ID: 1103096392

View in Genome Browser
Species Human (GRCh38)
Location 12:118136194-118136216
Sequence TCTGCTTGGCCTCGCCATGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103096383_1103096392 15 Left 1103096383 12:118136156-118136178 CCCGCGCCTGGCCTACCGCGGCA 0: 1
1: 2
2: 0
3: 6
4: 77
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096388_1103096392 0 Left 1103096388 12:118136171-118136193 CCGCGGCACTCCCGGCTGCACGC 0: 1
1: 2
2: 0
3: 10
4: 335
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096387_1103096392 4 Left 1103096387 12:118136167-118136189 CCTACCGCGGCACTCCCGGCTGC 0: 2
1: 1
2: 1
3: 10
4: 199
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096384_1103096392 14 Left 1103096384 12:118136157-118136179 CCGCGCCTGGCCTACCGCGGCAC 0: 1
1: 1
2: 1
3: 7
4: 150
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096381_1103096392 24 Left 1103096381 12:118136147-118136169 CCTCTGTCGCCCGCGCCTGGCCT 0: 1
1: 0
2: 2
3: 14
4: 199
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096390_1103096392 -10 Left 1103096390 12:118136181-118136203 CCCGGCTGCACGCTCTGCTTGGC 0: 1
1: 1
2: 2
3: 16
4: 274
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134
1103096385_1103096392 9 Left 1103096385 12:118136162-118136184 CCTGGCCTACCGCGGCACTCCCG 0: 2
1: 1
2: 1
3: 3
4: 90
Right 1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG 0: 1
1: 1
2: 0
3: 21
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103096392 Original CRISPR TCTGCTTGGCCTCGCCATGC CGG Exonic
901681193 1:10913814-10913836 TCTGCATGGCCTCACCACGTGGG + Intergenic
902155443 1:14481936-14481958 TCTGCCTGGACACTCCATGCAGG - Intergenic
903302859 1:22391476-22391498 TCAGCTTGGCCTGGTCATGTTGG - Intergenic
904689023 1:32280025-32280047 TCTGCTTGGCCAGACCCTGCAGG - Intronic
907578760 1:55552963-55552985 TCTGCCAGGCCTCATCATGCTGG - Intergenic
911332959 1:96546460-96546482 TGTTCTTGGCATCGCCAAGCAGG - Intergenic
911638919 1:100266562-100266584 TCTCCTAGGCCTCCCCTTGCGGG + Exonic
912473060 1:109918913-109918935 TCTGCTTGCCCTCCAAATGCTGG - Intronic
915503626 1:156338178-156338200 TCTGCATCGCGTCGCCATGATGG - Exonic
918311214 1:183286871-183286893 TCTGGGTGGCCTCTCCATGATGG - Intronic
923537123 1:234861635-234861657 TCTCCATAGCCTTGCCATGCAGG - Intergenic
1064771829 10:18731081-18731103 TCTGCTTGACCTCTCCATTATGG - Intergenic
1066460415 10:35608140-35608162 TCTGCTGGGCCTCGCCGACCTGG + Exonic
1067718659 10:48709717-48709739 TCTGCTTTGCCACGGCATGGAGG + Exonic
1070674163 10:78400530-78400552 TCTGCTTGGCCATGCTTTGCAGG + Intergenic
1070871404 10:79756889-79756911 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1070920261 10:80180297-80180319 TGTGCATGGCCTAGCCTTGCTGG - Intronic
1070951773 10:80436890-80436912 TCTTCTTGGCCTCTCTGTGCAGG - Exonic
1071638340 10:87279097-87279119 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1075990535 10:126834803-126834825 TCTGCTTGGCTTCTCTATGCTGG - Intergenic
1077350323 11:2090257-2090279 TCTGCCTGGCCCTGCCATGCGGG - Intergenic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1081632056 11:44695905-44695927 TCTGCTTGACCCCGCTTTGCTGG - Intergenic
