ID: 1103100021

View in Genome Browser
Species Human (GRCh38)
Location 12:118165315-118165337
Sequence GTGTGGGATGAATAAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103100021 Original CRISPR GTGTGGGATGAATAAATGCC TGG (reversed) Intronic
900896028 1:5483557-5483579 CTCTGTGATGAATAAATGGCAGG - Intergenic
901380747 1:8872272-8872294 GTGAGGGATGCATATTTGCCTGG - Intronic
904438504 1:30514806-30514828 GTGTGGGACGGATAAATGAGAGG + Intergenic
905537099 1:38730690-38730712 GTGTGTGATGAGTAAAAGCTTGG - Intergenic
905965073 1:42085813-42085835 GAGGGGGAAGAAGAAATGCCTGG + Intergenic
906025970 1:42674176-42674198 GTGAGGAAAGCATAAATGCCCGG + Intronic
906775870 1:48529062-48529084 GTGTGGAATGAATAAATAGTGGG - Intergenic
910250452 1:85192596-85192618 TTGTGGAGTAAATAAATGCCTGG - Intronic
916434814 1:164768303-164768325 GTGTGGGAAGAATACAAGCTTGG - Intronic
916746534 1:167689018-167689040 TTTTGTGATGAATGAATGCCAGG - Intronic
916749997 1:167714795-167714817 GTGTGGGGTGGGTAAAAGCCTGG - Intergenic
919157764 1:193788357-193788379 GTGTGAGGTGAAGAAAAGCCAGG - Intergenic
921646187 1:217621029-217621051 GTGTGGCCTAAATAAATGCATGG - Intronic
923634391 1:235680949-235680971 TTGTTGGATGAATAAATGTATGG - Intronic
1062836355 10:638744-638766 GTCCTGGGTGAATAAATGCCAGG - Intronic
1064506753 10:16039358-16039380 GTGTGGGCTAATTACATGCCTGG - Intergenic
1064621544 10:17222490-17222512 GCGTTGGATGAGTAAATGCCAGG - Intergenic
1065489266 10:26266253-26266275 TTGTGGGATGAATTAATTCCTGG + Intronic
1066150205 10:32608051-32608073 GGAAGAGATGAATAAATGCCTGG - Intronic
1071824351 10:89309899-89309921 GTGTTGGATGAATATATGAAGGG - Intronic
1072324887 10:94288202-94288224 GTGAGGGATGAAAAACTACCTGG - Intronic
1075080215 10:119378592-119378614 CCGTGTGGTGAATAAATGCCCGG + Intronic
1076026901 10:127122970-127122992 GTGAGGGATGAATTTAGGCCAGG + Intronic
1076237949 10:128880379-128880401 TTGTTGGATGAATAAATGAAAGG + Intergenic
1079514018 11:21245577-21245599 GTGCAGTGTGAATAAATGCCAGG - Intronic
1080412620 11:32040077-32040099 GTGTGGCAACAATAAAGGCCTGG - Intronic
1084545748 11:69814274-69814296 GTGTGGGCTGAAGAGATGCAGGG + Intronic
1084804000 11:71566255-71566277 GCGTGGGATGAATTAATTCAGGG - Exonic
1085080403 11:73629208-73629230 ATGTGTGCTGAATAAATGCTGGG + Intergenic
1085336039 11:75696636-75696658 CAGAGGGATGAATAAATTCCTGG - Intergenic
1088899423 11:114103941-114103963 GTGTGGGCTGAATGAATGTGTGG + Intronic
1089940019 11:122406625-122406647 GTCTGGGATGACATAATGCCTGG + Intergenic
1091111707 11:132975360-132975382 GTTTTGGAGGAAAAAATGCCAGG + Intronic
1091554062 12:1558843-1558865 GTGTTAAATGAATAAATGGCTGG + Intronic
1095214984 12:39537863-39537885 CTGTGGGATAAAAAAATTCCTGG + Intergenic
1097381848 12:58904734-58904756 GTGTTGGATGAATGAATGGATGG - Intronic
1097596682 12:61641906-61641928 GTGTTGGATGAATGAATGGTTGG - Intergenic
1100002823 12:89858029-89858051 GTGTGTGATGAATAAATACAGGG + Intergenic
1102238833 12:111310962-111310984 GTGCTGGATGAATACCTGCCAGG - Intronic
1103100021 12:118165315-118165337 GTGTGGGATGAATAAATGCCTGG - Intronic
1104244331 12:127023083-127023105 GTGAGGGTTCATTAAATGCCAGG - Intergenic
1105400596 13:20091215-20091237 TTGTTGAATGAATAAATGCCTGG - Exonic
1105765552 13:23555125-23555147 GTGTTGGATGAAGCAGTGCCAGG + Intergenic
1107004760 13:35596864-35596886 TTGTGGAATTAATGAATGCCAGG + Intronic
1107424060 13:40275485-40275507 GTGGAGGATGTATAAATTCCAGG - Intergenic
1107973024 13:45662526-45662548 GTGTAGCATCAATGAATGCCAGG - Intergenic
1108272333 13:48773777-48773799 TTGTTCTATGAATAAATGCCTGG - Intergenic
1109138213 13:58680267-58680289 ATGTGTGCTGAATAAATGCAGGG - Intergenic
1109755451 13:66752888-66752910 CTGTGGGAAGAACAAATGCCAGG + Intronic
1111763809 13:92500334-92500356 TTGTGTGCTGAATACATGCCAGG - Intronic
1114551372 14:23534557-23534579 GTGTGTGATCCATAAAGGCCTGG + Exonic
1119031186 14:71193909-71193931 ATGTGTGCTGAATAAATGCCAGG + Intergenic
1120160200 14:81137564-81137586 GTCTGGGATGACTCAATGCCTGG - Intronic
1122030865 14:98910747-98910769 GTGTTGAATGAATAAATGGATGG + Intergenic
1125171796 15:36773599-36773621 GTATGGGATGAAATAATTCCAGG + Intronic
1132045114 15:98557234-98557256 GTGTGGGATGAAGAAATGCCTGG - Intergenic
1134687973 16:16171937-16171959 GGGTGGGATGGATAAATGAGTGG + Intronic
1134687998 16:16172046-16172068 GAGTGGGATGGATAAATGAGTGG + Intronic
1134688003 16:16172067-16172089 GGGTGGGATGGATAAATGAGTGG + Intronic
1134688013 16:16172109-16172131 GGGTGGGATGGATAAATGAATGG + Intronic
1134688021 16:16172151-16172173 GAGTGGGATGGATAAATGGGTGG + Intronic
1134688026 16:16172172-16172194 GGGTGGGATGGATAAATGAGTGG + Intronic
1134688035 16:16172214-16172236 GAGTGGGATGGATAAATGGGTGG + Intronic
1134688042 16:16172235-16172257 GGGTGGGATGGATAAATGGGTGG + Intronic
1134688047 16:16172256-16172278 GGGTGGGATGGATAAATGAGTGG + Intronic
1134688090 16:16172430-16172452 GGGTGGGATGGATAAATGAGGGG + Intronic
1134688103 16:16172476-16172498 GGGTGGGATGGATAAATGGGTGG + Intronic
1136221352 16:28831087-28831109 GTGTTGGATGAAGAAATGGATGG + Intronic
1140983722 16:80137545-80137567 GGGTGGGATGAATAGGTGCTGGG - Intergenic
1143423055 17:6811330-6811352 GTGTGAAATGTATACATGCCAGG + Intronic
1146638236 17:34521648-34521670 TTGTTGAATGAATAAATGCATGG + Intergenic
1149116784 17:53106828-53106850 GTGTGGGATGAATATGTACAAGG + Intergenic
1151912515 17:77093265-77093287 GTGTGTGATGAATGAATATCTGG + Exonic
1154324552 18:13380427-13380449 GTGTGGGAGGAATGCAAGCCAGG - Intronic
1157485766 18:48085782-48085804 CTCTGGGACGAATAAATGTCTGG + Intronic
1158250526 18:55482433-55482455 GTGTGGGATCACTACATCCCTGG - Intronic
1158532304 18:58274397-58274419 GTGTGGGATGAAGGAGTGCTTGG + Intronic
1159038192 18:63297607-63297629 GTGTAGGATGAGTAAATGTTTGG + Intronic
1159148581 18:64488718-64488740 TTGTGGGATGAATAGAGGTCTGG + Intergenic
1159226745 18:65547929-65547951 GTGGGATATGAATAAATGCTTGG - Intergenic
1159981950 18:74792811-74792833 GTGTGAAATCAATAAAAGCCAGG + Intronic
1164382405 19:27746117-27746139 ATGTGTGCTAAATAAATGCCGGG + Intergenic
1167509321 19:49887920-49887942 GTGTGGGATTATTGAAAGCCTGG + Intronic
925350414 2:3197486-3197508 GGGTGGTCTGATTAAATGCCAGG - Intronic
926487200 2:13476555-13476577 GTATGAAATGTATAAATGCCTGG + Intergenic
927523872 2:23720151-23720173 TTGTGGGAAGAATGAATGCCAGG - Intergenic
931314411 2:61114271-61114293 ATGTGTGCTGAATAAATGCTGGG - Intronic
935540050 2:104338207-104338229 GGGTGGGATGAATCAAAGGCGGG - Intergenic
936791623 2:116159480-116159502 GTGTGGGATCAAGAAATCCCTGG - Intergenic
939583288 2:143977039-143977061 GTGAGGAATGAAGAAATGTCTGG + Intronic
940954117 2:159709718-159709740 TTGTGGGATGAATAAAAGAGGGG + Intergenic
941105464 2:161346877-161346899 GTGTGTGAGGAATCAATGCATGG - Intronic
944104948 2:196069532-196069554 GTGAAGGAAGAAGAAATGCCAGG + Intergenic
944906727 2:204269343-204269365 GTGTTGAATGAATAAAAGTCAGG - Intergenic
946156330 2:217809150-217809172 ATGAGGGATGAATAAATGCAGGG + Intronic
947114550 2:226755024-226755046 TTATGGGATCAATAAATGTCAGG - Intronic
947427069 2:229993480-229993502 GTGTGGGATGGAAATATGCGGGG + Intronic
1172912467 20:38420155-38420177 GTGTGGGATGTAAAAATCCATGG - Intergenic
1173841568 20:46160799-46160821 GTGAGGGCTGAATAAACGGCAGG + Intergenic
1173892272 20:46521987-46522009 TTGTTGGATGAATAAATGAATGG - Intergenic
1183224477 22:36540095-36540117 GTGTGGGGTACATCAATGCCAGG + Intergenic
1183465042 22:37975525-37975547 GTGTGGGAGGGATGACTGCCTGG + Intronic
951137010 3:19116059-19116081 ATGTGGGATGAATAAGTGTTGGG - Intergenic
951508083 3:23471418-23471440 GTGTGGGATCAGTAAATGTGTGG + Intronic
953849608 3:46455685-46455707 GTGTGGGATGAATCAAGGTGGGG - Intronic
954673053 3:52300924-52300946 ATGTGGAATGAATGAAGGCCTGG + Intergenic
954845844 3:53555217-53555239 TTGTGAGATGAATCAATGCTGGG + Intronic
956622345 3:71233996-71234018 GTGTGGGTTGTATAAAAACCAGG - Intronic
957792998 3:84962346-84962368 GTGTTTGATGAATAAATGTGAGG - Intronic
958548334 3:95586842-95586864 TTGAGGGATGTCTAAATGCCTGG + Intergenic
959623078 3:108420212-108420234 ATGGAGGATCAATAAATGCCAGG + Intronic
960561011 3:119084292-119084314 GTGTGGGGTGCCTAAATGCTAGG + Intronic
962179485 3:133190746-133190768 CTGTGTGACCAATAAATGCCAGG - Intronic
963210179 3:142680642-142680664 GTGTGGTAAGTATAAATACCTGG - Intronic
966311392 3:178597927-178597949 GGGTGGGAGGAAGAAATGGCTGG + Intronic
