ID: 1103103671

View in Genome Browser
Species Human (GRCh38)
Location 12:118203763-118203785
Sequence CTACTTCTTTTTACAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103103671 Original CRISPR CTACTTCTTTTTACAACAGG TGG (reversed) Intronic
903717185 1:25376396-25376418 CTATTTCTTGTCTCAACAGGTGG + Intronic
905949749 1:41939597-41939619 CTCCTTCTTTTTCTAACAGATGG + Intronic
908164092 1:61440457-61440479 CAACTTCTTTCTTCAAAAGGAGG - Intronic
909281402 1:73759102-73759124 CTACTTTTTTTTTCAATTGGAGG + Intergenic
910003254 1:82362297-82362319 ATACTTCTTTTTACTAGAGCAGG + Intergenic
910010466 1:82454821-82454843 CTACTGCTATTTAAAACATGTGG + Intergenic
910354252 1:86337202-86337224 CTACCTCTTTTTACCATAGTTGG + Intergenic
912010723 1:104958129-104958151 CTCCTTCTTTTGAGCACAGGTGG - Intergenic
912621971 1:111170242-111170264 CTACTTCTTTTTATATTAGAGGG + Intronic
913340697 1:117755039-117755061 CTGCTCCTTTCTAAAACAGGTGG + Intergenic
917942628 1:179937795-179937817 CTCATTCCTTTTTCAACAGGTGG + Intergenic
918521899 1:185423858-185423880 CTACTGTTGTTTCCAACAGGTGG - Intergenic
918733049 1:188022618-188022640 CTACTTCTTTTAGCATCAGAAGG + Intergenic
919506626 1:198407101-198407123 CTGCTTCTTGCTACAACAGTGGG - Intergenic
919551243 1:198990662-198990684 ATACTTCTTTTTCCATCAGTTGG - Intergenic
920448675 1:206040248-206040270 CAACTTCTTTTTACAACCCTTGG - Intronic
921521705 1:216163972-216163994 CTATTTCTTTTCTCAGCAGGAGG + Intronic
923183865 1:231550538-231550560 CCACTTCTCTTTCCACCAGGGGG - Intronic
1063300811 10:4847241-4847263 CTCCTTCTTTTTAAAACAGAGGG + Intronic
1064019553 10:11798129-11798151 CTCATTCTTTTTAGAACAGTTGG + Intergenic
1064121331 10:12622597-12622619 CTACTCCTTTTTGCAAGTGGAGG + Intronic
1066053451 10:31659106-31659128 CTATTTTTTTTTAAAAAAGGCGG + Intergenic
1067343314 10:45421113-45421135 GTCCTTCTTTTTACAAAAGCGGG + Intronic
1068151267 10:53135433-53135455 CTTGTTCTTTTGACCACAGGCGG - Intergenic
1068539729 10:58278359-58278381 CTATTTTTTTTTTCAACAGATGG - Intronic
1070212314 10:74337636-74337658 CTACTTTTTATTACTACAGCTGG + Intronic
1072929899 10:99653089-99653111 ATACTTCTTTATTCAAAAGGTGG + Intergenic
1073898776 10:108194524-108194546 CTACTTCAATTTACCACAGCAGG + Intergenic
1075170117 10:120105442-120105464 TTACTTCTTTTGAAAACAGCTGG + Intergenic
1078816064 11:14823501-14823523 CCACTTCTTTATATAACAGTTGG - Intronic
1079937450 11:26635211-26635233 CTACATCTTTTCAAAAAAGGGGG + Intronic
1084772230 11:71350799-71350821 CTACTTTGATTTACAAAAGGAGG - Intergenic
1089621315 11:119723990-119724012 CCACTTCTTTTTCCAATAAGGGG + Intronic
1090539634 11:127687037-127687059 CTTCTTCTTTTTATATTAGGAGG - Intergenic
1092507227 12:9115844-9115866 CTCCTTCTTTCTGCAACATGGGG - Exonic
1093804570 12:23416371-23416393 CTACTTCTTATTTAAACAGTGGG - Intergenic
1093863014 12:24190998-24191020 CTTCTTCTTTTTTTAAGAGGTGG + Intergenic
