ID: 1103108847

View in Genome Browser
Species Human (GRCh38)
Location 12:118256297-118256319
Sequence CAGCTACCAGCAGTGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103108847 Original CRISPR CAGCTACCAGCAGTGTTGGA GGG (reversed) Intronic
900482332 1:2905282-2905304 CACAGATCAGCAGTGTTGGAGGG + Intergenic
901770092 1:11525617-11525639 CACCAGCCAGCATTGTTGGAGGG + Intronic
903376869 1:22872051-22872073 AAGCTAAAAGCAGTGTTGGCAGG + Intronic
906703457 1:47876687-47876709 CAGCCTCCAGCAGTGCTGGGAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908882813 1:68751709-68751731 AAGGTTCCAGCAGTGTTGCATGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
908930885 1:69315132-69315154 CAGATGCCAGCAGTGGTGGATGG + Intergenic
909456211 1:75852489-75852511 TATCCACCAGCAGTGTTTGAGGG + Intronic
909705135 1:78572734-78572756 GAGCTACGTGCAGTGTTTGAGGG + Intergenic
912162998 1:107008917-107008939 CAGCTCCCATCAGTGTGGGTGGG - Intergenic
915762745 1:158331324-158331346 CAGCTCCCAGCACTGGTGCAGGG - Intronic
915947581 1:160165058-160165080 CTGCTACCACCAGAGTTTGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922894655 1:229090629-229090651 AAGCTCACAGCAGTTTTGGAAGG - Intergenic
924653185 1:245948932-245948954 CAGCTGCCCACAGTGGTGGATGG - Intronic
1065377410 10:25057707-25057729 CAGCTACCAACACTATTGGGAGG - Intronic
1067790990 10:49287701-49287723 CAGCCACAAGCAGTGTTGGGAGG + Intergenic
1068644211 10:59447438-59447460 CAGCTACGAGCAATGTATGAGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070615326 10:77965383-77965405 TTCCTACCAGCAGTGTAGGAGGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073516234 10:104077920-104077942 CAGCCACTAGAAGTGCTGGAGGG + Intronic
1074173323 10:110968075-110968097 TTCCTACCAGCAGTGTTTGAGGG + Intronic
1074879653 10:117645808-117645830 CACCTACCAGCAGAGATGGGAGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076689989 10:132218581-132218603 CCCCTACCAGCAGTGTGTGAGGG - Intronic
1078772275 11:14361625-14361647 CACCTACCAGCAGTGTATGAGGG - Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1087105344 11:94401929-94401951 CAGATACCAGAGGTGCTGGAGGG + Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1087890060 11:103527740-103527762 CAACTACCAGCAATGTTATATGG - Intergenic
1087992204 11:104758599-104758621 CAGATGCCAGCAGTGGTGAATGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1095225314 12:39671789-39671811 CAGATGCCAGCTGTGGTGGATGG + Intronic
1095975188 12:47935519-47935541 CAGCTACCAGAAGGCTTTGAAGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096584946 12:52613943-52613965 CAGCTTCCATCTGTGTGGGATGG - Intronic
1096585128 12:52614976-52614998 CAGAAACTAGCAGAGTTGGAAGG + Intronic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097555147 12:61127485-61127507 CAGATTCCAGCAGTGATGGATGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098826646 12:75305794-75305816 CAGCTACAATTAGTGATGGAGGG + Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100915209 12:99412529-99412551 CCTCTTCCACCAGTGTTGGATGG + Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1110840535 13:80136984-80137006 CTGTTACCACCTGTGTTGGAAGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113630120 13:111876635-111876657 TAGCTGCCAGCAGTCTTGCATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116012379 14:39366581-39366603 CAGATGCCAGCAGTGGTGGATGG + Intronic
1116686105 14:48040596-48040618 CAGATGCCAGCAGTGGTGGCTGG + Intergenic
1116870362 14:50064132-50064154 CAGCTACCAGGAGTGCTGGAGGG + Intergenic
1117404263 14:55386613-55386635 CAGCAACCAGCAGGGTGGGTGGG + Intronic