1081666132 11:44918191-44918213 TCTGCGGGGCCTTGCCAGGCGGG - Intronic
1084562354 11:69911930-69911952 TCTGCCTGGCCTCCCCCTGCAGG - Intergenic
1087836388 11:102879533-102879555 TCGCCTTGGCCTCCCAATGCTGG + Intergenic
1089010544 11:115128565-115128587 TCTGCTCTGCCTCTCCAAGCTGG - Intergenic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1092158852 12:6304022-6304044 TATGGTTGTCCTCGGCATGCTGG - Intergenic
1092821487 12:12357346-12357368 TCTGCTTTGCCTCCCCGTCCCGG + Exonic
1098875819 12:75865516-75865538 TCTTCTTGGCCTCTCTGTGCAGG + Intergenic
1100012617 12:89971927-89971949 TCTGCTTGCCATCCCCATTCAGG + Intergenic
1101528748 12:105555911-105555933 ACTGCTTGGCCTGGCCCAGCCGG - Intergenic
1101709494 12:107251619-107251641 TCTGCTTTTTCTAGCCATGCTGG + Intergenic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103679145 12:122679613-122679635 TCTGTTTTGGCCCGCCATGCTGG - Intergenic
1105267645 13:18836638-18836660 TCTGCCTGGCCTCCCCATCTGGG - Intergenic
1105805792 13:23951003-23951025 TCTGCTTGGCCACCCCAGGCTGG + Intergenic
1108501218 13:51071698-51071720 TCTGCTTAGCTTCTGCATGCTGG + Intergenic
1114271900 14:21105405-21105427 TCTGCTTCCCCTCTCCTTGCAGG - Intergenic
1114529138 14:23384594-23384616 TCTGCTCGGCCTCGTCCAGCCGG + Exonic
1116626825 14:47276006-47276028 TCTGCTTGGCCACTTCATCCAGG - Intronic
1118471719 14:66080675-66080697 TCTGCTTGGCCTTGGTATTCGGG - Intergenic
1121758660 14:96424210-96424232 TCCGCTCGGCCCCGCCACGCGGG - Intronic
1123126933 14:105953602-105953624 GGTGCTTGGCATCCCCATGCAGG - Intergenic
1128517885 15:68354695-68354717 TCTCCTTGGCCACTCCATGGGGG + Intronic
1130824295 15:87527978-87528000 TCTGTGTGGCCTCTCCATGTAGG + Intergenic
1132871802 16:2118688-2118710 TCTGCTTGGCATCCCCTTGCTGG - Exonic
1134520726 16:14918208-14918230 TCTGCTTGGCATCCCCTTGCTGG + Intronic
1134550850 16:15137766-15137788 TCTGCTTGGCATCCCCTTGCTGG - Intronic
1134708398 16:16316859-16316881 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134715613 16:16356892-16356914 TCTGCTTGGCATCCCCTTGCTGG + Intergenic
1134951204 16:18351786-18351808 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1134959144 16:18395267-18395289 TCTGCTTGGCATCCCCTTGCTGG - Intergenic
1135007334 16:18838079-18838101 TCTGCTTGCTCTCGGCCTGCTGG + Exonic
1135970265 16:27067116-27067138 CCTGCGTGGCCACGCCATGCAGG + Intergenic
1136549681 16:30976381-30976403 TCGCCTGGGCCTCCCCATGCTGG + Intronic
1138956295 16:61974392-61974414 TCTGCTAAGCCTAGCAATGCAGG + Intronic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1144852631 17:18251730-18251752 CCTGCTTGGCCTGGTCATCCTGG + Exonic
1148025915 17:44587566-44587588 TCTGCTTGGCCTTCCCAGGAGGG + Intergenic
1154483274 18:14856601-14856623 TCTGCCTGGCCGCGCCATCTGGG - Intergenic
1154483693 18:14858221-14858243 TCTGCCTGGCCGCGCCATCTGGG - Intergenic
1154484114 18:14859841-14859863 TCTGCCTGGCCGCGCCATCTGGG - Intergenic
1156338042 18:36187203-36187225 CCTGCTTGGCATCGGCATCCTGG - Intergenic
1158720307 18:59918660-59918682 CCTGCCTGGCCTCGCTATGTTGG - Intergenic
1160940896 19:1620005-1620027 GCTGCTCGGCCCCGCCAGGCAGG + Intronic
1165102899 19:33449322-33449344 TCTGATTGACCCCACCATGCGGG - Intronic
1165219120 19:34300524-34300546 TCTGCTTGGACCCGCCAAGCAGG - Exonic
1166953745 19:46448000-46448022 GCAGCCTGGCCTGGCCATGCTGG - Intergenic
1167048618 19:47066030-47066052 TCTGCGTGGCCGGGCCTTGCTGG - Exonic
1168663636 19:58185909-58185931 TCTGCTTGGGCTCACACTGCAGG + Intronic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
925409768 2:3633197-3633219 TCTCCTGGGCCTCACCATCCCGG - Intronic
927278467 2:21282003-21282025 TCTGTCTGGCCTGGCCAGGCTGG + Intergenic
927519563 2:23690643-23690665 TCGGCTTGGCCGCCCCATCCTGG - Intronic
931318050 2:61150838-61150860 TCTACTTGGCCTAGGGATGCTGG + Intronic
933713076 2:85341832-85341854 TCTGCTTGGCCTTGCCATGCCGG - Intergenic
934777881 2:96950466-96950488 ACTGCTTGGCCTCGGCAGGCTGG - Intronic
935517273 2:104056287-104056309 TCTGCTGGTTCTCTCCATGCTGG - Intergenic
935746529 2:106194160-106194182 GCTGCTGGGCATCGCCTTGCTGG - Exonic
943297864 2:186161090-186161112 TCTGCCTGGCCTGGACATCCAGG - Intergenic
944621680 2:201522510-201522532 TGTGCTTGGCAACCCCATGCAGG - Intronic
946156213 2:217808333-217808355 TCTGCTTCTCCTCTCCATGATGG - Intronic
947527246 2:230886217-230886239 TCTGCTGTGCCTCCCCATGAGGG - Intergenic
1169130554 20:3164501-3164523 CCTTCTTCTCCTCGCCATGCTGG + Exonic
1169171752 20:3471028-3471050 TCCGCTTCGCCTGGCCGTGCGGG - Exonic
1169724771 20:8716728-8716750 TCTTCTTGGCCTGTCCCTGCTGG + Intronic
1175999500 20:62825618-62825640 TCTCGGTGGCCTCGCCCTGCCGG - Intronic
1176797115 21:13379179-13379201 TCTGCCTGGCCACCCCATCCAGG + Intergenic
1179822963 21:43947425-43947447 TCTGTTTGGCCTCTACCTGCTGG + Intronic
1179887961 21:44322463-44322485 GCTGCCTGGCCTGGCCAGGCAGG - Intronic
1181902645 22:26169181-26169203 TCTGCCTGGCCAGGCCAGGCTGG - Intergenic
1183382354 22:37496503-37496525 TCTGCTGGGCCTCGGCTTCCAGG + Exonic
1183668310 22:39257542-39257564 GCTTCTTGGCCTGGCCCTGCTGG - Intergenic
1184097285 22:42323349-42323371 TCTGAATGGCCCCTCCATGCTGG - Intronic
1184192671 22:42905388-42905410 TAGACTTGGCCTTGCCATGCAGG + Intronic
1184273548 22:43398113-43398135 TCTTCCTGGCCTCCCCAGGCCGG + Intergenic
1184691617 22:46119838-46119860 TCTGCTTGGCCTGCCCTGGCTGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954413748 3:50382846-50382868 TCTGCGTGGGCTGTCCATGCAGG + Intronic
955463413 3:59210516-59210538 TCTGCTTGGCTTGGACTTGCTGG + Intergenic
956684637 3:71813655-71813677 TTTGCTTGGCCTCTCAGTGCAGG - Intergenic
958406070 3:93760609-93760631 TCTGCCTGGCCTCCCCATCTGGG - Intergenic
960988563 3:123295992-123296014 TCTGCTGGGCCAGGCCAAGCCGG - Intronic
961741613 3:129036522-129036544 TCTCCTGGGGCTCTCCATGCTGG + Intronic
962367405 3:134795596-134795618 TCGGCTTGGTCTCGGCCTGCGGG + Exonic
962377339 3:134869366-134869388 TCTGCATGACCTCACCATGATGG + Intronic
964652799 3:159030051-159030073 TCTGCTTGACCTCTCAATGCTGG - Intronic
971932976 4:33108860-33108882 TCTGCTTGTCCTCTGGATGCAGG + Intergenic
977202227 4:94130660-94130682 TCTTCTTGGCCTCTCTGTGCAGG - Intergenic
979809773 4:125022059-125022081 TCTTCTTGGCCTCACCGTACAGG + Intergenic
984924026 4:184791055-184791077 TCAGCATGGCCTAGACATGCAGG + Intronic
985584806 5:725174-725196 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985588550 5:753188-753210 TCAGCTGGGCCTCCCCATGGGGG + Intronic
985598309 5:809488-809510 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985603217 5:845627-845649 TCAGCTGGGCCTCCCCATGGGGG + Intronic
987324543 5:16800685-16800707 TCTGCTTGGCCTCACTACACTGG + Intronic
997590121 5:135067176-135067198 TCTGGGAGGCCTGGCCATGCCGG - Intronic
1000228516 5:159293256-159293278 TCTTCTTGGCCTCTTCATACGGG + Intergenic
1000606172 5:163330221-163330243 TGAGGTTGGCCACGCCATGCAGG + Intergenic
1001476988 5:172057546-172057568 TCTGCCTGGCCTCCTCATGCTGG + Intronic
1002564042 5:180100109-180100131 TCTGCTTGGCCCCGATGTGCAGG + Intergenic
1002804971 6:564612-564634 ACTGCTTGGCTTCCCCATCCCGG + Exonic
1003537166 6:6985459-6985481 TCTGCTTGCCCTCACCATACTGG - Intergenic
1006923471 6:37641028-37641050 TCTGCCTGGCTTTGCCATGGGGG + Intronic
1007329074 6:41089641-41089663 TCTGCTGGGTCTGGCCCTGCTGG - Exonic
1019309309 7:352535-352557 TCGGCTTGGCCTCACCTTGGAGG - Intergenic
1020097767 7:5378009-5378031 TCTGCTCGGCCGTGCCCTGCAGG + Exonic
1023891424 7:44394715-44394737 TCTGCTTTGCCTCTTCATGCTGG - Intronic
1023919743 7:44618875-44618897 TCTTCTTGGCCTCTCTGTGCAGG - Intronic
1024947434 7:54824153-54824175 TCTGCTTGGCCTGGAAATACTGG + Intergenic
1028177564 7:87675157-87675179 TGTGCTTAGCCTCCCCATGCTGG + Intronic
1028602696 7:92619523-92619545 TCTGCTTGGCCTCTACTTGTTGG + Intronic
1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG + Intergenic
1032387793 7:131536616-131536638 TCTCCTGGGCCTCTCCCTGCTGG + Intronic
1033167628 7:139054445-139054467 ATTGCTTAGCCTCCCCATGCTGG - Intronic
1038805550 8:30787814-30787836 TCAGCTTGGCCTCCCAAAGCTGG + Intronic
1039961866 8:42254682-42254704 TCTGCCTGGCCTCCCCATCTGGG + Intergenic
1040909404 8:52502844-52502866 TCTGCGTGGCCTCCAGATGCGGG - Intergenic
1042104316 8:65308483-65308505 TCTGCTGGGCCTCAGCATGCTGG - Intergenic
1044086300 8:87945964-87945986 TCTGCTCTGCCTGGCCCTGCAGG + Intergenic
1046828215 8:118715314-118715336 TCTCCTAGGGCTCACCATGCTGG + Intergenic
1049462015 8:142734652-142734674 TCTGCTGGGACTTGCCATGGGGG + Intronic
1052777231 9:32744074-32744096 CCTGCTTGGCTTCACCATTCTGG - Intergenic
1056278670 9:85018467-85018489 TCTCCTTGGCATTGCCATGTGGG + Intronic
1059403506 9:114085568-114085590 TCTGCGTGGTCTGGCCTTGCTGG + Intergenic
1191842543 X:65523583-65523605 CCTGCTTGGGCTCACCTTGCTGG - Exonic
1192314880 X:70043763-70043785 ACTGCTAGGTCTAGCCATGCAGG + Intronic
1192664120 X:73069692-73069714 TCTGCCTGGCCTCCCCATCTGGG + Intergenic
1196864268 X:120056745-120056767 ACTGCTTGGCCTCGTGATGAGGG + Intergenic
1196878831 X:120179585-120179607 ACTGCTTGGCCTCGTGATGAGGG - Intergenic
1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG + Intergenic
1200165096 X:154030415-154030437 TCTGTTTGGCCTTGGCATGGAGG + Exonic
1201511081 Y:14763823-14763845 TTTGTTTGGCATCTCCATGCTGG + Intronic
1202182520 Y:22151669-22151691 TCTGCTTGGCCTCCTCATTGTGG - Intergenic
1202208840 Y:22434733-22434755 TCTGCTTGGCCTCCTCATTGTGG + Intergenic