ID: 1103120181

View in Genome Browser
Species Human (GRCh38)
Location 12:118373234-118373256
Sequence TGCTCTCCGGTCAAAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103120177_1103120181 9 Left 1103120177 12:118373202-118373224 CCCGCCTGGGGTGCGGTCAGTCT 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55
1103120179_1103120181 5 Left 1103120179 12:118373206-118373228 CCTGGGGTGCGGTCAGTCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55
1103120175_1103120181 17 Left 1103120175 12:118373194-118373216 CCTACGGGCCCGCCTGGGGTGCG 0: 1
1: 0
2: 1
3: 12
4: 90
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55
1103120178_1103120181 8 Left 1103120178 12:118373203-118373225 CCGCCTGGGGTGCGGTCAGTCTT 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1103120181 12:118373234-118373256 TGCTCTCCGGTCAAAGTTCATGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103120181 Original CRISPR TGCTCTCCGGTCAAAGTTCA TGG Intergenic