969021-20969043 GATCAAGCATGTGCATTAAGAGG + Intergenic
1188162592 X:26821401-26821423 GCTTTAGCTTGTGCCTGGAGGGG + Intergenic
1188883391 X:35518442-35518464 GCTCAAGCATGCACATTAAGAGG - Intergenic
1188898655 X:35700558-35700580 GCTCCAGCATGTGCACTAAGAGG - Intergenic
1188905770 X:35789429-35789451 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1189986062 X:46554291-46554313 GCTCAAGTATGTGCACTAAGAGG - Intergenic
1191739736 X:64423982-64424004 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1191884602 X:65875501-65875523 GCTCAAGCATGTGCATTAAGAGG - Intergenic
1192432993 X:71125257-71125279 GCTTTAGCATGTGGATGCTGAGG + Intronic
1193066636 X:77267415-77267437 GCTGAAGCATGTGCATTAAGAGG + Intergenic
1193286509 X:79721279-79721301 GCTTAAGCATGCACACAAAGGGG + Intergenic
1193330769 X:80233223-80233245 GCTCAGGCATGTGCACCAAGAGG - Intergenic
1193732415 X:85116910-85116932 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1193870242 X:86788214-86788236 GCTTAAGCATGCACACTAAGAGG - Intronic
1193974699 X:88102871-88102893 GCTCAAGCATGCGCATTAAGAGG - Intergenic
1195325809 X:103757494-103757516 GTTCAAGCATGTGCACTAAGAGG - Intergenic
1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG + Intergenic
1196366074 X:114925834-114925856 GCTCAAGCATGCCCATTAAGAGG + Intergenic
1196387027 X:115167512-115167534 GCTTAGTCTTGTGGATGAAGAGG + Intronic
1197660744 X:129168687-129168709 GCTCAAGCATGCACATTAAGAGG + Intergenic
1198393620 X:136201495-136201517 GCTCAAGCATGTGCACTAAGAGG - Intronic
1198823490 X:140674185-140674207 GCTCAAGCATGTGCACTAAGAGG + Intergenic
1199082352 X:143591066-143591088 GCTCAAGCATGCTCATTAAGAGG + Intergenic
1199082447 X:143591902-143591924 GCTTAAGCTTGCGCATTAAGAGG - Intergenic
1199276172 X:145944966-145944988 GCTTGAGCATGCACATTAAGAGG - Intergenic
1200492938 Y:3850711-3850733 GCTTAAGCATGTGCACTAAGAGG - Intergenic
1202085726 Y:21134696-21134718 GCCCAAGCATGTGCAGTAAGAGG + Intergenic