1095047051 12:37518483-37518505 CTACATCTATATACAACATGAGG + Intergenic
1097104344 12:56612363-56612385 CTACTTCTTTTTCCAACCCTAGG - Intronic
1097616368 12:61888889-61888911 CTATTTCTTATTCCAAAAGGTGG + Intronic
1100079336 12:90828537-90828559 CTACTTCTTTTACCTACAAGGGG - Intergenic
1100337549 12:93645940-93645962 AAACTTCTTTTGACAATAGGAGG + Intergenic
1101666051 12:106816156-106816178 CTCTTTCTTTTTACAGGAGGGGG - Intronic
1101756072 12:107621355-107621377 CTACTTATTTTTAAGTCAGGTGG - Intronic
1102273473 12:111560798-111560820 CTACTTCTTTTTCCAGTGGGTGG - Intronic
1102615923 12:114154090-114154112 ATACGTCTTTGTACAGCAGGAGG + Intergenic
1103103671 12:118203763-118203785 CTACTTCTTTTTACAACAGGTGG - Intronic
1103889243 12:124226179-124226201 CTGTTTCTTTTTAAAACATGTGG - Intronic
1111289532 13:86146092-86146114 AGACTTCTTTTTGAAACAGGTGG - Intergenic
1114586511 14:23819215-23819237 CGATTTCTTTTTACAAGAAGTGG + Intergenic
1115000979 14:28419409-28419431 CTTCTTCTTTATACAACACTGGG + Intergenic
1117884679 14:60348126-60348148 CTTTTTCTTTTAACAACAGTAGG + Intergenic
1122126909 14:99584062-99584084 TTTCTTCTTTTTAGAAAAGGGGG + Intronic
1127472237 15:59300594-59300616 CAGCTTCCTTTTACAACATGTGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130336704 15:82962840-82962862 CTACTTTTTATTAAAACAAGAGG + Intronic
1131023868 15:89123054-89123076 CCAGTTCTTTTTAATACAGGTGG - Intronic
1131767400 15:95693935-95693957 ATACTTTTTTTTACACCAGGCGG - Intergenic
1131806494 15:96127488-96127510 TTACTTCATTTTACATCAGAAGG - Intergenic
1137909023 16:52356961-52356983 CTACTTCTGTTTACAATAAATGG - Intergenic
1141286605 16:82678662-82678684 CTACTTCTGTGCAAAACAGGTGG + Intronic
1143983562 17:10891875-10891897 CTACTTTTTTTTACTGCATGGGG + Intergenic
1144227480 17:13163963-13163985 ATACTTCCTTTTGCAAGAGGTGG + Intergenic
1147699445 17:42383510-42383532 CTACTCCTTTTAAAAACTGGAGG + Intronic
1148824411 17:50381737-50381759 CTTCATCTTTTCACAACAGCTGG - Exonic
1156452290 18:37273808-37273830 CTACTTCTTTCTTCCACATGGGG - Intronic
1156755340 18:40516898-40516920 CTAGTTCTATTTAAACCAGGTGG + Intergenic
1157008805 18:43621113-43621135 TTACTTCTTTGAACAACAGATGG + Intergenic
1158907545 18:62028397-62028419 CTATTTCTTTTTAGAGCAGATGG - Intergenic
1162098696 19:8326471-8326493 TTTTTTTTTTTTACAACAGGTGG - Intronic
925859451 2:8160657-8160679 GTATTTCTTTTTACAGCAGAGGG - Intergenic
927115529 2:19897990-19898012 CTACTGCATATAACAACAGGGGG - Exonic
931281484 2:60796857-60796879 CTACTTCTTTTTACAGTCAGAGG - Intronic
931435170 2:62239563-62239585 CTACTTATTTTTAAGACATGGGG - Intergenic
933426120 2:82114035-82114057 CCACTTCTCTGTACAAAAGGTGG - Intergenic
935149974 2:100425031-100425053 CTCCTTCTTTTTAGAAAAGCTGG - Intergenic
938309130 2:130274947-130274969 ATTTTCCTTTTTACAACAGGAGG + Intergenic
938446370 2:131383125-131383147 ATTTTCCTTTTTACAACAGGAGG - Intergenic
940489363 2:154338353-154338375 CTACTTTTTTTTCCAATATGTGG + Intronic
940589730 2:155706573-155706595 CTTCTTCTGTTTAACACAGGAGG + Intergenic
940881013 2:158946874-158946896 CTACTTCTCTCTCCAAAAGGTGG + Intergenic
941114263 2:161453249-161453271 CTACATCTTTTTAATACAGAAGG - Intronic
941427785 2:165369839-165369861 CTGCTTCTCTCTACATCAGGAGG - Intronic
942808851 2:179971885-179971907 CTACTTCTTTTTACTAGGGGAGG + Intronic
942946125 2:181676116-181676138 CTATTTCTTTTTTTAAAAGGTGG - Intronic
943446020 2:187988706-187988728 CTACTGCTTTCTACTACACGTGG + Intergenic
944755487 2:202757246-202757268 CTACTTCTCTGTACAAGGGGGGG - Exonic
944930483 2:204513767-204513789 CAACTTCTTTGGACAACAGTTGG - Intergenic
1170575111 20:17656611-17656633 CTACTTGTAATTACAACAGTTGG + Intronic
1177093740 21:16804408-16804430 CTACTTATTTTTACAGAAGAAGG + Intergenic
1177489957 21:21810175-21810197 CTAGTTTTTCTTACAACATGAGG - Intergenic
1181374814 22:22448740-22448762 CCACTTCTTTGGAAAACAGGTGG - Intergenic
1182605718 22:31501613-31501635 CAACTTCATTTTACAGCTGGAGG - Intronic
949443237 3:4106325-4106347 CTACTTCTTTTTTCAGCTAGGGG + Intronic
950997142 3:17514248-17514270 ATACTTCATTTGACAACAGGGGG + Intronic
952052417 3:29400653-29400675 CTACTTATTCTTAAACCAGGTGG + Intronic
953136571 3:40187269-40187291 CTACTTCCTTGTCCAACAGTGGG - Intronic
958568766 3:95852290-95852312 CTAATTATTTATATAACAGGAGG - Intergenic
958634599 3:96727293-96727315 CAACTACTTTTAACAAGAGGCGG - Intergenic
959964729 3:112340386-112340408 GTACTGCTTTTTAAAACATGCGG + Intronic
962115599 3:132503195-132503217 TTAATTTTTTTTATAACAGGAGG + Exonic
967168333 3:186804212-186804234 CTTCTTCTCATTACAATAGGTGG - Intronic
971148341 4:24004300-24004322 CCACTTCTTTTTGAAACAGGAGG - Intergenic
973997153 4:56470196-56470218 ATACTTCCTTTTACAAGAGGAGG + Intronic
974267597 4:59604597-59604619 CTTCTTCATATTACAGCAGGAGG - Intergenic
976688218 4:87839536-87839558 GTACTTCTTATAACCACAGGAGG - Intronic
978081044 4:104591958-104591980 CTGCTTCTTTTTAAAATATGCGG + Intergenic
978592279 4:110337546-110337568 CTCATGCTATTTACAACAGGAGG - Intergenic
979795599 4:124842414-124842436 CTATTTATTTTTCCTACAGGGGG + Intergenic
979803060 4:124935998-124936020 CTACTGCTGTTTCCTACAGGGGG + Intergenic
981004014 4:139856362-139856384 GTTCTCCTTTTTCCAACAGGAGG - Intronic
983154292 4:164327417-164327439 CAACTCCTTTTTGCAACAGGTGG + Intronic
988653229 5:33176940-33176962 CTACTCCTTTTGAGAACAGAGGG - Intergenic
989073848 5:37541639-37541661 CTAATTCTTTTTTAAAAAGGTGG + Intronic
990145407 5:52754375-52754397 CTACTTCCTTTTGCAAGGGGAGG - Intergenic
990939093 5:61183102-61183124 CTACTTATTTTTACCATGGGTGG - Intergenic
991393942 5:66183915-66183937 CTTTGTCTTTTAACAACAGGTGG + Intergenic
992577564 5:78133272-78133294 CTTCTTCCTTTTAGAACAGCAGG - Intronic
993982945 5:94564703-94564725 CTACTACTTGTTACAAGAGTAGG + Intronic
994599105 5:101879526-101879548 GTGCTTATTTTTACAAGAGGAGG + Intergenic
