ID: 1103095676

View in Genome Browser
Species Human (GRCh38)
Location 12:118130623-118130645
Sequence GGCCCCTGAGGATGTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103095665_1103095676 17 Left 1103095665 12:118130583-118130605 CCTTTGAATTGGATGAAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 157
Right 1103095676 12:118130623-118130645 GGCCCCTGAGGATGTCCTAGGGG 0: 1
1: 0
2: 1
3: 4
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103095676 Original CRISPR GGCCCCTGAGGATGTCCTAG GGG Intronic
900093520 1:930833-930855 GGCCCATGGGCCTGTCCTAGTGG + Intronic
900099753 1:956742-956764 GGCGCCTGAGGCTGTGCTGGTGG - Intronic
900179777 1:1306011-1306033 GCTCCCTGAGGCTGTCCTGGGGG - Intronic
900487808 1:2931770-2931792 GGCCCCTGAGGCTGGGCTATAGG + Intergenic
900540762 1:3201592-3201614 TGCCCCTGAGCATGGCCTCGGGG + Intronic
901465363 1:9417798-9417820 GGCCCCAGAGGCTGTCCTGGTGG - Intergenic
902651851 1:17842561-17842583 GGCCCCTTGAGATGTCCTAATGG - Intergenic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
903967905 1:27101420-27101442 GGCCCCTCAGGAGCTCCTAAGGG + Intronic
903995558 1:27303425-27303447 AGCCCCTGAGGATGTTCAAGAGG - Intronic
908139718 1:61171868-61171890 AGCCCCTGAGGATTTCTAAGGGG - Intronic
908420875 1:63957308-63957330 GTCCCCCGAGGAATTCCTAGTGG + Intronic
908644883 1:66266469-66266491 GGCCCCTGCGGATATGTTAGTGG + Intronic
910763922 1:90761888-90761910 GGCCCCTGAGGGTGCCCTAGGGG - Intergenic
915742860 1:158132619-158132641 GGCACCTCTGGATGACCTAGAGG + Intergenic
921155179 1:212433276-212433298 GGCCCCGAAGGATGGCCGAGGGG + Intronic
922050972 1:221990404-221990426 GGCCCCTGAGGGAGCCCTGGTGG - Intergenic
923100331 1:230809265-230809287 GGCCCCTGGGGAAGACCTGGTGG - Intergenic
1075055613 10:119216297-119216319 GGCCCCAGAAGCTGTCCTTGGGG - Intronic
1075070581 10:119317470-119317492 GGCCCCTGAGGCTGTCTCATTGG + Intronic
1077571170 11:3339623-3339645 GGTCCCAGAGGATGTTCGAGTGG + Intronic
1078266388 11:9758712-9758734 GGCCCCTGAGGATTTCCGGCCGG + Intergenic
1079303052 11:19296612-19296634 GGGCCCTGAAGATGCCCTGGAGG + Intergenic
1083317887 11:61827784-61827806 GGCGCCGGAGGAGATCCTAGAGG - Exonic
1083798427 11:65032182-65032204 GGACCCAGAGGATGTCAAAGAGG + Exonic
1084790796 11:71474282-71474304 GACCACTCAGGATGACCTAGCGG + Intronic
1089541170 11:119189708-119189730 GGCTCCAGAGGATGTCATATGGG + Exonic
1090905158 11:131068424-131068446 GGCCATTAGGGATGTCCTAGTGG - Intergenic
1091364171 11:135003770-135003792 TGCCCCTGAAGATGTTCCAGTGG - Intergenic
1092672689 12:10882248-10882270 TGCCCCTGTGGAGGTCCTTGTGG + Exonic
1092677005 12:10931027-10931049 TGCCCCTGTGGAGGTCCTTGTGG - Exonic
1092872604 12:12819471-12819493 TGCCCCTGAGGAAGTACCAGTGG + Intronic
1097168734 12:57100075-57100097 GGCCCAGCAGGATCTCCTAGGGG + Exonic
1099009507 12:77275400-77275422 AGGCCCTGGAGATGTCCTAGTGG + Intergenic
1099670260 12:85682374-85682396 TGCCCCTGAAGATCTTCTAGTGG - Intergenic
1103095676 12:118130623-118130645 GGCCCCTGAGGATGTCCTAGGGG + Intronic
1103160969 12:118729116-118729138 GGTCCCTGGGGATGTTCTTGTGG - Intergenic
