ID: 1103120175

View in Genome Browser
Species Human (GRCh38)
Location 12:118373194-118373216
Sequence CGCACCCCAGGCGGGCCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103120175_1103120180 4 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191
1103120175_1103120181 17 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103120175 Original CRISPR CGCACCCCAGGCGGGCCCGT AGG (reversed) Intergenic
900265438 1:1754756-1754778 CCCACCCCAGGGAGGCCAGTGGG + Intronic
900399434 1:2467021-2467043 CTCACCCCAGGAGGGCCTCTGGG - Intronic
901526102 1:9824161-9824183 CGCGCTCCAGGCGGGGCCGACGG - Exonic
902286113 1:15409798-15409820 CGCACGCCGCGCGGGCCCGGGGG + Intergenic
902815424 1:18913716-18913738 CCCACCCCAGGCGGGGCCCTGGG - Intronic
903778561 1:25808178-25808200 GGCACCCAAGGCTGGCCCATGGG + Intronic
913660327 1:121001384-121001406 CGCACTCCAGGCGGGCCCTGGGG + Intergenic
914011692 1:143784541-143784563 CGCACTCCAGGCGGGCCCTGGGG + Intergenic
914166140 1:145176593-145176615 CGCACTCCAGGCGGGCCCTGGGG - Intergenic
914650318 1:149693200-149693222 CGCACTCCAGGCGGGCCCTGGGG + Intergenic
921053314 1:211526517-211526539 GGCACCCCAGGCATGCCCGAGGG + Intergenic
922933764 1:229408903-229408925 GGCAGCCCAGGCGGGCCCATGGG - Intergenic
924943688 1:248830260-248830282 CACACCCCAGACGGGGCGGTGGG - Intergenic
1062992915 10:1836768-1836790 CGCACCCCAGCCTGCCCTGTGGG - Intergenic
1069834718 10:71301303-71301325 CGCACCCCAGCGGGGCTGGTGGG - Exonic
1070895844 10:79982370-79982392 CGCTCCCGCGGCGGGGCCGTGGG + Intronic
1073249831 10:102114653-102114675 CGCCCCCCAGGCCGGCCCCCTGG - Intronic
1078184459 11:9039997-9040019 CGCACCACAGGAGTGTCCGTGGG + Intronic
1079093592 11:17496931-17496953 TGGGCCCCAGGTGGGCCCGTGGG - Intronic
1083919882 11:65776772-65776794 CTCACGCCAGGCAGGCCAGTGGG - Exonic
1083928372 11:65823420-65823442 GGGACCCCAGGCAGGCCAGTGGG + Intronic
1084399587 11:68935966-68935988 CACACCCCAGGCGGCCCCTGAGG + Intronic
1089543690 11:119206381-119206403 CGGAGCCCAGGCGGGTCCGCCGG - Exonic
1090365423 11:126201311-126201333 TGTTCCCCAGGCGGGCACGTTGG - Intergenic
1090657003 11:128854009-128854031 AGCAGTCCAGGCTGGCCCGTGGG + Intronic
1094411223 12:30170308-30170330 GGCACCACAGGCGGGACCGCGGG - Intergenic
1102953471 12:117045225-117045247 CCCACCTCATGGGGGCCCGTAGG + Intronic
1103120175 12:118373194-118373216 CGCACCCCAGGCGGGCCCGTAGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1113362330 13:109642998-109643020 AGCATCCCAGGAGGGCCCCTAGG - Intergenic
1113766053 13:112881754-112881776 GTCACCCCAGGCAGCCCCGTGGG + Intronic
1113788573 13:113015635-113015657 TGCACCCCAGGCCGGGCCTTGGG + Intronic
1113820275 13:113208727-113208749 CGCACCCGCGGCGGGGCCGGGGG - Intronic
1115769343 14:36654535-36654557 CGCCTCCGAGGCGGGCCCGAGGG - Intergenic
1119732691 14:76961138-76961160 AGCACCCCAGGAGTGCCTGTAGG + Intergenic
1120130631 14:80802518-80802540 CACACACCAGGGGGGCCTGTTGG + Intronic
1122116605 14:99530695-99530717 AGCACCCCAGGCGGTCCCAAGGG - Intronic
1122736552 14:103847127-103847149 CGCCCCCCAGGCGGGCAGGTGGG - Intronic
1122839600 14:104450867-104450889 CGCAACCCAGGCGAGGCCGGAGG + Intergenic
1133972887 16:10580118-10580140 CGCAGCCCAGGAGGACCCGCTGG + Intronic
1135424559 16:22325877-22325899 CGCACACCGGGCGGGACCGCAGG - Exonic
1136719782 16:32310658-32310680 CCCACCCCTGCCGGGCCCGTCGG + Intergenic
1136838157 16:33516938-33516960 CCCACCCCTGCCGGGCCCGTCGG + Intergenic
1136878893 16:33886223-33886245 CTCACCCCAGGGGGCCCCCTGGG - Intergenic
1138105135 16:54284032-54284054 GGCACCCCAGGCGCGGCCGGAGG - Intronic
1142156418 16:88534604-88534626 CGCGCCCCTGGCCGGCCCGGGGG + Exonic
1203006649 16_KI270728v1_random:207111-207133 CCCACCCCTGCCGGGCCCGTCGG - Intergenic
1203093127 16_KI270728v1_random:1229166-1229188 CTCACCCCAGGGGGCCCCCTGGG + Intergenic
1203148327 16_KI270728v1_random:1817218-1817240 CCCACCCCGGCCGGGCCCGTCGG + Intergenic
1143541638 17:7572916-7572938 GCTACCCCCGGCGGGCCCGTCGG - Intronic
1144960709 17:19042558-19042580 CACACCACAGGTGGGCCCGGAGG + Intronic
1144974451 17:19131966-19131988 CACACCACAGGTGGGCCCGGAGG - Intronic
1160564637 18:79779589-79779611 CGCGCCCCTGGGGGGCTCGTGGG - Intergenic
1161096943 19:2397626-2397648 AGCACTCCAGGCGGGCACGGTGG + Intronic
1162562311 19:11423816-11423838 CCCACCCCAGACGGGCCCCAGGG - Intronic
1163699073 19:18778085-18778107 CTCACCGCAGGCAGGCCCATCGG + Exonic
1164694312 19:30232128-30232150 CCCACCCCAGGTGGGCCAGATGG - Intronic
1166380683 19:42353681-42353703 CCCAGCCCTGGCTGGCCCGTTGG - Intronic
1167166432 19:47802830-47802852 CGCACCTCAGCGGGGCCCCTCGG - Exonic
1167589915 19:50398889-50398911 TGCCCCCAAAGCGGGCCCGTGGG + Exonic
926341660 2:11909240-11909262 CACACCCCAGGCAGGCCAGCAGG - Intergenic
932903445 2:75725225-75725247 CACACCCCAGACGGGGCGGTGGG - Intergenic
1168757074 20:325431-325453 CGCAGCCCAAGCGGGCACCTCGG + Exonic
1169016905 20:2299492-2299514 CACACCCCAGCCTGGCACGTGGG - Intronic
1170960384 20:21020268-21020290 CACATCCAAGGCGGCCCCGTGGG - Intergenic
1176088630 20:63309266-63309288 CCCACCGCAGGTGGCCCCGTCGG + Intronic
1176154277 20:63610232-63610254 CGCACACCAGCCGGGCACGGTGG + Intronic
1176618482 21:9040347-9040369 GGTACCCCTAGCGGGCCCGTAGG + Intergenic
1178920318 21:36734515-36734537 TGCACCCCAGCCAGGCCGGTGGG + Intronic
1179631809 21:42683552-42683574 GGCAGCCCAGGCGGCCCCGGAGG - Intronic
1180615439 22:17122917-17122939 CCCACCCCAGCCGGGCGCGGTGG + Intronic
1182211385 22:28679968-28679990 CCCACCCCCGCCGGGCCCGTCGG + Intergenic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184308810 22:43628008-43628030 TGCACCCCAGGAGGCCCCCTCGG - Intronic
954382581 3:50227483-50227505 CGCACCCCAGGCCCGCCAGGAGG + Intronic
963741584 3:149086702-149086724 CGCCCCCAAGGCGGGCGCGCGGG + Intergenic
967956486 3:194881349-194881371 CGGCACCCAGGCAGGCCCGTGGG + Intergenic
968126445 3:196163874-196163896 TGCAACCCAGGCCGGCCCGGGGG - Intergenic
968921434 4:3524115-3524137 CGCACACCAGGTGGGCCCGTGGG - Intronic
969413468 4:7043952-7043974 CGCACCCCAGAAGGCCCCGGAGG + Intronic
973729732 4:53811550-53811572 CACACCCCATCCGGCCCCGTAGG + Intronic
991494737 5:67215882-67215904 AGCAACCCAGGCGGGGCTGTGGG - Intergenic
1002819377 6:710842-710864 GGCACCCCAGGCCGGGTCGTGGG + Intergenic
1003318215 6:5030352-5030374 CCCACCCCAGGCTGGGCCCTGGG + Intergenic
1004492508 6:16129577-16129599 CGCACCCCACGCGCGCCAGGAGG - Intronic
1013372472 6:109482998-109483020 TGCTCCCCAGTCGGGCCCGCGGG - Intronic
1015315069 6:131808089-131808111 CGCTCCCCGGGAGGGCCCGGCGG + Exonic
1017912787 6:158808644-158808666 GGCATCCCAGGCGGGCACGCAGG + Intronic
1018093895 6:160367970-160367992 CTCAGCCCAGGCAGGCCAGTGGG - Intronic
1019348803 7:543490-543512 CTCACCCCAGCAGGGCGCGTGGG + Intergenic
1020106479 7:5424391-5424413 CGCACCCCAGGGGAGGCCGGGGG - Intronic
1022427973 7:30285598-30285620 CGCTCCCTCGGCGGGGCCGTGGG + Exonic
1039554601 8:38467418-38467440 CGCACCCCAGGCTTTCCCGGGGG + Intronic
1041068081 8:54101621-54101643 CGCACCCCACCCGGGCCGGGAGG + Intronic
1042738529 8:72016659-72016681 CTCACCCCAGGAGGCCACGTGGG - Intronic
1048986349 8:139737186-139737208 CGCTCCCCAGGCAGGCCCTGAGG + Intronic
1049283671 8:141763163-141763185 GGCACCCCAGGCTGGCCTGCAGG + Intergenic
1049573582 8:143380543-143380565 CACACACCATGTGGGCCCGTGGG - Intronic
1049783285 8:144438752-144438774 CCCACCCCAGGGGAGTCCGTGGG + Intronic
1056755130 9:89376939-89376961 CGCACCCGAGGCTGGCCAGGGGG + Exonic
1061677104 9:132223689-132223711 CACACCCCAGGCGGGACGGGTGG + Intronic
1189321118 X:40088181-40088203 CCCACTCCAGGAGGGCCCCTAGG + Intronic
1200114193 X:153762961-153762983 GGCAGACCAGGCAGGCCCGTGGG - Intergenic
1201188830 Y:11429739-11429761 CCCACCCCCGCCGGGCCTGTCGG - Intergenic