995659310 5:114463278-114463300 CTACTTCTTTTCCCATCAGCAGG + Intronic
997054696 5:130427774-130427796 CTACTTCATTCAACAACAGCAGG + Intergenic
997105100 5:131009111-131009133 CTTCATCTTTTCACAACAGCTGG + Intergenic
1000198674 5:158986243-158986265 CTACTTCTTAGTATAATAGGTGG + Intronic
1008713742 6:54262705-54262727 CAAATTCTTTTGAAAACAGGTGG - Intronic
1011492704 6:87908795-87908817 CTTCTTCTTTTGAAATCAGGAGG + Intergenic
1011891915 6:92174538-92174560 CTACTTCTTTCTAGTACAGAGGG + Intergenic
1013595212 6:111654565-111654587 CTACTTCTCTTAATAACAGCTGG - Intergenic
1017026188 6:150183346-150183368 CTACTTCCTTTTTGTACAGGTGG - Intronic
1018256207 6:161922162-161922184 CTTCTGCATTTGACAACAGGGGG - Intronic
1018771999 6:166979110-166979132 ATATTTCTCTTTACAACAGTAGG - Intergenic
1024195581 7:47055421-47055443 CTTCTTCTTTTTACAAGACCAGG + Intergenic
1024284561 7:47746079-47746101 CCAGGTCTTTTTACTACAGGTGG - Intronic
1024600696 7:50978146-50978168 CTACTTTCTTTTTCAACAGTAGG + Intergenic
1025772067 7:64518311-64518333 CAACTTTTTTTTACAATAGCTGG + Intergenic
1027737354 7:81950505-81950527 CTTTTTTTTTTAACAACAGGAGG - Exonic
1029141501 7:98414016-98414038 CCCCTTTTTTCTACAACAGGGGG + Intergenic
1029687494 7:102158744-102158766 CTACTTCTCATGACAACAGAAGG - Intronic
1029964317 7:104722917-104722939 CTACTTATTTTTTTAACAGAAGG - Intronic
1034312810 7:150104315-150104337 CTACATCTTTCTAAGACAGGAGG + Intergenic
1034794048 7:153996350-153996372 CTACATCTTTCTAAGACAGGAGG - Intronic
1038131931 8:24742003-24742025 CCACTTCTTTTTGCAGCAGTTGG - Intergenic
1039022103 8:33219172-33219194 CTACTTCTCTATGAAACAGGAGG - Intergenic
1042859529 8:73298297-73298319 CTACTTTTTTTTTCCATAGGCGG + Intronic
1043554885 8:81420040-81420062 CTATGTCTTTTTACAAATGGTGG + Intergenic
1044195225 8:89368025-89368047 CTACTGCATTTTACCACAGCTGG - Intergenic
1044239821 8:89875720-89875742 CTACTTCTTTTCACTACTGTTGG - Intergenic
1045891155 8:107159185-107159207 CTACTTCTGTTTTTAACAGAGGG - Intergenic
1047092938 8:121593620-121593642 TTACTAGTTGTTACAACAGGTGG + Intergenic
1050083744 9:1942236-1942258 ATCCTTCTTTTTACATCAGGAGG - Intergenic
1050102627 9:2134817-2134839 CTAGGTCTTTCTACAACAGGAGG + Intronic
1053333817 9:37244664-37244686 CCACTTCTTTTTAGAACAAAAGG - Intronic
1056075554 9:83034964-83034986 CTACTTCTTTTTAACCCAGTTGG - Intronic
1057803891 9:98207290-98207312 CTGCTTTTTTTTAGAATAGGTGG - Intronic
1058932879 9:109739350-109739372 CTATTTCTTTTTACAATTGATGG - Intronic
1190743914 X:53309518-53309540 ATGCTTCTTTTGAGAACAGGAGG + Intronic
1193103557 X:77642869-77642891 CTAGTTGTTTGTACTACAGGCGG - Intronic
1194434610 X:93855359-93855381 CTACTTGTTTTGACATAAGGAGG + Intergenic
1197532077 X:127641696-127641718 CTATTTCTTTTTGCAACATATGG + Intergenic
1199727733 X:150601608-150601630 CTACTTCTCTGGGCAACAGGAGG - Intronic
1201552111 Y:15228698-15228720 CAAGATATTTTTACAACAGGAGG + Intergenic