ID: 1103120175

View in Genome Browser
Species Human (GRCh38)
Location 12:118373194-118373216
Sequence CGCACCCCAGGCGGGCCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103120175_1103120181 17 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55
1103120175_1103120180 4 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103120175 Original CRISPR CGCACCCCAGGCGGGCCCGT AGG (reversed) Intergenic