ID: 1103115959

View in Genome Browser
Species Human (GRCh38)
Location 12:118332081-118332103
Sequence TCCCACAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842078
Summary {0: 2641, 1: 295980, 2: 261775, 3: 149501, 4: 132181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103115953_1103115959 -8 Left 1103115953 12:118332066-118332088 CCTTCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1103115959 12:118332081-118332103 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1103115951_1103115959 3 Left 1103115951 12:118332055-118332077 CCTCAGGTGATCCTTCCACCTTG 0: 15
1: 726
2: 10262
3: 35679
4: 73816
Right 1103115959 12:118332081-118332103 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1103115950_1103115959 8 Left 1103115950 12:118332050-118332072 CCTGACCTCAGGTGATCCTTCCA 0: 37
1: 2025
2: 28169
3: 74642
4: 125501
Right 1103115959 12:118332081-118332103 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1103115949_1103115959 11 Left 1103115949 12:118332047-118332069 CCGCCTGACCTCAGGTGATCCTT 0: 1
1: 46
2: 731
3: 3309
4: 10654
Right 1103115959 12:118332081-118332103 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103115959 Original CRISPR TCCCACAGTGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr