ID: 1103120180

View in Genome Browser
Species Human (GRCh38)
Location 12:118373221-118373243
Sequence GTCTTGTTTGTGCTGCTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103120169_1103120180 21 Left 1103120169 12:118373177-118373199 CCTTGCAACTTTAGTAACCTACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191
1103120175_1103120180 4 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191
1103120177_1103120180 -4 Left 1103120177 12:118373202-118373224 CCCGCCTGGGGTGCGGTCAGTCT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191
1103120179_1103120180 -8 Left 1103120179 12:118373206-118373228 CCTGGGGTGCGGTCAGTCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191
1103120178_1103120180 -5 Left 1103120178 12:118373203-118373225 CCGCCTGGGGTGCGGTCAGTCTT 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1103120180 12:118373221-118373243 GTCTTGTTTGTGCTGCTCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103120180 Original CRISPR GTCTTGTTTGTGCTGCTCTC CGG Intergenic