ID: 1103114007

View in Genome Browser
Species Human (GRCh38)
Location 12:118309466-118309488
Sequence GGGTAGATTTGCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103114007_1103114016 0 Left 1103114007 12:118309466-118309488 CCCTCCTCCCTGCAAATCTACCC 0: 1
1: 0
2: 6
3: 34
4: 351
Right 1103114016 12:118309489-118309511 TCCCTTCTTGGCTCAAATGGTGG 0: 1
1: 0
2: 2
3: 10
4: 108
1103114007_1103114014 -3 Left 1103114007 12:118309466-118309488 CCCTCCTCCCTGCAAATCTACCC 0: 1
1: 0
2: 6
3: 34
4: 351
Right 1103114014 12:118309486-118309508 CCCTCCCTTCTTGGCTCAAATGG 0: 1
1: 0
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103114007 Original CRISPR GGGTAGATTTGCAGGGAGGA GGG (reversed) Intronic
900146278 1:1160241-1160263 GGGGGGATGCGCAGGGAGGAGGG + Intergenic
901430222 1:9209615-9209637 GGGTAGAATTGCAGAGGGGTGGG - Intergenic
901467791 1:9433916-9433938 AGGTAGAGTTGAAGGGAGGTGGG - Intergenic
902048360 1:13542611-13542633 GGGGAGCTTTGCATGAAGGATGG + Intergenic
903229107 1:21911253-21911275 GGGAAGATGTACTGGGAGGAGGG + Intronic
903342338 1:22662259-22662281 GGGTAGATGGGCAGAGTGGAAGG - Intergenic
903959524 1:27047867-27047889 GGGTAAATTTGAAGGCAGGTAGG + Intergenic
904038646 1:27571786-27571808 GGGTGGGTTTGCAGGGAGCGGGG + Intronic
904631657 1:31847345-31847367 GAGCAGAGTGGCAGGGAGGAGGG + Intergenic
904965401 1:34368893-34368915 AGGTAGACCTGCAGGTAGGAAGG + Intergenic
906534861 1:46545753-46545775 GGGTTGATGGGCAGGGGGGAGGG + Intronic
907484625 1:54768600-54768622 GGGTGGCTTTGCAGTCAGGAAGG + Intergenic
908431293 1:64060973-64060995 GGGTACATTTAAAGGGAGAAGGG + Intronic
909559345 1:76992406-76992428 GGGAATATTTGGAGGCAGGAAGG - Intronic
909693504 1:78437168-78437190 GGATAGATTGGAAGGCAGGAAGG + Intronic
910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG + Intronic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
911260996 1:95685242-95685264 GGGTAGATTGGTAGGGGGGAAGG - Intergenic
912519308 1:110234380-110234402 TGGTACAATTGCAGGGAGGAGGG - Intronic
913327580 1:117639991-117640013 GGGTAGATTGACAGGCTGGAGGG + Intergenic
913593769 1:120353968-120353990 TGGTAGATTTGCAGAGACGGGGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914514632 1:148363531-148363553 TGATAGATTTGCAGAGAGGGGGG - Intergenic
915445028 1:155969666-155969688 GGGAAGATGCGCAGAGAGGAGGG + Intronic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915723834 1:158003482-158003504 TGGTAGATTTCCAGGGAGAGTGG - Intronic
915841085 1:159213568-159213590 GGGAAGAAGTGGAGGGAGGAAGG + Intergenic
915971214 1:160356556-160356578 GGGAAGATTTGGTGGGTGGATGG - Intronic
916207367 1:162328333-162328355 GGGTACATGTGCAGGATGGACGG - Intronic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
916962391 1:169902439-169902461 GTGTTTGTTTGCAGGGAGGAGGG - Intergenic
918338264 1:183543847-183543869 TGGTAAAGTTGCAGGGTGGAAGG + Intronic
919466172 1:197923116-197923138 GGGTGGCCTTGCAGGGAGAATGG + Intronic
920302923 1:205000427-205000449 GATGAGATTTGCAGGAAGGATGG - Intronic
920507995 1:206530664-206530686 GAGTAGAAAAGCAGGGAGGAGGG + Intronic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
920887320 1:209942341-209942363 GGGTAAATTTGCATGGAGGCTGG - Intronic
921270400 1:213463735-213463757 GGGCAGAGTTTCAGAGAGGAGGG - Intergenic
921958374 1:221008100-221008122 GGGAAGGGTAGCAGGGAGGAGGG - Intergenic
922083581 1:222323709-222323731 GGGGAGAATTGGAGAGAGGACGG - Intergenic
922470159 1:225871773-225871795 GGATGAATTTGCAGGCAGGAAGG - Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063095751 10:2907472-2907494 GGGCAGATCTGCAGAGGGGAGGG - Intergenic
1064137459 10:12763366-12763388 AGGTACATTTGCAGGTAGGCTGG - Intronic
1065408534 10:25395495-25395517 GGGTAGATAGGCAGGTAGGTAGG - Intronic
1066440199 10:35431334-35431356 GGGAAGATGTGGGGGGAGGAGGG - Intronic
1067515561 10:46938618-46938640 GGGCAGAGTACCAGGGAGGAGGG - Intronic
1067558247 10:47287084-47287106 GGGTGGAGTAGCAGGGTGGAGGG + Intergenic
1067646690 10:48113197-48113219 GGGCAGAGTACCAGGGAGGAGGG + Intergenic
1070088260 10:73257625-73257647 GTGTAGATTTGGAGGAAGTAAGG - Intronic
1070285983 10:75084069-75084091 GGGTGGAGTTGGGGGGAGGATGG + Intergenic
1070769861 10:79075931-79075953 GGGATGACTGGCAGGGAGGATGG + Intronic
1071463137 10:85917386-85917408 GGGTAAATTTGGAGGGATAAAGG - Intronic
1071465264 10:85934024-85934046 GGGTGAATTTGCAGGCAAGAAGG + Intronic
1072613023 10:97031566-97031588 GGGTGGATTTTCTGGCAGGATGG + Intronic
1072945207 10:99803800-99803822 GGGTAGAGTTGGAGGAAGGTGGG + Intronic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073291264 10:102414411-102414433 AGGGAGATTAGCAGGGAGGGAGG - Intronic
1073794181 10:106970306-106970328 GGTTACATTTGGAGGGAAGAAGG - Intronic
1074463383 10:113659499-113659521 TGGTAGATTTGCACTGGGGAAGG - Intronic
1074830623 10:117245502-117245524 GGGTAGGTGGGCAGGGAGCAGGG + Intronic
1075223942 10:120608587-120608609 GGCTAGAGTTGCTGTGAGGATGG + Intergenic
1075403396 10:122177414-122177436 GGATGGAGTTGCAGGGATGATGG + Intronic
1077495835 11:2886123-2886145 GGGGAGTGTTGCAGGGGGGATGG - Intergenic
1077559668 11:3251497-3251519 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1077565560 11:3297300-3297322 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1078290298 11:10004143-10004165 GGGTAGATTTGAAGGGAATAAGG - Intronic
1080888956 11:36391953-36391975 GGGTAGTTGTGGTGGGAGGAAGG - Intronic
1081419098 11:42851163-42851185 GGGTGGTTTTGGAGGGTGGAAGG + Intergenic
1082270959 11:50169152-50169174 TGATAGATTTGCATGGATGATGG + Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1082763687 11:57149802-57149824 GGGCAGATATGCAGGGAGTGGGG - Intergenic
1083129681 11:60613440-60613462 GGGTTGATTAGCTAGGAGGAAGG - Intergenic
1083595563 11:63917023-63917045 GGGCAGAGTTGCCGGGAGGCGGG + Intergenic
1083737108 11:64687636-64687658 GGGAAGAGTGGCAAGGAGGAGGG + Intronic
1084438397 11:69157201-69157223 GGGAAGCTTGGCAGGGAGGCTGG - Intergenic
1084672025 11:70612655-70612677 GGGTGCCTCTGCAGGGAGGAAGG - Intronic
1089357133 11:117861374-117861396 GGGGAGAGAGGCAGGGAGGAGGG + Intronic
1089360438 11:117882558-117882580 GTGCATATTTGCAGAGAGGAGGG - Intergenic
1089573483 11:119424852-119424874 GGATGGAGTTGGAGGGAGGAGGG - Intronic
1089762640 11:120739510-120739532 GGTTAGAGTTGCAGGGACCATGG + Intronic
1089785366 11:120903546-120903568 GGGTGTATTTACAGGCAGGAAGG - Intronic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1090189433 11:124758829-124758851 GGGCAGATTTCCAGCGAGGAGGG + Intronic
1090399327 11:126438917-126438939 GGGCAGTTGTGCAGGGAGGGTGG - Intronic
1090616243 11:128518022-128518044 GGGAACATTTGCAGGGTTGATGG - Intronic
1090808905 11:130220038-130220060 TGGTAGACGTGCAGGCAGGAGGG - Intergenic
1091785862 12:3243048-3243070 TGGTACATTTGGAGGGATGAAGG + Intronic
1093558670 12:20510730-20510752 AGGTAGATTTGTAGGTAGGAGGG + Intronic
1095563000 12:43587748-43587770 AGGTAGATTTAAAGAGAGGAGGG - Intergenic
1097440303 12:59599721-59599743 GGGATGAGTTGAAGGGAGGAGGG - Intronic
1097519730 12:60652100-60652122 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1097756663 12:63415154-63415176 GAGTAGTTTGGCAGGAAGGATGG - Intergenic
1097844937 12:64356589-64356611 GAGTAGTTTGGCAGGAAGGATGG + Intronic
1099975247 12:89540016-89540038 GGCTTGATTTGTGGGGAGGATGG - Intergenic
1101778925 12:107818128-107818150 GAGTAGTTTGGCAGGAAGGATGG + Intergenic
1102740633 12:115204466-115204488 GGGATGTTTTGCTGGGAGGAGGG - Intergenic
1102999568 12:117375093-117375115 GGGAAGGTGAGCAGGGAGGAGGG + Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1104295197 12:127505712-127505734 AGGGAGAGTGGCAGGGAGGAAGG - Intergenic
1104678836 12:130734787-130734809 GGGAGGCTTTGCAGGGAGGGAGG - Intergenic
1105265503 13:18810728-18810750 GGGCACATATGCAGGGAGGGAGG - Intergenic
1105702107 13:22941560-22941582 GGGTGGTTTTGCAGGCAGTATGG + Intergenic
1106899968 13:34345310-34345332 GGGCAGATGTGGAGGGAGGTGGG - Intergenic
1107798813 13:44083839-44083861 GGGAAGATTAGGAGGGAGGAGGG + Intergenic
1108065173 13:46569937-46569959 GAGTAGAGTTGCAGAGAGGGAGG - Intronic
1108556403 13:51597629-51597651 GGATGGATTTGCAGAGAGAATGG + Intronic
1109910115 13:68898544-68898566 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1110525374 13:76530815-76530837 GGATAGGTTTGCAGGGAAAAAGG - Intergenic
1111058562 13:82981876-82981898 GGGAACATTTGCAGGGAGGAAGG + Intergenic
1111278469 13:85985401-85985423 TGATAGATTTGCTGGGTGGAGGG + Intergenic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112437137 13:99398607-99398629 GGACAGTTTTGCAGGGAGCAAGG - Intergenic
1113510726 13:110853186-110853208 GGCCAGATTTGCATGGGGGATGG + Intergenic
1114263007 14:21052486-21052508 GGGAGGACTTGCAGGGAAGAGGG + Intronic
1117804530 14:59477462-59477484 GGGTGGACTTTGAGGGAGGAAGG - Intronic
1118715419 14:68556404-68556426 GGAGCGATCTGCAGGGAGGAAGG - Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1119866760 14:77980911-77980933 GGGTGGATTGGCAGGGAGGTCGG + Intergenic
1119996050 14:79254865-79254887 AGGAAGAGTTGGAGGGAGGAAGG - Intronic
1119998422 14:79278202-79278224 CATTACATTTGCAGGGAGGAAGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1121144625 14:91573668-91573690 GGGGAGACTGGCAGGGAAGAGGG + Intergenic
1122722064 14:103727711-103727733 GGGAGGATTGGCAGTGAGGAGGG - Intronic
1123484461 15:20675469-20675491 GGGAAGATTTGAAGAGATGAGGG - Intergenic
1123537186 15:21244436-21244458 GGGAAGATTTGAAGAGATGAGGG - Intergenic
1125281376 15:38045323-38045345 GGGGAGATTGGTAGGAAGGAAGG + Intergenic
1126955635 15:53930474-53930496 GAGTAGATTTTCTGGGAAGAGGG + Intergenic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1128178642 15:65580459-65580481 AGGAAGCTCTGCAGGGAGGATGG + Intronic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1129104620 15:73297695-73297717 GGGTAGATTAGCCTGGAGAAGGG - Intronic
1129298698 15:74613481-74613503 GGGTAGAATCTCAGGCAGGATGG + Intronic
1131065614 15:89433401-89433423 GGGTGCATTTGGAGGGAGGGAGG - Intergenic
1131346827 15:91657225-91657247 AGGTAGACTTGAAGGGATGATGG - Intergenic
1131986160 15:98044407-98044429 GGGTAGATGGGCAGGGAGAAGGG - Intergenic
1132279807 15:100602827-100602849 GGGCAGAGGTGCAGGGAGGCAGG - Exonic
1133601209 16:7341998-7342020 GGGGAGAATTGCAGTGAGGAGGG + Intronic
1135607686 16:23837275-23837297 GGGTACAGAGGCAGGGAGGAAGG + Intronic
1136012685 16:27374312-27374334 CGGAAGTTCTGCAGGGAGGAAGG - Intergenic
1137734472 16:50713700-50713722 GGGTAGACTTGAAGGGGGAAGGG + Intronic
1138005080 16:53326817-53326839 GGGTAGAATTAGAGGGAGGAAGG - Exonic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1143237184 17:5412840-5412862 AGTTAGATTTGGAGGAAGGAGGG + Intronic
1143894497 17:10125646-10125668 GGGGAGATGAGGAGGGAGGAGGG + Intronic
1144048128 17:11471439-11471461 GGGTGGATTTGCAGTGCTGATGG + Intronic
1145785317 17:27589743-27589765 AGATAGATTTGAAGGAAGGATGG - Intronic
1145850747 17:28093172-28093194 GAGGGGAGTTGCAGGGAGGAGGG + Intronic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1147236328 17:39060281-39060303 GGCCAGAGGTGCAGGGAGGAAGG - Intergenic
1147519912 17:41160714-41160736 GGGTGGGTTTCCAGGAAGGAGGG + Exonic
1147521573 17:41178187-41178209 GGGTGGATTTCCAGGAAGGTGGG + Exonic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1148868071 17:50639477-50639499 GGGCAGGCTTCCAGGGAGGAAGG + Intronic
1148897900 17:50850890-50850912 TGGTATATTAGCAGGGAGAAGGG - Intergenic
1149644414 17:58229362-58229384 GGGTAGGACTGCAGAGAGGAAGG - Intronic
1150444752 17:65220314-65220336 GGATATATTTGAGGGGAGGAGGG + Intronic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1152301733 17:79498839-79498861 GGGTAGATGTGGTGGGTGGAAGG - Intronic
1153417941 18:4870401-4870423 GAGTAGATTGGCAGGAAGGATGG - Intergenic
1153419362 18:4886586-4886608 GGGGAGATTGGCAGAGAAGACGG - Intergenic
1153775911 18:8453756-8453778 AGGTACTTTTGCAGTGAGGAAGG - Intergenic
1155834889 18:30568716-30568738 GCGAAGCTTTGCAGGCAGGAAGG - Intergenic
1157532756 18:48435690-48435712 GAGAAGAATTGCAGGAAGGAAGG + Intergenic
1158329401 18:56344896-56344918 GGGGATCTCTGCAGGGAGGAAGG + Intergenic
1158888781 18:61853936-61853958 GGGCAGGTGGGCAGGGAGGATGG - Intronic
1159007588 18:63026174-63026196 GGGTTTATGTGCAGGAAGGAGGG + Intergenic
1160175936 18:76594041-76594063 GGGAAGTTTTGGAGGGAAGATGG - Intergenic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1161172143 19:2817624-2817646 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1161511900 19:4676649-4676671 GGGTAGATCTGCGGGGAGACAGG + Exonic
1162285590 19:9736315-9736337 TGGTAGAAGGGCAGGGAGGAAGG + Intergenic
1162364874 19:10242550-10242572 GGGCAGATTTTCCGAGAGGAAGG - Intergenic
1163373405 19:16915026-16915048 GGGTAGAGGTCCAGGTAGGAAGG - Intronic
1163646224 19:18490752-18490774 TGGGAGATTTGAGGGGAGGAGGG - Intronic
1163779688 19:19239840-19239862 GGGAGGAGTTGGAGGGAGGAGGG - Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166710757 19:44935741-44935763 CAGAAGATTAGCAGGGAGGAGGG + Intergenic
1166813521 19:45528038-45528060 GGGCAGATTTGGAGGGAAGTTGG + Exonic
1166881589 19:45933644-45933666 GGGTGGAGGTGCAGGGAGGAGGG + Intergenic
1166910881 19:46155562-46155584 TGGTTGTTTTGCCGGGAGGAAGG + Intronic
1166923048 19:46244881-46244903 TGGTTGTTTTGCTGGGAGGAGGG - Intergenic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925194587 2:1912919-1912941 GGGAAGGTTAGCAGGGACGAAGG + Intronic
925611477 2:5706085-5706107 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611484 2:5706107-5706129 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611491 2:5706129-5706151 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611525 2:5706240-5706262 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611532 2:5706262-5706284 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611539 2:5706284-5706306 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
925611546 2:5706306-5706328 GGGTAGAGGAGCAGGGAGGCTGG + Intergenic
926266787 2:11330727-11330749 GGGAAGATGAGGAGGGAGGAGGG + Intronic
927981049 2:27375461-27375483 GGGTAGATTAGGAGGGAGAATGG - Intronic
928483756 2:31708832-31708854 GGGCAGTTGTGCGGGGAGGAAGG + Intergenic
928927896 2:36597627-36597649 GGTTTGGTTTGCAGGAAGGAGGG + Intronic
929596927 2:43181797-43181819 GGGCAGATTTGTTGGGAGAAGGG + Intergenic
929935854 2:46294266-46294288 AGGGAGATTTGCTGGGAGGTGGG + Intronic
930174222 2:48285191-48285213 GGGTAGTTTTGCAGGAAGGACGG - Intergenic
931749923 2:65321298-65321320 GGGTACATTTGCAGGTGGCAAGG - Intronic
932049985 2:68388845-68388867 TGGTTGCTTTGAAGGGAGGAGGG - Intronic
932433290 2:71687974-71687996 GAGAATATTTGAAGGGAGGAAGG + Intergenic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
934112726 2:88757502-88757524 GGGAAGACTTGGAGGGAGGCTGG + Intergenic
934851926 2:97707154-97707176 TGGGAGATTTGAATGGAGGAGGG + Intergenic
934856198 2:97731915-97731937 GTGTAGCTTTACAGTGAGGAGGG - Intronic
936514534 2:113173636-113173658 GGGCAGAAGCGCAGGGAGGAAGG + Intronic
936716083 2:115189307-115189329 GAGTAGTTTGGCAGGAAGGATGG + Intronic
937267857 2:120628373-120628395 GGGGAGAATTGGAGGGAGGAAGG + Intergenic
938127122 2:128682638-128682660 TGGTAGATGAGCAGGGATGAGGG + Intergenic
938577224 2:132616035-132616057 GGGAAGGTTTGCAGGAGGGAGGG - Intronic
940383850 2:153047450-153047472 TGTGAGATTTGGAGGGAGGAAGG + Intergenic
941163791 2:162063803-162063825 TGGTAGGTTGGCAGGGATGAGGG + Intronic
942629236 2:177938119-177938141 GGGAAGGTTGGAAGGGAGGAGGG + Intronic
943365774 2:186966382-186966404 GGACAGATTTGTAGGAAGGATGG + Intergenic
943697343 2:190950622-190950644 AGGTACATGTGCTGGGAGGAAGG - Intronic
943821064 2:192321435-192321457 GGGTAGGTTTGAGGGGAGGAAGG + Intergenic
946240567 2:218351968-218351990 AGGTAGTTTGGCAGGAAGGATGG + Intergenic
948291992 2:236832411-236832433 TGGTACATGTGCAGGAAGGAGGG + Intergenic
948345519 2:237294105-237294127 GGCTGAATTTGCAGGGAGGAGGG + Intergenic
1169027876 20:2385382-2385404 GGGTTGTCTTGTAGGGAGGAGGG + Intronic
1169703390 20:8474515-8474537 GGGTAGAGTGGCAGGGATTATGG + Intronic
1171367669 20:24637141-24637163 GGGTACATTGGCTGGGAAGAGGG + Intronic
1172015356 20:31869889-31869911 AGGTAGACTTGCAGGGTGCAGGG + Intronic
1172800123 20:37570196-37570218 GGGAAGGGTTGCAGGGAGGCAGG - Intergenic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174101545 20:48130025-48130047 GGTTACTTTTGGAGGGAGGAAGG + Intergenic
1174283906 20:49458778-49458800 TGGAAGATTTGCATGGAGGTAGG + Intronic
1174289288 20:49496334-49496356 GGATAGATTAGAAGGGTGGACGG - Intergenic
1175616842 20:60407089-60407111 GGGGAGATTTGATGGCAGGAAGG - Intergenic
1175858789 20:62138086-62138108 AGGTAGATGAGCAGGAAGGAAGG - Intronic
1176012519 20:62906816-62906838 GCGTAGACTTGCAGGCAGGTAGG - Intronic
1178946063 21:36948622-36948644 GGGAAGATTAGGTGGGAGGATGG + Intronic
1179052573 21:37900660-37900682 GGGTGGATTTGATGGGAGAAAGG + Intronic
1179164890 21:38927598-38927620 GGGTATCTTTGCAGGAAGGGGGG + Intergenic
1179326630 21:40352836-40352858 AGGCAGATTTGGAGGAAGGAGGG - Intronic
1179876888 21:44273152-44273174 GGGAAGATGTGGAGGGTGGAAGG + Intergenic
1181550818 22:23638259-23638281 GGGTTGAGCTGCAAGGAGGAAGG + Intergenic
1181790631 22:25263022-25263044 TGGGAGAGTTGCAGGGAGGGGGG - Intergenic
1181917562 22:26292900-26292922 GGGGAGATTTGCAGGGGTGCGGG - Exonic
1182647876 22:31825087-31825109 GGGTAGAGTTGCGCCGAGGAGGG + Intronic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1183262914 22:36807441-36807463 GGCTAGAATTACAGGGAGAACGG + Intronic
1183557678 22:38543824-38543846 GAGTAGTTTGGCAGGAAGGATGG - Intronic
1184785431 22:46669279-46669301 GGTTTGATGTGCAGGGAGGTTGG + Intronic
949610605 3:5699504-5699526 GAGTAGTTTGGCAGGAAGGATGG + Intergenic
950209952 3:11115908-11115930 GGGCAGAATACCAGGGAGGAGGG - Intergenic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
951781526 3:26368617-26368639 GGCTTGAATTGCAGGGATGAGGG + Intergenic
952202682 3:31147661-31147683 GGGTAGAGTGGCTGGGAGGCAGG + Intergenic
952275008 3:31868333-31868355 GAATACATTTGCAGTGAGGATGG + Intronic
952650900 3:35725583-35725605 GGGAACATTCCCAGGGAGGAAGG - Intronic
952824015 3:37509972-37509994 AGGTACATTTGAAGGGAAGAGGG - Intronic
953207052 3:40840416-40840438 GTGAAGATTTGAAGGAAGGAGGG + Intergenic
954466429 3:50657857-50657879 GGGCAGATGTGCAGGGAGACTGG + Intergenic
954633149 3:52057545-52057567 GTGTCGATTTGCAGGCAGGCGGG + Intergenic
955144255 3:56300403-56300425 GGCTAGAAATGCAGAGAGGAGGG + Intronic
955926127 3:64006799-64006821 GGGATGATTTGCATGGAAGAGGG + Intergenic
956272378 3:67461830-67461852 GGGAAGATTTCCAAGGAGAAAGG + Intronic
956354302 3:68374079-68374101 GGGTAGAGATGCAAAGAGGAGGG - Intronic
956608535 3:71098211-71098233 GAATATACTTGCAGGGAGGAAGG - Intronic
959099675 3:101996197-101996219 GGGGACATTTCCAGGGAGAAGGG - Intergenic
960959867 3:123062702-123062724 GGCAAGAGTTGAAGGGAGGAAGG - Intergenic
961315582 3:126033170-126033192 GGGAGGATTTCCAGGCAGGAAGG + Intronic
963068907 3:141286494-141286516 GGGTAGATTTTCTAGGAGGAAGG + Intronic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
970652808 4:18197348-18197370 GAGTACATTTTCAGGGAGGCAGG + Intergenic
972291984 4:37697999-37698021 AGGTAGATTTCCAGGGATAAAGG - Intergenic
972656307 4:41066869-41066891 GGGTGGATTTGAAGGGGGCAGGG + Intronic
972658453 4:41089741-41089763 GGGTAGATTTACAGAGTAGAGGG - Intronic
973678713 4:53293429-53293451 GGGTACATTTGCAGGAATGCAGG - Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976968556 4:91076933-91076955 GGGCAGATTACCAGAGAGGAGGG + Intronic
977096214 4:92748442-92748464 GGGTAGAGTTGCTGGTGGGATGG - Intronic
978605516 4:110475409-110475431 TGATAGATTTGCATGGATGATGG + Intronic
978616662 4:110603791-110603813 GTGCAGATTTGGAGGAAGGAAGG - Intergenic
978838703 4:113184282-113184304 GATAAGATTTGCAGGGATGATGG + Intronic
979483115 4:121240805-121240827 GGGTACATTGGCAGTGAGGAAGG - Intergenic
980220289 4:129904092-129904114 GCGTAGTTTTCCTGGGAGGAGGG + Intergenic
981044080 4:140250576-140250598 GGGAAGAGGTGCAGGGAGGGAGG + Intergenic
981082446 4:140648797-140648819 GGGAACATCTGCAGGCAGGATGG - Intronic
982353623 4:154443544-154443566 GGGTATGTTTGCAGTGGGGATGG - Intronic
982719980 4:158849274-158849296 GGTTTGCCTTGCAGGGAGGAGGG + Intronic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
983481937 4:168285738-168285760 GGGTGGATATGCATGGGGGATGG + Intronic
985747380 5:1654952-1654974 GGGTGGAGTTGCAGGGTGGATGG - Intergenic
985766805 5:1784400-1784422 GGAAAGAGTTGCAGGGTGGAGGG - Intergenic
986728221 5:10615870-10615892 GGGTAGGTTAGCTGGGAGAATGG + Intronic
987001542 5:13664868-13664890 GGGAAGAGTTGGAGAGAGGAAGG + Intergenic
988050330 5:26021127-26021149 GGGAAGATTTGAAGGGTGAAAGG - Intergenic
990677636 5:58205632-58205654 TGGGAGATTTGGAAGGAGGAAGG - Intergenic
991311273 5:65245398-65245420 GGGTAGAAGGGTAGGGAGGATGG - Intronic
993876095 5:93308765-93308787 GGGTGGACTTGGAGAGAGGAAGG + Intergenic
996763834 5:127015361-127015383 GGGAAGATGAGCAGGGAGGAGGG + Intronic
997449301 5:133968717-133968739 AGGAAGGATTGCAGGGAGGAGGG + Exonic
997613686 5:135232048-135232070 GGGGAGATTTGCTGTGAGGTGGG + Intronic
997671115 5:135672867-135672889 GGGTAAAGATGGAGGGAGGAAGG - Intergenic
998096280 5:139397149-139397171 GGGGAGAGAGGCAGGGAGGAGGG + Intronic
1000244889 5:159441298-159441320 GAGTAGATTTGCAGGGCTGGAGG + Intergenic
1000416112 5:160985458-160985480 GGGTAAACTTGAAGGGAGGCTGG - Intergenic
1000917852 5:167103680-167103702 GGTTAGATTCACAGGGAGAATGG - Intergenic
1001266910 5:170280334-170280356 GGGAATGTGTGCAGGGAGGAGGG - Intronic
1001403194 5:171458619-171458641 GGGTAGTTTTCAAGGGAGGCAGG - Intergenic
1002660952 5:180790954-180790976 GGAGAGAGGTGCAGGGAGGAAGG - Exonic
1003175459 6:3750459-3750481 GGGAAGAATTGCGGGGTGGAGGG - Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004796805 6:19095403-19095425 GGGTAGATATGAATGGAGGAAGG - Intergenic
1005344720 6:24877895-24877917 GGGTAGTTTGGCAGGAAGGACGG + Intronic
1005952483 6:30642100-30642122 GGGTATAGTGGCTGGGAGGAGGG + Intronic
1006259750 6:32857920-32857942 GGGTCGTTTAGCAGGGATGATGG + Intronic
1006832177 6:36975676-36975698 GGGAAGATTTTCAAAGAGGAAGG - Exonic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007344057 6:41214971-41214993 GAGTAGTTTAGCAGGAAGGACGG + Intergenic
1010032378 6:71284787-71284809 TAGAATATTTGCAGGGAGGAAGG + Intergenic
1012258738 6:97063412-97063434 GGGGAGAATTGCAGGCAGAAGGG + Intronic
1013033389 6:106358024-106358046 TGGTAGTTTGGAAGGGAGGAAGG - Intergenic
1014078521 6:117264453-117264475 GGGTAGGGTCGCAGGAAGGAGGG + Intergenic
1015682800 6:135826288-135826310 ATGTAAATTTGTAGGGAGGAGGG + Intergenic
1016581598 6:145634366-145634388 AGGTAGATGTGGAGGGAGAAAGG - Intronic
1017723703 6:157262150-157262172 GGATTGATGTCCAGGGAGGAGGG - Intergenic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1019966154 7:4500283-4500305 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1022531636 7:31070396-31070418 GAGCAGACTTGGAGGGAGGAGGG + Intronic
1023291354 7:38671861-38671883 GGGCAGATTCGTGGGGAGGATGG + Intergenic
1023360585 7:39411193-39411215 GGATAGTTCGGCAGGGAGGAGGG + Intronic
1023870286 7:44259554-44259576 GGGAAGTTGTGCAAGGAGGAAGG - Intronic
1024349913 7:48353091-48353113 GGGGATGTTTGCAGAGAGGACGG + Intronic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1027775076 7:82454853-82454875 GGGTAGATTTGTAGAGATGGGGG + Intergenic
1028629124 7:92914542-92914564 GGGTAAATCTGCAGGAAGAAAGG - Intergenic
1029792374 7:102858276-102858298 GGGAAGAGTGGCAGGGAGGGAGG + Intronic
1030635415 7:111942680-111942702 GAGTAGTTTGGCAGGAAGGATGG - Intronic
1031727492 7:125259087-125259109 GGGGAGATTTGAAGCCAGGATGG - Intergenic
1031976313 7:128095694-128095716 GGGGAGTTTAGGAGGGAGGAAGG + Intergenic
1034563204 7:151894724-151894746 GGGCAGAGGAGCAGGGAGGATGG - Intergenic
1035600364 8:893682-893704 GGATAGACCTGCAGGCAGGAGGG - Intergenic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1036204125 8:6793009-6793031 GGGTTGATTTTCAGCGTGGAGGG + Intergenic
1038224746 8:25645468-25645490 GCTTAGGTTTGCAGGGAGGAGGG - Intergenic
1039414668 8:37383653-37383675 GCCTGGATTTGCATGGAGGAAGG + Intergenic
1039608171 8:38900035-38900057 GACTGGATTTGCAGGAAGGAGGG - Intergenic
1039833201 8:41234137-41234159 GGAAAGATTGGCATGGAGGAAGG - Intergenic
1039954189 8:42194859-42194881 GTGCATATTTGCAGGAAGGAGGG + Intronic
1040015386 8:42695427-42695449 GAGTATCTTTGCAGGGAGAAAGG + Intergenic
1040568531 8:48588221-48588243 GGATATCTTTGCAGGGAAGAAGG - Intergenic
1041347341 8:56913238-56913260 GGCTACATTTGAAGGGAAGATGG - Intergenic
1041895200 8:62916693-62916715 TTGCAGATTTGCAGAGAGGAAGG + Intronic
1042729621 8:71917668-71917690 GGGTAAATAAGCAGGGAGCAAGG + Intronic
1045396806 8:101768874-101768896 GGGTTGCTTTGCAGGGAAAAAGG + Intronic
1045658583 8:104412201-104412223 TGGCAGATTTGCAGGGATGCAGG + Intronic
1046823751 8:118663818-118663840 GAGTGGATTTGCAGGGACTAAGG + Intergenic
1046844687 8:118902766-118902788 GGACAGACATGCAGGGAGGAAGG - Intergenic
1047055373 8:121158423-121158445 GGGTAGACTTAGAGAGAGGATGG + Intergenic
1047211093 8:122841156-122841178 GGGAAGACAGGCAGGGAGGAAGG - Intronic
1047490856 8:125373582-125373604 GGGAAGTGTTGCAGAGAGGAAGG - Intergenic
1048150755 8:131891132-131891154 GGGCAGAGTTGCAGGGAGCGAGG + Intergenic
1048553159 8:135452704-135452726 GTATAGATTTGCAGGGCAGATGG + Intergenic
1048921555 8:139235979-139236001 AGGAAGATTTGCACGGAGAAAGG - Intergenic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1050485992 9:6135216-6135238 GGGTATATTTGCAGGAATGAAGG + Intergenic
1050851993 9:10300209-10300231 GGGAAGATTTGCTGGCAAGATGG + Intronic
1051310463 9:15765516-15765538 GGGTACAGTTGCAGGTAGGTTGG + Intronic
1052836350 9:33252861-33252883 GGGTAGGGTTGGAGGAAGGAAGG + Exonic
1056323020 9:85454186-85454208 CGGTAGATCTGCAGGGTGGCTGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1058506313 9:105669758-105669780 GGGTGGAGTTGGAGGCAGGAAGG - Intergenic
1059074852 9:111181947-111181969 GGGTAGATTTGCATGGAGAAAGG + Intergenic
1059751713 9:117253760-117253782 GGGCAGAATTGTGGGGAGGATGG + Intronic
1061532521 9:131225987-131226009 TGTTAGATTTGGAGGGAGGCAGG + Intronic
1061806236 9:133139248-133139270 TGGCAGATATGCAGGGAGCAGGG - Intronic
1186200725 X:7152678-7152700 AGGTATCCTTGCAGGGAGGAGGG + Intergenic
1186257612 X:7739803-7739825 AGGTAGATTCTCAGTGAGGATGG - Intergenic
1186974442 X:14886003-14886025 GGGCAGAGTTGGAGGGAGCAGGG + Intronic
1187834868 X:23421984-23422006 GAGTTAATTAGCAGGGAGGAAGG - Intergenic
1188170414 X:26917965-26917987 GGGTACATTTGCAGGGAATCTGG - Intergenic
1188509437 X:30919654-30919676 GGGTAAAGTACCAGGGAGGAGGG - Intronic
1189665541 X:43350957-43350979 GGGTACATTTGCAGGGAATCTGG + Intergenic
1190753234 X:53380272-53380294 GGGCAGGTATGTAGGGAGGAGGG - Intronic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1194275095 X:91869157-91869179 TGGTAGTTTTGAAGGGAGCAGGG + Intronic
1195542498 X:106078756-106078778 TGGGGGATTTGCAGGGAGGTGGG - Intergenic
1196519544 X:116656883-116656905 GGGTAGATATTAAGGGAGGTGGG + Intergenic
1197639277 X:128950323-128950345 AGGTGGATTTGAAGGGAGCAGGG - Intergenic
1198241672 X:134794043-134794065 GGGAAGCTCTGCAGAGAGGACGG - Intronic
1198421387 X:136473140-136473162 GGGGAGAAATGAAGGGAGGAAGG + Intergenic
1199784301 X:151090643-151090665 GGGTAGATTAGGAGTGGGGAGGG + Intergenic
1200592338 Y:5090561-5090583 TGGTAGTTTTGAAGGGAGCAGGG + Intronic
1201303076 Y:12526963-12526985 GAGTAGCTTTGGAGGGAGTAGGG - Intergenic