1118471913 14:66082199-66082221 AAGCCACCAGCAGTCCTGGAGGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119198912 14:72738558-72738580 CAGCTACCAGGAGGGTGAGACGG + Intronic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124015919 15:25875600-25875622 CAGGTGCCAGCAGAGTTGGCCGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127780337 15:62307610-62307632 CATCTTTCAGGAGTGTTGGAAGG - Intergenic
1129007571 15:72386907-72386929 CAGCTACCGGCAGGGTGAGATGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129955785 15:79635534-79635556 CAGGTACCAGCAGGTGTGGAGGG + Intergenic
1129964301 15:79720178-79720200 CATCTTCCAGCATTGGTGGATGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132406756 15:101546381-101546403 AAGCAACAAGCAGTGATGGAGGG + Intergenic
1133255913 16:4515783-4515805 CCCCTACCAGCAGTGTATGAGGG - Intronic
1133374026 16:5268851-5268873 CACCCACCAGCAGTGTATGAAGG + Intergenic
1136568259 16:31082547-31082569 CGGCTTCCAGCAGTGCTGGGTGG - Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137688053 16:50400644-50400666 CAGCTTCAACCAGTGATGGATGG - Intergenic
1140051602 16:71486250-71486272 CAGCTACTAGCTGAGTTGGGAGG + Intronic
1141098011 16:81176626-81176648 CAGCCACCAGTAGTGTTGCCAGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142214576 16:88824346-88824368 CAGCAACCCCCAGTGTGGGAGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142289736 16:89188056-89188078 CAGTTACCAGCAGGGCTGGGGGG - Intronic
1143309380 17:5975873-5975895 CAGAGAGCAGCTGTGTTGGAGGG - Intronic
1146267202 17:31460646-31460668 CTGCTACCACTAGTCTTGGAGGG - Intronic
1147476613 17:40717926-40717948 TTCCTACCAGCAGTGTAGGAGGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149619971 17:58036843-58036865 CTCCTACCAGCAGTGTATGAGGG - Intergenic
1149625377 17:58076505-58076527 TTCCTACAAGCAGTGTTGGAGGG - Intergenic
1150335685 17:64329044-64329066 CAGTTTCAAGCAGTGTGGGATGG - Intronic
1153056267 18:949613-949635 CAGATGCCAGCAGTGGTGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1156671889 18:39480727-39480749 CTGATACCAGCAGGGTAGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158195461 18:54880597-54880619 GAGGAACCAGCAGTGTTGAAGGG - Intronic
1161561640 19:4976367-4976389 CAGCTACAAACAGTGTAGGTGGG + Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1166165356 19:40984074-40984096 CAGCTGCCAAAGGTGTTGGATGG - Intergenic
1166227156 19:41403366-41403388 CAGCTACCACCTGTCTTTGATGG + Intronic
1167289314 19:48615707-48615729 CAGCTCCAAGCAGTGTTGAAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925361860 2:3285345-3285367 CAGGTCCCAGCTGTGGTGGACGG + Intronic
927339300 2:21963332-21963354 CAGCAACCAACAGAGATGGAAGG + Intergenic
927864750 2:26581285-26581307 CAGCTCCCTCCAGTGCTGGAGGG + Exonic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929812351 2:45201108-45201130 CAGATCCCTGCAGTGGTGGATGG - Intergenic
929878201 2:45814460-45814482 CAGCCCCCAGCAGTGTTGCCAGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931852453 2:66265511-66265533 CAGGTACCAAGAGTGTTGAAAGG - Intergenic
932845177 2:75127935-75127957 CAGCTAACAGGAGTATGGGAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934042546 2:88140200-88140222 CATATACCAGCAGTGTATGAGGG + Intergenic
934102184 2:88663747-88663769 AAGCTTACAGCATTGTTGGAAGG - Intergenic
934665032 2:96163950-96163972 CGGGGCCCAGCAGTGTTGGAGGG - Intergenic
935729289 2:106051790-106051812 CAGTTACAAGCTGTGTTGGGAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937291213 2:120783231-120783253 CAGCTTCCTGCCGTCTTGGAGGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939821086 2:146957615-146957637 CTCCTACCAGCAGTGTATGAGGG - Intergenic
940258798 2:151759573-151759595 AAGATACTAACAGTGTTGGATGG + Intergenic
940277560 2:151955490-151955512 TAGCCACCTGCAGTCTTGGATGG - Intronic
944177441 2:196848914-196848936 CTCCTACCAGCAGTGTATGAGGG + Intronic
947400195 2:229724183-229724205 CAGGTACAAGCTGTGTGGGAAGG - Intergenic
1169802301 20:9522686-9522708 CAGCGACCATCAGTGATAGATGG - Intronic
1170729570 20:18961536-18961558 CAGATACCAGAAGTGTAGGTGGG + Intergenic
1170776185 20:19376686-19376708 CAGCTCACAGCAGTGTTAAAGGG - Intronic
1170830630 20:19837055-19837077 CATCTTACAGCAGTGTTGTATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172454858 20:35062181-35062203 TATCTACCAGCAGTGTATGAAGG - Intronic
1172885110 20:38225708-38225730 CAGCTGCCCGCAGTCCTGGAAGG - Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177598061 21:23272070-23272092 CATCTACCAGCAGTCTGGGGAGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1181415569 22:22756307-22756329 GAGCTACCAGCAGTGCTGGGTGG - Intronic
1181419814 22:22789932-22789954 AAGCTCCCAGCAGTGCTGGGTGG - Intronic
1181519636 22:23437668-23437690 CCCCTACCGGCAGTGTTGCAGGG + Intergenic
1184543268 22:45144849-45144871 GAACTACCAGTTGTGTTGGAGGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952376195 3:32769618-32769640 AAGCCACCAGCAGAATTGGATGG + Intronic
952736151 3:36693441-36693463 CTGCTACCAGCAGGGGTGCATGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954307538 3:49737269-49737291 TTCCTACCAGCAGTGTAGGAGGG + Intronic
956165089 3:66392400-66392422 CTCCCACCAGCAGTGTAGGAGGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961623223 3:128240771-128240793 CAGCTGCAACCTGTGTTGGATGG + Intronic
961661993 3:128473835-128473857 CATCTTGCAGCATTGTTGGAAGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964836765 3:160947725-160947747 CAGCTATCACCAGGCTTGGAGGG - Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
967759558 3:193208093-193208115 GAGCTACCAGAAGTGTTGCCAGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971707219 4:30060748-30060770 CAGCTTCCAGCAGGCTTTGATGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974745573 4:66070953-66070975 CAGATACAAGCAGTGTGGAAAGG - Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975132968 4:70846622-70846644 CAGCTACCAGCTGAGGTGGGAGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977926497 4:102705829-102705851 GAGGTACCAACAGTGGTGGATGG - Intronic
978338891 4:107700238-107700260 CTCCTACCAGCAGTATGGGAGGG - Intronic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979469621 4:121079264-121079286 AAGCTAGCAGCAGTGTTGGGAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980195295 4:129580233-129580255 AAGCTACCAGCTGAGGTGGAAGG + Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981310298 4:143291448-143291470 TAGCTTTCAGCAGTGTTGTAAGG - Intergenic
983248397 4:165316043-165316065 CACCTTCCTGCAGTGTTTGATGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984580943 4:181509455-181509477 AAGGAACGAGCAGTGTTGGAAGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985999636 5:3620360-3620382 CAGCTGCCCACCGTGTTGGAAGG + Intergenic
987572932 5:19688000-19688022 CAGGTGCCAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988220314 5:28337030-28337052 CCTCTACCAGCAGTGTATGAGGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993812118 5:92493657-92493679 CACCTGCTAGCAGTGTGGGAGGG - Intergenic
993879814 5:93348871-93348893 CAGCTCCCAGCAGGGGTGCAGGG - Intergenic
994245661 5:97472228-97472250 CACCCACCACCAGTGTGGGAAGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
997405414 5:133642419-133642441 CAGCTCACAGAAGTGTTGGAGGG - Intergenic
997533557 5:134598058-134598080 CAGCTCCCAGCAGAGTTGAAAGG - Intergenic
1002588794 5:180272932-180272954 CAGCTGCCAGCAGTGCACGAGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005885073 6:30091406-30091428 CAGTTCACAGCACTGTTGGATGG - Intergenic
1006739248 6:36295444-36295466 CAGGTAAGGGCAGTGTTGGAGGG + Intronic
1007825508 6:44597174-44597196 CCCCTACCAGCAGTGTATGAGGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009329249 6:62395448-62395470 TTCCTACCAGCAGTGTTCGAGGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009909222 6:69904925-69904947 CCTCCACCAGCAGAGTTGGATGG - Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011930115 6:92701080-92701102 CCTCTGCCAGCAGTGTTGGGTGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013928843 6:115504826-115504848 AAGCTTCCAGTAGTGGTGGAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014209532 6:118693372-118693394 CACCTACCAGTAGTATTGTATGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1018369265 6:163152715-163152737 CAGCTTACAGCAATATTGGAAGG + Intronic
1019131328 6:169879051-169879073 CATATCCCAGCAGTGTGGGAAGG + Intergenic
1019334374 7:476104-476126 CCGCTTCCGGCAGTGCTGGATGG - Intergenic
1019591625 7:1838606-1838628 CCGCTACCTGCAGTGTTGCAGGG - Exonic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021368907 7:19816882-19816904 CACCTAGCAGCAATGTTGGCTGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022708636 7:32830968-32830990 CAGCTACAAGCAGTCTTGTGCGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024310480 7:47964720-47964742 CAGCTAAGAGCTGTGTTGGCTGG + Exonic
1024383320 7:48723993-48724015 AAGCTTACAGCAATGTTGGAAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033993192 7:147313214-147313236 AAACTACCAGCAGAGTGGGATGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034559201 7:151869188-151869210 CAGCAGCCAGCAGAGTTGGTGGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035000204 7:155606510-155606532 CTCCCACCAGCAGTGTGGGAGGG - Intergenic
1036068777 8:5416309-5416331 CACCCACCTGCAGTGTAGGAGGG + Intergenic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1038329940 8:26600404-26600426 CTCCCACCAGCAGTGTGGGAGGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039711764 8:40062145-40062167 CAGGTGCCAACAGTGGTGGACGG - Intergenic
1039711777 8:40062189-40062211 CAGGTGCCAACAGTGGTGGATGG - Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041734801 8:61098605-61098627 CACCTCCCAGGAGTGTTGCAAGG - Intronic
1042737345 8:72004331-72004353 CAACTACCAGCTGGGTTGGAGGG - Intronic
1042862023 8:73324582-73324604 TAGTTATCAGCAGTGTTGTAAGG + Exonic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047261195 8:123261530-123261552 CAGGTACCAGCAGTGAAGCAAGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048965503 8:139611695-139611717 CAGCTTCCAGCCCTGTTGTATGG + Intronic
1049383067 8:142326999-142327021 CCCCCGCCAGCAGTGTTGGAGGG - Intronic
1050899907 9:10934127-10934149 CAGCCACCAGCAGGAGTGGAGGG + Intergenic
1051199115 9:14597609-14597631 CAGGTACCAGCAGTGAGGGCTGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053292156 9:36888157-36888179 TTCCTACCAGCAGTGTTTGAGGG - Intronic
1055871301 9:80883794-80883816 CAGCCACAAGCACTGTTGGTGGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057209660 9:93192870-93192892 CAGCTCCCAGCTGTCCTGGAAGG - Intronic
1060297355 9:122351758-122351780 CAGATACCAGCAGGGCTTGATGG - Intergenic
1186207502 X:7215853-7215875 CAGCTAACAGCAGTGTGGACAGG - Intergenic
1188124338 X:26349916-26349938 CAGCCAGCAGCATTTTTGGAAGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188864596 X:35299709-35299731 CAGCTGCAAGCTGTGTTGCATGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193752952 X:85369841-85369863 CATCCACCAGCAGTGTGTGAAGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195582239 X:106518577-106518599 TTCCTACCAGCAATGTTGGAAGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199704996 X:150416710-150416732 CTGCTACCACCAGCTTTGGAGGG - Intronic
1200136947 X:153879822-153879844 CAGCCAGCAGCAATATTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic