ID: 1103115953

View in Genome Browser
Species Human (GRCh38)
Location 12:118332066-118332088
Sequence CTGTGGGAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103115953_1103115959 -8 Left 1103115953 12:118332066-118332088 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1103115959 12:118332081-118332103 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103115953 Original CRISPR CTGTGGGAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr