ID: 1103118128

View in Genome Browser
Species Human (GRCh38)
Location 12:118355378-118355400
Sequence CCAATTTGATGGAACAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103118128 Original CRISPR CCAATTTGATGGAACAGCCC GGG (reversed) Intronic
901900604 1:12358580-12358602 CCAATGTTATAGATCAGCCCTGG - Exonic
904341680 1:29839134-29839156 CCAAGGTGATGGACCAGTCCTGG - Intergenic
908265286 1:62372854-62372876 CCAAAATGATGTAACAGGCCGGG + Intergenic
909842120 1:80340603-80340625 CATATTTGATGGTTCAGCCCTGG + Intergenic
915770771 1:158420563-158420585 ACATTTGGATGGCACAGCCCAGG + Exonic
915774287 1:158465843-158465865 ACATTTGGATGGCACAGCCCAGG - Exonic
923509674 1:234639483-234639505 CCACTTTGATGGTATAGACCTGG - Intergenic
1064405677 10:15059910-15059932 GCAATTTGATGGACAAGCCTTGG + Intronic
1067156709 10:43787841-43787863 CCAATTTGTTGGGAAGGCCCTGG - Intergenic
1070369453 10:75768142-75768164 CCCATTTGTTGTAACAGCCATGG + Intronic
1070680972 10:78448773-78448795 CCATTTGCATGGAACAGCCAAGG + Intergenic
1073326523 10:102646583-102646605 CCAATCGGATGGACTAGCCCTGG + Intronic
1075469197 10:122675450-122675472 CCCATTTATGGGAACAGCCCTGG - Intergenic
1077410546 11:2401928-2401950 CCTATTTGCTGGAAGATCCCCGG - Intronic
1078327307 11:10391195-10391217 TTAATTTGATGGGACAGCACTGG + Intronic
1084839612 11:71834520-71834542 CTAATTGGATAGAACAGCACAGG + Intronic
1086371171 11:86157071-86157093 CCAACTTGCTGGAAAAGCTCAGG - Intergenic
1095927524 12:47593758-47593780 CCCATTTGATCCACCAGCCCAGG + Intergenic
1097754521 12:63394522-63394544 CCAGGTAGATGGCACAGCCCTGG + Intergenic
1100446753 12:94668210-94668232 AAAATTTGATGGAAGAGGCCAGG + Intergenic
1103118128 12:118355378-118355400 CCAATTTGATGGAACAGCCCGGG - Intronic
1104484831 12:129142077-129142099 CCCATTTGATGGAAAAGACAAGG + Intronic
1104554659 12:129788850-129788872 CCAGTTAGACGGAAGAGCCCTGG + Intronic
1105929517 13:25039378-25039400 CCAATTAGAAGGTAAAGCCCTGG - Intergenic
1106361058 13:29030884-29030906 CCAATTGGCAGGAACAGCACAGG + Intronic
1114963526 14:27926337-27926359 GTAATTTGCTTGAACAGCCCTGG + Intergenic
1117276293 14:54197383-54197405 CCAAGGTGATTGCACAGCCCAGG + Intergenic
1118481942 14:66175872-66175894 TGAATTTGATTGAACACCCCTGG - Intergenic
1119150322 14:72353685-72353707 CAAAATTCATGGAACAGGCCAGG + Intronic
1120168778 14:81228370-81228392 GCACTTTGATACAACAGCCCTGG - Intergenic
1120602097 14:86523562-86523584 CCAAGATGATGGCACATCCCAGG + Intergenic
1124347215 15:28930861-28930883 CCGCCTTGAAGGAACAGCCCAGG - Intronic
1133204353 16:4224085-4224107 GCACAGTGATGGAACAGCCCTGG + Intronic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1138251965 16:55508662-55508684 CTCACTTAATGGAACAGCCCAGG + Intergenic
1140255769 16:73334751-73334773 CCAATTTAATGGAAGATCACAGG - Intergenic
1140431959 16:74911801-74911823 CCAATTTCATTTAGCAGCCCAGG - Intronic
1144682187 17:17203541-17203563 CCAATTTGCTGGCACAACCTCGG + Intronic
1155364214 18:25034186-25034208 ATAATTTGATGCAACAGCACAGG - Intergenic
1160838373 19:1135473-1135495 CCAATGTGACAGCACAGCCCAGG + Intronic
1163171095 19:15531650-15531672 CCAACTTGTGGGAAGAGCCCTGG + Intronic
1164473700 19:28556279-28556301 CTACTTTGCTGGAACAGCACAGG - Intergenic
925164347 2:1706180-1706202 CCAATTTCATAGAATAACCCGGG - Intronic
928620747 2:33085292-33085314 GCAATTTGTTAGAGCAGCCCTGG + Intronic
930090688 2:47529229-47529251 CCAGTTGCTTGGAACAGCCCTGG - Intronic
930738102 2:54800328-54800350 CCAATCTGATGGAACAGTGGGGG - Intronic
932733026 2:74233780-74233802 GTAATTTGCTGCAACAGCCCTGG + Intronic
933299868 2:80529639-80529661 CCTATTTGAGGCAACAGCCTGGG + Intronic
943487191 2:188500847-188500869 CCAATTTGATAGAACATGGCTGG - Intronic
944442156 2:199753572-199753594 CCAATGTGATGGAACAAGCGTGG + Intergenic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
1172259684 20:33551825-33551847 AAAAGTTGATGGAACAGGCCAGG - Intronic
1174484002 20:50850114-50850136 CCACTTTTATGCACCAGCCCTGG + Intronic
1182519217 22:30876010-30876032 CCAAGTTTAGGGAAGAGCCCGGG + Intronic
1183196141 22:36354821-36354843 ACAATTGGATGGGACATCCCAGG - Intronic
949288674 3:2437645-2437667 CCATTCTGATGGAAAAACCCTGG + Intronic
949298296 3:2552788-2552810 CCAATTTGATGGAACATGGTTGG + Intronic
949566987 3:5254083-5254105 CCATTTTCAAAGAACAGCCCTGG - Intergenic
950631407 3:14284517-14284539 CAAATTTGAAGGAGCACCCCAGG + Intergenic
951600790 3:24372586-24372608 CCTATGTAAAGGAACAGCCCTGG - Intronic
952071257 3:29639103-29639125 TCAATTTGAGGGAAGAGGCCTGG + Intronic
953540542 3:43813961-43813983 CCACTTTGATGCAACTGCCAAGG - Intergenic
955263733 3:57421538-57421560 CCCATTTGATGAAAAAGGCCTGG - Intronic
964430754 3:156603962-156603984 CCAATGAGGTGGAACAACCCTGG - Intergenic
966391040 3:179452409-179452431 ACAATTTAAAGAAACAGCCCTGG + Intergenic
966693303 3:182763068-182763090 CCAATTTGAAGGGACAGAGCAGG - Intergenic
968970443 4:3790980-3791002 GCCATTGGATGGAACAGCCTGGG + Intergenic
969780693 4:9400532-9400554 CTAATTGGATAGAACAGCACAGG + Intergenic
970762197 4:19503567-19503589 TCAATTTTATGGCACAGACCTGG - Intergenic
971193329 4:24448185-24448207 CTAACTTGATGAAACAGCCTTGG + Intergenic
980574298 4:134665771-134665793 CCAAAAGGATGTAACAGCCCTGG + Intergenic
987414420 5:17648064-17648086 CCAATTAGCAGGAACAGCCTAGG + Intergenic
988817007 5:34844182-34844204 CTAATTTGATGGGACAGCCAGGG - Intronic
990817012 5:59797059-59797081 ACAATTTGATGCAACGGCTCAGG - Intronic
996789807 5:127280939-127280961 CCAATCAGATGCATCAGCCCTGG + Intergenic
996996056 5:129697895-129697917 CCAATTTGGTGAAAGAGCCATGG + Intronic
1006925410 6:37651579-37651601 CCAAATGGAGGAAACAGCCCTGG + Intronic
1009771939 6:68154378-68154400 CTAACTTGTTGGAACAGCCTGGG + Intergenic
1018146976 6:160900560-160900582 CCAATTGGAAGAATCAGCCCAGG - Intergenic
1024199229 7:47089538-47089560 CCCATTTGATGACACAGCCATGG + Intergenic
1025968715 7:66301455-66301477 ACTATTTGATGGAAGAGGCCTGG + Intronic
1027698482 7:81438770-81438792 CCAATTTGAAGAACCTGCCCAGG - Intergenic
1033548332 7:142422762-142422784 ATAATATCATGGAACAGCCCTGG - Intergenic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1035969277 8:4228992-4229014 TCAATTTCATGGAAAAGTCCAGG - Intronic
1036278128 8:7374465-7374487 CTAATTGGATAGAACAGCACAGG + Intronic
1036278874 8:7381371-7381393 CCAAATTGATTGATCAGCCAAGG - Intronic
1036342648 8:7930495-7930517 CCAAATTGATTGATCAGCCAAGG + Intronic
1036343394 8:7937426-7937448 CTAATTGGATAGAACAGCACAGG - Intronic
1036627760 8:10485777-10485799 CCAACTTGTAGGAACAACCCTGG - Intergenic
1037950476 8:23016099-23016121 CTAAATTGATGGTACAACCCAGG + Intronic
1038017908 8:23530163-23530185 CCTAATTCATGCAACAGCCCTGG + Intronic
1043541919 8:81273634-81273656 CCAATGGGATAGAATAGCCCAGG - Intergenic
1046190483 8:110788869-110788891 GCAATTTGTTGGAATAGCCTAGG + Intergenic
1047992157 8:130297530-130297552 CCAATCTGATTCCACAGCCCAGG + Intronic
1049447507 8:142638182-142638204 CCACTTTGAGGGCACAGCCTGGG + Intergenic
1049778325 8:144416337-144416359 CCAATTTGATGGCAGAGGGCCGG + Intronic
1051158963 9:14184131-14184153 CCAATTTTATGGAAGATCCTAGG + Intronic
1052447010 9:28575796-28575818 CCATTTGCATGGAACATCCCAGG + Intronic
1058642680 9:107102597-107102619 CCAGTTTGAAGGAACAGCTCTGG - Intergenic
1059921351 9:119163844-119163866 CCAATTTGATGCAGCAACCAAGG - Intronic
1061033686 9:128101837-128101859 GAAATCTCATGGAACAGCCCTGG + Intronic
1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG + Intronic
1185844847 X:3428091-3428113 CCCATTTGTTGGAACATCGCAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189217948 X:39343510-39343532 GCAATTTGATGGAGCATTCCTGG - Intergenic
1194780750 X:98022980-98023002 ACAAGCTGATGGAAGAGCCCTGG - Intergenic
1197186776 X:123596248-123596270 CCAATTTGTTATACCAGCCCAGG - Intergenic
1198282801 X:135158558-135158580 CCAATATGAGGGAGCAGCACAGG + Intronic
1198285078 X:135181508-135181530 CCAATCTGAGGGAACAGCACAGG + Intergenic
1201462129 Y:14238299-14238321 CCAATATCATGGAACAGCATGGG + Intergenic