967277609 3:187791788-187791810 TTGTGGGATGAATAAGTGAACGG + Intergenic
967585056 3:191203219-191203241 GTGTGTGTTGAATGAATGCATGG - Intronic
968705975 4:2077862-2077884 GTGTGGGGTGGATGAATGCAGGG + Intronic
969486289 4:7474172-7474194 GTGTTGGATGAATGAATGAGTGG + Intronic
969662167 4:8536682-8536704 GTGTGGGATAAAGAAGTGGCAGG + Intergenic
970887928 4:21008020-21008042 GTCTGGGATGATTAAAAACCTGG + Intronic
971470523 4:27021131-27021153 GTGTTGGATGAATGAATGGAAGG - Intronic
971530228 4:27678559-27678581 GTATTGGATGAATAAATGGTTGG + Intergenic
971567647 4:28166501-28166523 GTGTTTGATAATTAAATGCCTGG + Intergenic
972397530 4:38670839-38670861 TTGTGAGATGAATAAATGAATGG - Intronic
972689587 4:41383442-41383464 GTGTGGGAGGAGTTAAAGCCAGG + Intronic
974309754 4:60190082-60190104 GTGTGATATAAATAAATGCTGGG - Intergenic
975390781 4:73814907-73814929 TTGAGGGATGAATAAATGAATGG + Intergenic
975575798 4:75861297-75861319 GTTTGAGATGATTAAATGCAGGG - Intronic
977913751 4:102566819-102566841 GTATGTGATGAACAAATGACAGG - Intronic
978404078 4:108361528-108361550 GGGAGGGAAGAATAAAGGCCCGG - Intergenic
980628472 4:135406162-135406184 ATGTGTGCTGAATAAATGCCAGG + Intergenic
983386539 4:167070274-167070296 TTGTGGGAAGCATAAATGGCAGG + Intronic
983686377 4:170413798-170413820 GTGGGGGAAGAATATTTGCCAGG + Intergenic
984026611 4:174550599-174550621 ATGTGTGCTGAATAAATGCCAGG - Intergenic
986052173 5:4100500-4100522 GTGTGGGCGGGGTAAATGCCAGG + Intergenic
989028682 5:37094095-37094117 ATGTGTACTGAATAAATGCCAGG + Intergenic
991141198 5:63245391-63245413 ATGAGGAATGAATAAATTCCTGG + Intergenic
993233660 5:85273852-85273874 GTGTAGGATAAATAATTGCTAGG + Intergenic
993358671 5:86946229-86946251 ATGGGGGATGAATAACTGCATGG + Intergenic
993535730 5:89083850-89083872 TTCTGGGATGAATAAATTCTGGG - Intergenic
994035579 5:95196177-95196199 GTCTGTGCTGAATAAATGCAGGG + Intronic
998314598 5:141170850-141170872 CTGTGGGATGAATAAGTGATAGG + Intergenic
1000581375 5:163038971-163038993 GTGAGGAATGAATAAATTCAAGG - Intergenic
1001318749 5:170663274-170663296 GTGTGGGATGATTTAAAGGCTGG - Intronic
1003247618 6:4397723-4397745 TTGTTGGGTGAATAAATGCGTGG - Intergenic
1004072286 6:12311569-12311591 TTGTGTGATGAATAAAGGGCCGG - Intergenic
1004287160 6:14331984-14332006 ATGTTGAATGAATAAATGACTGG + Intergenic
1006383948 6:33718469-33718491 GTGGGGGATGAATATCTCCCAGG + Intergenic
1008114067 6:47527201-47527223 GTGTGGTAGGCATAAATGCCTGG + Intronic
1011624281 6:89270752-89270774 GTGTGGAATAAATAAAAGTCGGG - Intronic
1012051793 6:94355321-94355343 GGGTGGGATGGAAAAATCCCAGG - Intergenic
1012241767 6:96880759-96880781 ATGTGGGATGAAAGAATGCAAGG + Intergenic
1015149777 6:130023960-130023982 GTTTGGGATAAATAAATTTCCGG - Intronic
1016310184 6:142725630-142725652 GCATGGGTTGAAGAAATGCCTGG - Intergenic
1016840114 6:148517313-148517335 CTGTGGGCTGACTTAATGCCAGG - Intronic
1026559562 7:71437034-71437056 ATGTGTGCTGAATAAATGCCGGG - Intronic
1026963098 7:74422252-74422274 GTGAGGATTGAATGAATGCCTGG - Intergenic
1027630865 7:80603836-80603858 GAGTGGGATGATTAAATGGAAGG + Intronic
1030246751 7:107391166-107391188 ACGTGTGCTGAATAAATGCCCGG + Intronic
1032167394 7:129556190-129556212 GAGTGGGGTGAACAAAGGCCTGG + Intergenic
1034030822 7:147761529-147761551 GGGTTGGATGAATTAATGGCAGG - Intronic
1037039689 8:14216029-14216051 ATCTGTGCTGAATAAATGCCTGG - Intronic
1038507320 8:28095814-28095836 GTGTGGGCTCCATAATTGCCAGG + Intronic
1039114480 8:34077031-34077053 GTGTGGGAGGTATAAATGGGGGG - Intergenic
1039760927 8:40574533-40574555 TTGTGGGAGGAACAAATGCCAGG - Intronic
1041402033 8:57456447-57456469 ATGTGTGCTGAATAAATGCCGGG + Intergenic
1041403222 8:57466470-57466492 ATGTGTGCTGAATAAATGCCGGG + Intergenic
1044065937 8:87700252-87700274 ATGTGTGCTGAATAAATGCCAGG + Intergenic
1044276866 8:90311386-90311408 ATGTGTGCTGAATAAATGCTGGG + Intergenic
1048624643 8:136171836-136171858 GTCAGGGATTAGTAAATGCCAGG + Intergenic
1048871445 8:138802764-138802786 GTGTGGGCTGAATACCTGGCAGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049464314 8:142744095-142744117 GTGGGGGATGGATAGATGGCTGG + Intergenic
1049464440 8:142744530-142744552 GTGTGGGATGGATAGGTGGCTGG + Intergenic
1053032584 9:34793961-34793983 GAGTGGGATAAATAAAGCCCTGG + Intergenic
1053838258 9:42164187-42164209 GTGTGGGATGAATACTTCCATGG + Intergenic
1054095204 9:60894312-60894334 GTGTGGGATGAATACTTCCGTGG + Intergenic
1054116670 9:61170237-61170259 GTGTGGGATGAATACTTCCATGG + Intergenic
1054591085 9:67012324-67012346 GTGTGGGATGAATACTTCCATGG - Intergenic
1058431223 9:104921778-104921800 AAGTGGGATGAATTAAGGCCAGG + Intronic
1058760963 9:108131851-108131873 GAGTGGTGTGAAAAAATGCCTGG + Intergenic
1059729519 9:117043234-117043256 GTCTAGCATGAATAAATGCTTGG + Intronic
1062169400 9:135126618-135126640 CTGCGTGATGAATAAATGGCCGG - Intergenic
1185535302 X:856543-856565 CAGCGGGATGAATAACTGCCTGG - Intergenic
1190569539 X:51767622-51767644 TTGTGAGATGAAAAAATGCTGGG + Intergenic
1190824454 X:54004260-54004282 AAGATGGATGAATAAATGCCTGG + Intronic
1195966978 X:110437771-110437793 CTCTGGGCTGAAGAAATGCCAGG + Intronic
1196765800 X:119241687-119241709 GTGTGAGACAAATAAAAGCCAGG - Intronic
1199490571 X:148395297-148395319 GTGTGGTATGGATATATGACAGG - Intergenic
1200336007 X:155352200-155352222 GTGTTGGAAGAATAAATGAATGG + Intergenic
1200350463 X:155489027-155489049 GTGTTGGAAGAATAAATGAATGG - Intergenic
1200891547 Y:8329514-8329536 ATGTGTGTTGAATGAATGCCAGG + Intergenic
1200921133 Y:8614424-8614446 GTGTGGGATGGATTGATGCTTGG + Intergenic
1201682330 Y:16661123-16661145 GCTTGGGATGAATGAATTCCAGG + Intergenic