ID: 1103111011

View in Genome Browser
Species Human (GRCh38)
Location 12:118278285-118278307
Sequence GAGGGTGGAAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6086
Summary {0: 1, 1: 5, 2: 107, 3: 991, 4: 4982}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103111011_1103111016 -10 Left 1103111011 12:118278285-118278307 CCCTCCTCCTTCTTTCCACCCTC 0: 1
1: 5
2: 107
3: 991
4: 4982
Right 1103111016 12:118278298-118278320 TTCCACCCTCAAGTAGGCCCTGG 0: 16
1: 160
2: 329
3: 428
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103111011 Original CRISPR GAGGGTGGAAAGAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr