ID: 1103098587

View in Genome Browser
Species Human (GRCh38)
Location 12:118152485-118152507
Sequence CTGGAAGAGGTTTCCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103098575_1103098587 20 Left 1103098575 12:118152442-118152464 CCCTTGCCTACAGCCCTTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098579_1103098587 7 Left 1103098579 12:118152455-118152477 CCCTTGGTGGCCTACAGCCCTTG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098584_1103098587 -10 Left 1103098584 12:118152472-118152494 CCCTTGGTGACTACTGGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098577_1103098587 19 Left 1103098577 12:118152443-118152465 CCTTGCCTACAGCCCTTGGTGGC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098582_1103098587 -3 Left 1103098582 12:118152465-118152487 CCTACAGCCCTTGGTGACTACTG 0: 1
1: 0
2: 3
3: 31
4: 278
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098580_1103098587 6 Left 1103098580 12:118152456-118152478 CCTTGGTGGCCTACAGCCCTTGG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1103098578_1103098587 14 Left 1103098578 12:118152448-118152470 CCTACAGCCCTTGGTGGCCTACA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103098587 Original CRISPR CTGGAAGAGGTTTCCTCATT TGG Intronic
900383689 1:2399166-2399188 CTTGAAGAGCTTTGCTCATTTGG + Intronic
907279545 1:53337616-53337638 CTGGAAGCTGTGTCCTCAGTGGG + Intergenic
909513505 1:76481704-76481726 CAAGATGATGTTTCCTCATTGGG + Intronic
918138904 1:181703497-181703519 CTGGAATATGTTTCCTGTTTCGG - Intronic
920151275 1:203910470-203910492 CTGGCACAGGTTACCACATTTGG + Intergenic
920329805 1:205198430-205198452 GTGAAAGAGGTTTCCTCAGTGGG + Intronic
920395424 1:205642073-205642095 TGGGAAGAGCCTTCCTCATTGGG + Intergenic
921308744 1:213822192-213822214 CTGGAAGCCCTTTCTTCATTTGG + Intergenic
921801194 1:219404340-219404362 CTGGAAAAGGATTACTCTTTTGG - Intergenic
922880744 1:228978762-228978784 CTGGAAGAGCTTTCCTTACTCGG - Intergenic
923645207 1:235813627-235813649 CTGGAGAAGGTCCCCTCATTTGG + Intronic
1063268764 10:4484070-4484092 CTGCAAGAGGTTTCATAATTTGG + Intergenic
1066425681 10:35305779-35305801 GTGGAAGAAATTTCCTGATTGGG + Intronic
1066780176 10:38936805-38936827 ATGGACCAGGGTTCCTCATTGGG - Intergenic
1068006741 10:51399893-51399915 GGGGCAGAGGTCTCCTCATTGGG + Intronic
1069855589 10:71439308-71439330 CAGGAAGAGATATGCTCATTGGG + Intronic
1071662959 10:87524275-87524297 CTGGCAGAGGTTAGCTCATGGGG - Intronic
1076140305 10:128073228-128073250 ATGAGAGAGTTTTCCTCATTAGG + Intronic
1079492414 11:21003660-21003682 CTGGAAGAGATTTTGTCACTTGG + Intronic
1083225821 11:61283996-61284018 CTTGAAGATGTTTCCACATCAGG - Intronic
1085012151 11:73148524-73148546 CTGGAAGAGCTTTCCTGAGTTGG - Intergenic
1086226040 11:84510946-84510968 CTGGTAGGGGTCTCCTCTTTCGG - Intronic
1087478697 11:98671282-98671304 CTAGCAGAGGTTGCCTCATGAGG + Intergenic
1098010211 12:66043125-66043147 GTGGAAGAGATTTCCCCACTGGG + Intergenic
1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG + Intronic
1104879766 12:132062442-132062464 TATGAAGAGGTTTGCTCATTAGG - Intronic
1106475379 13:30093858-30093880 CTGGAAGACCCTTCATCATTTGG + Intergenic
1106915453 13:34508918-34508940 CCGGCAGAGGTTGCCTCATGAGG - Intergenic
1107799016 13:44086657-44086679 CTGATACAGGTTTCCTCAGTTGG - Intergenic
1109437636 13:62326894-62326916 CTTGAAGTAGTTTCCTTATTTGG - Intergenic
1111937802 13:94574492-94574514 CAGGAAGAAGTCTCCTGATTCGG - Exonic
1112812012 13:103229534-103229556 ATGGAAGAGGTGTCCTCAAGAGG - Intergenic
1112927366 13:104693170-104693192 TTGGAACAGGTTTACACATTTGG - Intergenic
1118505873 14:66411288-66411310 CTGGCAGAGCTTTCCTCAACAGG + Intergenic
1122075843 14:99233961-99233983 CTGGGAGAGGTTTCCACACGGGG + Intronic
1123396129 15:19938446-19938468 ATGGACGAGGCTTCCTCACTGGG - Intergenic
1125343991 15:38700513-38700535 CTGGAAGAGGTTGTCTTAGTAGG + Intergenic
1127320200 15:57836707-57836729 CTGGAAGAGGTTCCAGCATCTGG - Intergenic
1128272781 15:66326251-66326273 CTGGGAGAGCTTCCCTCATCAGG + Exonic
1129603703 15:77014552-77014574 CAGGACCTGGTTTCCTCATTGGG - Intronic
1129875250 15:78971097-78971119 CTGGAAGAGTTTTCCTGGTCGGG - Intronic
1133823580 16:9258238-9258260 CTGGGAGAGTTTTCTTCATGTGG - Intergenic
1139783148 16:69368305-69368327 CTGGAAGCAGTCTCCTCCTTAGG - Intronic
1140867143 16:79072924-79072946 GTGGAAGTGTTTTCCCCATTTGG + Intronic
1143996655 17:11012276-11012298 CTTGAAGTGTTTTCCTCACTTGG - Intergenic
1152535737 17:80949462-80949484 CTGGAAGAATTTTGCTGATTTGG + Exonic
1152750048 17:82058490-82058512 CTGGCAGAGGCTTCCCCAGTGGG - Intronic
1152779935 17:82222480-82222502 CTGAATGATGTTTCCTCATGTGG - Intergenic
1153871766 18:9327806-9327828 CTGGCAGAGGTTGCTTCATTAGG + Intergenic
1154088974 18:11339059-11339081 CTGTCAGTGGTTTCCTCACTTGG - Intergenic
1155918999 18:31584218-31584240 ATGGAAGAGATTTCTCCATTTGG - Intergenic
1157747222 18:50146478-50146500 CTGGTGCAGGTTTCCTCACTGGG - Intronic
1157953597 18:52068864-52068886 TTGGAAGATGTTTAATCATTGGG + Intergenic
1162789623 19:13056068-13056090 CTGGAAGCAATTTTCTCATTAGG - Intronic
926036357 2:9638807-9638829 CTGCAAAAGGTTTCTTCACTGGG - Intergenic
926877701 2:17501692-17501714 CTTTTAGATGTTTCCTCATTTGG - Intergenic
928886298 2:36152332-36152354 CTGGAAGTGCTTTCTTCACTTGG - Intergenic
932426927 2:71643763-71643785 GAGGAAGAGGTTTCAGCATTTGG - Intronic
933823307 2:86135055-86135077 CTGGTAGAGGTTCTTTCATTTGG + Intronic
936765105 2:115837781-115837803 CTGATAGAATTTTCCTCATTTGG - Intronic
936767611 2:115872563-115872585 CTGGAAGAGGGTTTCTAATCTGG - Intergenic
938518771 2:132043760-132043782 ATGGACCAGGTTTCCTCACTGGG + Intergenic
941989428 2:171540671-171540693 GTGGTAGAGGTATTCTCATTCGG + Intronic
943294998 2:186127079-186127101 CTGGGAGAGCCTTTCTCATTAGG - Intergenic
948198086 2:236110001-236110023 TGGGAAGATGTTTCCTAATTTGG + Intronic
948720257 2:239894839-239894861 ATGGAAGAGGGCTCCTGATTTGG - Intronic
1169874876 20:10286270-10286292 CTGGAGGAAGATGCCTCATTTGG + Intronic
1171114596 20:22513706-22513728 CTGGAACGGGTTTCCTAGTTTGG + Intergenic
1173197755 20:40930011-40930033 CTTGAAGAGGCTTCCCCACTAGG + Intergenic
1177906026 21:26972304-26972326 CTGGAAGAGGGTTCCTTCCTGGG - Intergenic
1179818298 21:43922093-43922115 ATGGAAAAGGTTTCCTTTTTTGG + Intronic
1182920722 22:34076550-34076572 CTCAAAGAGTCTTCCTCATTGGG - Intergenic
1184980462 22:48091794-48091816 CTGGAAGGGGTTTCCCCGTCTGG + Intergenic
949875848 3:8625557-8625579 CTTAAAGAGGTTTTCTCCTTTGG + Exonic
953201572 3:40782472-40782494 GTGGGAGAGGGTTCCTCATGAGG - Intergenic
953372923 3:42405625-42405647 TGGAAAGAGGTTTGCTCATTAGG + Intronic
953386041 3:42506134-42506156 ATGGGGGACGTTTCCTCATTAGG + Intronic
954775445 3:53013300-53013322 CTAGAAGAGTTTTACTCTTTAGG - Intronic
956617244 3:71184612-71184634 TTGGAAAAGGGTTCCTCTTTTGG - Intronic
959692972 3:109219293-109219315 CTGGGAGATGTTTCCCAATTAGG - Intergenic
960610088 3:119547879-119547901 CTGGAAGAGCTTTACCCATTTGG - Intronic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
963337097 3:143987912-143987934 CTCGAAGTTGTTTCCTCCTTTGG + Intronic
973849985 4:54952021-54952043 CTGGAAGAGGTTGGTTCATGAGG - Intergenic
976526260 4:86093227-86093249 CTGGAAAATGTTTCCTCTCTGGG + Intronic
980488760 4:133496899-133496921 CAGGGAGAGGTTTACACATTAGG - Intergenic
982545191 4:156724603-156724625 CTTGAAGATGGTGCCTCATTGGG - Intergenic
984628848 4:182039310-182039332 CTGGAAGTGGTTTCCTGAGCAGG - Intergenic
985036016 4:185840811-185840833 CTGGAAGATGTTCACTCACTAGG + Intronic
986100538 5:4605902-4605924 CTGGAAGAGGTTTTCCCTTTGGG + Intergenic
988014226 5:25531410-25531432 CTGAAACGGGTTTCCTCTTTCGG - Intergenic
991166672 5:63570888-63570910 CTGAAAGTGGCTTCCGCATTGGG - Intergenic
994739538 5:103600679-103600701 CTGCAAGCAGTTTCCTCATAAGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996023744 5:118620454-118620476 CTGAGTCAGGTTTCCTCATTGGG - Intergenic
996722225 5:126641116-126641138 CTAGCAGAGGTTGCCTCATGAGG - Intergenic
996725487 5:126670270-126670292 CAGAAAGAGGTTTCCTCACTAGG - Intergenic
999371119 5:151055981-151056003 CTGGAAGAGAGGTCCCCATTCGG - Intronic
999655342 5:153805391-153805413 CTGTAAGAGATTTTCTCCTTTGG - Intronic
1000912989 5:167044895-167044917 CTGGAAGAGTTGTCCACACTCGG - Intergenic
1003788975 6:9521209-9521231 CTGCAAGAGGTTTTCACATCAGG - Intergenic
1009869663 6:69437995-69438017 CTGAAAGAGGTTTTACCATTAGG - Intergenic
1018248241 6:161842535-161842557 AAGGAAGAGGTGTCCTCAGTGGG - Intronic
1018298900 6:162378869-162378891 CTGGAAGGGGATTCCACACTTGG + Intronic
1020621308 7:10522898-10522920 ATGGAAGATGTTTCTTCACTTGG + Intergenic
1023250660 7:38257257-38257279 GTGGAAAACATTTCCTCATTTGG - Intergenic
1023371859 7:39519707-39519729 CTGGGAGATGTTTTCTCGTTTGG + Intergenic
1024988158 7:55213645-55213667 CTGGAAGAGGTTTTCCCTTTGGG + Intronic
1027722060 7:81755979-81756001 CTGCAAGATGATTCTTCATTAGG - Intronic
1027742461 7:82027863-82027885 CTGGCAGAGGTTGGCTCATGAGG + Intronic
1028159699 7:87471756-87471778 TTGGAAGAAGTCTCCTCATCTGG - Intronic
1030946288 7:115725728-115725750 TTGGAAGACCTTTCCTCATACGG + Intergenic
1039222107 8:35343570-35343592 CTGGGAAATGTTTCCCCATTTGG + Intronic
1041346303 8:56902054-56902076 CTGCAAGCGGTTTTCACATTGGG + Intergenic
1042191464 8:66191745-66191767 CTGGAAGAGGCCTGCTCATCTGG - Intergenic
1043201483 8:77374611-77374633 CTAGAAGAGGTTGGCTCATGTGG - Intergenic
1043238335 8:77898715-77898737 CTGGCAGAGGTTTGTTCATGAGG - Intergenic
1044164261 8:88961716-88961738 CTAGAAGAGGTTTGTTCATGAGG - Intergenic
1046195759 8:110860864-110860886 CTGAAAGCTGTATCCTCATTGGG + Intergenic
1046705518 8:117446419-117446441 CTTGAACAAGTTTCTTCATTTGG - Intergenic
1047897271 8:129380753-129380775 CTGGCAGAGGTTGGTTCATTAGG + Intergenic
1049666870 8:143848730-143848752 CTGGAAGAGGATGCATCATGTGG - Intergenic
1050596579 9:7210637-7210659 ATGGAAGAGGATTGCTTATTTGG + Intergenic
1051031511 9:12685686-12685708 TTGGAAGAGATTTCTACATTAGG - Intronic
1051528012 9:18068893-18068915 CTAGAAGAGGTTACCTAACTTGG + Intergenic
1051699579 9:19807356-19807378 CAGGAAGTTGTTTCCTAATTTGG + Intergenic
1052591874 9:30507567-30507589 CTAGCAGAGGTTGCCTCATGAGG - Intergenic
1053137610 9:35661266-35661288 CTTGAAGAGCTGTCCTTATTAGG + Exonic
1056817677 9:89813219-89813241 CTGGATGAGGTCTCGTCCTTGGG - Intergenic
1058268541 9:102938768-102938790 CTGAAAGAGGTGTCCTCAAATGG + Intergenic
1062224866 9:135444189-135444211 AAGGAAGAGGTTTTTTCATTCGG + Intergenic
1186801408 X:13096167-13096189 CTGGCAGAGGCTTCCTTATTAGG + Intergenic
1187261070 X:17685819-17685841 CTGGAAGACTTTTCCTATTTTGG - Intronic
1187319627 X:18227965-18227987 CTGGAGGAGGCCTCCTAATTAGG + Intergenic
1196069842 X:111508742-111508764 CAGGAAAAGGTTACCTCAATGGG - Intergenic
1198490544 X:137135921-137135943 CTGGAAGAGGTTGGTTCATGAGG - Intergenic
1199518086 X:148701485-148701507 CTGGATTGGCTTTCCTCATTTGG - Intronic
1199669855 X:150135454-150135476 CTTGAAGAATTTTGCTCATTAGG - Intergenic
1201716226 Y:17046807-17046829 GTGGAAGAGGATTCCTCACAGGG + Intergenic
1202034682 Y:20620243-20620265 CTGGAAGGTGTCTCCTAATTAGG + Intergenic