1103209746 12:119157559-119157581 GGCCCCTGTGAATGGCCAAGAGG - Exonic
1104787440 12:131458733-131458755 GGACCCTGAGGCCGTCCTACAGG + Intergenic
1106132931 13:26954418-26954440 TGGCCCTGGGGAGGTCCTAGGGG - Intergenic
1107553555 13:41498414-41498436 GGGCCCTGAGGCTGGCCTCGTGG - Intergenic
1108541842 13:51452839-51452861 GGCCCCTGTGTGTGTCCCAGCGG + Exonic
1108767853 13:53655695-53655717 GGCCCCTGAAGACTTCCCAGTGG - Intergenic
1109326164 13:60870155-60870177 GGCACCTGAGGCGGTCCTACAGG + Intergenic
1110635780 13:77765949-77765971 TGCCACTGGGGATGGCCTAGTGG - Intergenic
1119402925 14:74376515-74376537 TGCCATTGAGGAGGTCCTAGAGG + Intergenic
1122303497 14:100746138-100746160 CGCCCCTGAGGATCTTCCAGAGG + Intergenic
1122788202 14:104173594-104173616 GGCTCCTGGGGATGTCCCTGGGG + Intronic
1202902961 14_GL000194v1_random:53757-53779 GGCTCATGTGGATGTCCTTGAGG + Intergenic
1125239642 15:37558826-37558848 TGCCCTTGAGGATTTCCTTGTGG - Intergenic
1131523912 15:93137564-93137586 GCCGCCTGAGAATGTCCTAAAGG + Intergenic
1132913181 16:2326344-2326366 GGCTCCTGGGGATGCCCTTGAGG - Intronic
1133019881 16:2962755-2962777 GTCCACAGAGGATGTCCTAGGGG - Intergenic
1134668573 16:16037824-16037846 GTCCTCTGCTGATGTCCTAGTGG - Intronic
1134747563 16:16599905-16599927 GCCCACTGAGGGTTTCCTAGTGG + Intergenic
1134997907 16:18753752-18753774 GCCCACTGAGGGTTTCCTAGTGG - Intergenic
1139465706 16:67152990-67153012 GGCCCCAGGGGATGTCCTGAAGG - Intergenic
1141036822 16:80633719-80633741 AGCGCCTGAGGAAGCCCTAGGGG - Intronic
1142376525 16:89709614-89709636 AGCCCCTGAGGATGGCCTCAGGG + Intronic
1143114947 17:4576993-4577015 GGCCCCTGGGGAAGGCCCAGGGG + Intergenic
1143201358 17:5115867-5115889 GGCCACTGAGGCGGTCCTCGAGG + Intronic
1143327579 17:6109612-6109634 AGCCCCTGAGAATGGCCAAGGGG - Exonic
1144450458 17:15373199-15373221 TGCCCCTGAGGACCTTCTAGTGG - Intergenic
1148830132 17:50425962-50425984 GGCCCCTGAGGATGGTCGCGAGG + Intergenic
1151414503 17:73952687-73952709 GGCCCTTGAGGATGTCCCCTCGG + Intergenic
1151598783 17:75093854-75093876 GGCCGATGAGAAAGTCCTAGGGG + Intronic
1153942725 18:9991509-9991531 GGCCACTGAGGACCTCCTTGTGG + Intergenic
1154384334 18:13879967-13879989 GGGCCCTGCACATGTCCTAGAGG + Intergenic
1156326079 18:36076746-36076768 TGCCCCTGAAGATCTTCTAGTGG + Intergenic
1156437966 18:37153998-37154020 GTCCCCCGAGGATTTCCTACAGG + Intronic
1156482933 18:37447568-37447590 GGCCCCTGGGGAGCTCCTGGAGG - Intronic
1161221569 19:3120401-3120423 GGCCCCTGGGGGTGTTCAAGGGG - Intronic
1162919032 19:13889616-13889638 GCCCCCCGGCGATGTCCTAGTGG - Exonic
1164822296 19:31259574-31259596 GGCCACTGAGGGTATCCTATGGG + Intergenic
1165605726 19:37102113-37102135 ACCCCCTGAGGATGTGCTATGGG + Intronic
1166102697 19:40580559-40580581 GGCTCCTCAGGTTGTCCTTGAGG - Exonic
1167703041 19:51061881-51061903 GGCCCATGAGGCTGGACTAGAGG - Intronic
1168238795 19:55079078-55079100 TGCCCCAGAAGATGTCCTGGGGG - Intronic
924997389 2:374750-374772 AGACCCTGAGTATTTCCTAGAGG - Intergenic
925173398 2:1766557-1766579 GGCCGCTGAAGAGGTCCTGGAGG + Intergenic
930928774 2:56854728-56854750 CGTCCCTGAGGATCTTCTAGTGG + Intergenic
932405642 2:71511207-71511229 GGCAGCTGAGGATGTGCTGGGGG + Intronic
932620744 2:73263826-73263848 AGCCCCTGGGGATGACCAAGAGG + Exonic
932982887 2:76691305-76691327 AGCCCCTGAGGAAGGCCTGGTGG - Intergenic
933656558 2:84891881-84891903 GGCCCATGAGGAAGTTCTACAGG - Intronic
934473497 2:94577038-94577060 GCTCCCTGAGGAGGTCCTGGTGG + Intergenic
934503701 2:94876637-94876659 GGCTCATGTGGATGTCCTCGAGG - Exonic
936038120 2:109128854-109128876 GAGCCCTGGAGATGTCCTAGGGG + Intergenic
937444890 2:121949592-121949614 GGCCTCTGATGATGTGCTGGAGG + Intergenic
938811370 2:134855955-134855977 GGCCCCATAGAATGTCCAAGTGG - Intronic
939808687 2:146806149-146806171 GTACCCTGAGGATATCCTTGAGG + Intergenic
944220254 2:197296275-197296297 GGCCCCTCAAAAGGTCCTAGTGG - Intronic
948609197 2:239156003-239156025 GGCCCCTGAGAAAGTCACAGAGG + Intronic
948760006 2:240184486-240184508 GGCCCCTGATGATGCCCTCCTGG + Intergenic
949027239 2:241772008-241772030 GGCCCCTGAGGACGTCCATCAGG + Intergenic
1169206575 20:3744050-3744072 GTCCTCTGAATATGTCCTAGAGG + Intronic
1170817255 20:19724243-19724265 TGCTCCTGAGTGTGTCCTAGTGG + Intergenic
1172105136 20:32512373-32512395 GGCACCTGAGGATGTTTTTGGGG - Intronic
1172271689 20:33658819-33658841 GGGCCATGAGGATGTGCTGGTGG + Exonic
1175570085 20:60011827-60011849 GGTCTCTGTGGATGTCCTTGTGG + Intronic
1176146992 20:63569863-63569885 GGCCCCTGTGGATGTCCCGTGGG + Intronic
1176180385 20:63747013-63747035 GGCCCCTGAGGATGCGCTGTTGG - Exonic
1176622324 21:9068524-9068546 GGCTCATGTGGATGTCCTTGAGG + Intergenic
1179388209 21:40961895-40961917 GGCCCCTCAGGAAGGCCTAAGGG - Intergenic
1184348281 22:43926085-43926107 GGCTGCTGAGCATGTCCCAGAGG + Intronic
1184431102 22:44441945-44441967 GGCCCCTGGCCATGTCCTTGAGG - Intergenic
950143072 3:10628456-10628478 GGAGGCAGAGGATGTCCTAGAGG - Intronic
950419879 3:12892546-12892568 GGTCCCTGTGGAGGTCCTGGGGG - Intergenic
953916498 3:46924016-46924038 GGGCTCTGAGGATGTCCTCTGGG + Intronic
954361862 3:50126407-50126429 GGCTCTCGAGGATGTCCTATGGG + Intergenic
955492600 3:59498341-59498363 GGCCCCTCAGAAGGCCCTAGGGG + Intergenic
960292087 3:115898027-115898049 CCCTCCTGAGGAAGTCCTAGGGG + Intronic
966359183 3:179115903-179115925 GGCCCATGAGGAAATCCTTGTGG + Intergenic
966389749 3:179439492-179439514 GGCCCCTGAAGAAATCCTTGTGG + Intronic
966726833 3:183116050-183116072 GGCTTCTGAGGGTTTCCTAGGGG - Intronic
969638850 4:8384906-8384928 GGCACCTGAGGGTGTCTCAGAGG - Intronic
970432409 4:16001096-16001118 GGCCCATGAGGGTGGCCTAAGGG + Intronic
973191462 4:47390580-47390602 AGCCCCTGGGGATTTCTTAGTGG - Intronic
973738007 4:53891399-53891421 GGCCGGTGGGGAGGTCCTAGAGG + Intronic
975200777 4:71585872-71585894 TGCCCCTGAAGATCTTCTAGTGG + Intergenic
981423247 4:144575404-144575426 TGCCCATGAGCATGACCTAGTGG + Intergenic
982455794 4:155608273-155608295 GGTCCCTGAGGATTTCACAGAGG - Intergenic
986634585 5:9808874-9808896 GGCCACTGAAGATATCCTTGTGG + Intergenic
991650214 5:68844963-68844985 GGCCCCTGAAGATGACCAGGAGG + Intergenic
997697541 5:135873376-135873398 ATCCCATGAGGATGACCTAGTGG + Intronic
997758229 5:136420482-136420504 GGCCCCTGAGGAGGTCAGTGTGG + Intergenic
998221094 5:140280577-140280599 GCCTCCTGAGGATTTCTTAGGGG - Intronic
1000144150 5:158436882-158436904 AGCCTCTGAGGATGTCTCAGGGG - Intergenic
1000411446 5:160937943-160937965 GGTCCCTGAGCATGCCCTTGTGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006001158 6:30966135-30966157 GGCCCCAGAGGCTGTGGTAGAGG - Intergenic
1007174485 6:39886786-39886808 GGCCCCTGAAGTTGTGCAAGAGG + Intronic
1011804775 6:91059970-91059992 GCCCCCTTGGGATCTCCTAGGGG + Intergenic
1013608970 6:111776238-111776260 GGCCCCTGAGGATCACCCAGGGG + Intronic
1014928131 6:127299310-127299332 TGCCCCTGAAGATGTTCCAGTGG + Intronic
1017626663 6:156356373-156356395 CCCTCCTGAGGAGGTCCTAGGGG - Intergenic
1018041611 6:159928951-159928973 TGCCCCTGAGGACCTCCCAGTGG + Intergenic
1019424849 7:969687-969709 GGCCTCTTGGGATGTCCAAGAGG + Intronic
1019493698 7:1326568-1326590 TGCCCCTGATGATGCCCCAGCGG + Intergenic
1022042282 7:26592374-26592396 GTCCCATGGTGATGTCCTAGAGG - Intergenic
1022878859 7:34565028-34565050 GGCAGCTGAGGATGGGCTAGCGG + Intergenic
1028215580 7:88128130-88128152 GTCCTCTGAGGATCTCCGAGAGG - Intronic
1029870014 7:103680717-103680739 TGACCCTGGGGAGGTCCTAGAGG + Intronic
1034023213 7:147668483-147668505 TGCCCCTGAGAACGTCCCAGTGG + Intronic
1034432896 7:151049810-151049832 GGCCCCTGTGGCTGTCCTCCGGG - Intronic
1037906601 8:22719204-22719226 GGGCCCTGAGGCTGCCCTGGAGG + Intronic
1043443919 8:80300858-80300880 GTGCCCTCAGGATGACCTAGTGG + Intergenic
1049127184 8:140802188-140802210 GGCCCCTGAAGACCTCCCAGTGG + Intronic
1049430930 8:142564371-142564393 AGACCCTGAGAATGTCCCAGAGG + Intergenic
1050757293 9:9021639-9021661 TGCCCCTGAAGATCTTCTAGTGG + Intronic
1053684832 9:40511464-40511486 GCTCCCTGAGGAGGTCCTGGTGG - Intergenic
1053934796 9:43139747-43139769 GCTCCCTGAGGAGGTCCTGGTGG - Intergenic
1054278895 9:63113492-63113514 GCTCCCTGAGGAGGTCCTGGTGG + Intergenic
1054297925 9:63346927-63346949 GCTCCCTGAGGAGGTCCTCGTGG - Intergenic
1054395941 9:64651445-64651467 GCTCCCTGAGGAGGTCCTGGTGG - Intergenic
1054430585 9:65156640-65156662 GCTCCCTGAGGAGGTCCTGGTGG - Intergenic
1054499795 9:65864881-65864903 GCTCCCTGAGGAGGTCCTGGTGG + Intergenic
1057445253 9:95109675-95109697 TGCCTCTGTGGATGTCCTTGAGG - Intronic
1059627276 9:116080720-116080742 AGGCCCTGAGGCTGTCCTTGTGG + Intergenic
1061672006 9:132194134-132194156 TGCCCCTGGGGACTTCCTAGGGG - Intronic
1061861847 9:133472385-133472407 AGCCCCTGAGGAAGGCCGAGGGG - Intronic
1203745522 Un_GL000218v1:38954-38976 GGCTCATGTGGATGTCCTCGAGG + Intergenic
1203564587 Un_KI270744v1:80530-80552 GGCTCATGTGGATGTCCTCGAGG - Intergenic
1189429126 X:40931772-40931794 GACCCCTGAGAATGACCAAGTGG + Intergenic
1190297816 X:49038873-49038895 GGGCCATGAGGATGTCTTGGTGG - Intronic
1191803613 X:65108525-65108547 CGCCCCTGAAGATCTTCTAGTGG - Intergenic
1195577603 X:106468374-106468396 AGCCCCTGAGGATTTCCAGGAGG - Intergenic
1197941513 X:131795401-131795423 AGCCCCTGGGGATGTCGGAGAGG - Intergenic
1201158845 Y:11153965-11153987 GGCTCATGTGGATGTCCTCGAGG + Intergenic