ID: 1103122145

View in Genome Browser
Species Human (GRCh38)
Location 12:118389239-118389261
Sequence CCCACGGGCTGGGGCAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 659}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103122145_1103122155 7 Left 1103122145 12:118389239-118389261 CCTACCCTGCCCCAGCCCGTGGG 0: 1
1: 0
2: 1
3: 74
4: 659
Right 1103122155 12:118389269-118389291 TCTTCCACCGAACTGGTCCCTGG 0: 1
1: 10
2: 344
3: 908
4: 1390
1103122145_1103122154 0 Left 1103122145 12:118389239-118389261 CCTACCCTGCCCCAGCCCGTGGG 0: 1
1: 0
2: 1
3: 74
4: 659
Right 1103122154 12:118389262-118389284 AGAATTGTCTTCCACCGAACTGG 0: 1
1: 2
2: 19
3: 496
4: 1125
1103122145_1103122158 18 Left 1103122145 12:118389239-118389261 CCTACCCTGCCCCAGCCCGTGGG 0: 1
1: 0
2: 1
3: 74
4: 659
Right 1103122158 12:118389280-118389302 ACTGGTCCCTGGTGCCAAAAAGG 0: 413
1: 844
2: 1234
3: 1037
4: 767
1103122145_1103122159 22 Left 1103122145 12:118389239-118389261 CCTACCCTGCCCCAGCCCGTGGG 0: 1
1: 0
2: 1
3: 74
4: 659
Right 1103122159 12:118389284-118389306 GTCCCTGGTGCCAAAAAGGTTGG 0: 923
1: 1683
2: 1429
3: 952
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103122145 Original CRISPR CCCACGGGCTGGGGCAGGGT AGG (reversed) Intronic
900150672 1:1178029-1178051 CCCACGGGCAGGGGAAGGTGGGG - Intronic
900379222 1:2375566-2375588 ATGAAGGGCTGGGGCAGGGTGGG + Intronic
900898993 1:5504139-5504161 CCCTGGGGCTGGGGCAGGTCTGG + Intergenic
900992306 1:6103705-6103727 CCCACGTGCAGTGTCAGGGTCGG + Exonic
901176565 1:7304047-7304069 CTCAAGGGCTGGGGGAGGGGAGG + Intronic
901517149 1:9755663-9755685 CCCAGGAGCTGGGGCAGCGCTGG - Intronic
901873613 1:12153197-12153219 CGCAGGAGCTTGGGCAGGGTGGG - Intergenic
902221596 1:14969450-14969472 CCGAGGGGCTGGCTCAGGGTGGG - Intronic
902391477 1:16109626-16109648 CCCCCTGGGTGGAGCAGGGTAGG - Intergenic
902449138 1:16485532-16485554 CCCCTGAGATGGGGCAGGGTGGG - Intergenic
902468531 1:16632238-16632260 CCCCTGAGATGGGGCAGGGTGGG - Intergenic
902626576 1:17680071-17680093 GGCAGGGGCAGGGGCAGGGTGGG - Intronic
902686044 1:18078288-18078310 CCCATGGGCTGGGGGAGGAGTGG - Intergenic
902990885 1:20186259-20186281 CCCCCGGGCTGGGTCTGGGGAGG - Intronic
903506009 1:23836595-23836617 CCCAGGGGCTGGGGTGGTGTGGG + Intronic
903655660 1:24947601-24947623 CCCATCTGCTGGGGCAGGGTGGG - Intronic
903850716 1:26304293-26304315 GGCAGGGGCTGGGGCAGGGTGGG - Intronic
904171050 1:28592443-28592465 GCCCCGGGCAGGGGCGGGGTCGG + Intronic
905028266 1:34865711-34865733 CCCGCGGGGTGGGGGAGGGGGGG + Exonic
905406370 1:37735296-37735318 CCCAGGGGCTCCGGCAGGGATGG + Exonic
905419692 1:37832623-37832645 TTCACGGGGTGGGGCAGGGGAGG - Intronic
905863717 1:41365963-41365985 CCCAGGGGCTGGGGCAGCCTGGG + Intronic
906102091 1:43270354-43270376 CGCAGGAGCTGGGGCAGGGGTGG + Intronic
906149715 1:43580620-43580642 CACTCTGCCTGGGGCAGGGTGGG - Intronic
907339790 1:53726711-53726733 CCCTAGGGCTGGGGGAGGTTGGG - Intronic
907431377 1:54414086-54414108 CCCTCTGGCTGGGGAAGGGAGGG - Intergenic
907516259 1:54995222-54995244 CCCAGGGGCTAGGACAGGGTAGG - Intergenic
907528901 1:55073039-55073061 CCCAGGGGCTGGGGGAAGGGAGG + Intronic
908168695 1:61483912-61483934 CCCTGAGGCTGGGGCAGGGATGG + Intergenic
908221419 1:62010440-62010462 ACCAGAGGCTGGGGCGGGGTGGG - Intronic
908597245 1:65701358-65701380 CCATGGGGCTGGGGCAGGCTAGG - Intergenic
910227198 1:84947930-84947952 CCCAGGGGCAGGGGCAGGAAGGG - Intronic
910230615 1:84983057-84983079 CTCAGGGGATGGGGCAGGGTAGG + Intronic
911158113 1:94656291-94656313 CCCTCTGAATGGGGCAGGGTGGG - Intergenic
912247434 1:107974777-107974799 GCCAGGGGCTGAGGCAGGGTGGG + Intergenic
912949200 1:114108991-114109013 CCCAGGGGTTGTGGGAGGGTAGG + Intronic
915108531 1:153548855-153548877 CTCATGGGCTGGGGCAGACTGGG - Intronic
915313906 1:155017584-155017606 CCCCCGGGCTGGCGCAGCGAAGG + Exonic
918779771 1:188684546-188684568 TCCATGGACTGGGGCAGGGAGGG + Intergenic
919764332 1:201116416-201116438 CACAGGGACTGGGGCAGGGAAGG - Intronic
920076362 1:203340197-203340219 CCAACGGGCTTTGGCAGGCTTGG + Intergenic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
920259604 1:204679932-204679954 GCCACTGGCTTGGGCAGGGCTGG + Intronic
920269046 1:204749686-204749708 CCCACTTACTGGGGGAGGGTAGG + Intergenic
920491037 1:206415500-206415522 CCGAGGGGCCAGGGCAGGGTGGG + Intronic
920586622 1:207170144-207170166 CCCACGGGCTGGGACAGTTCTGG + Intergenic
922559490 1:226558856-226558878 CCCACAATCTGGGGCAGGGTAGG + Intronic
922677222 1:227560544-227560566 CCCACGGGCTGGGTCCTCGTCGG + Intergenic
922773754 1:228205658-228205680 CCCAAGGCCTGGGGGATGGTGGG - Intronic
924220703 1:241872509-241872531 ACCCCGGCCTGTGGCAGGGTAGG - Intronic
924736376 1:246760719-246760741 CCCAAGGCCTGAGCCAGGGTTGG - Intronic
924771777 1:247085955-247085977 CCCACTGTCTGGGTCAAGGTTGG - Intergenic
1062883154 10:995024-995046 CCCAGGAGGTGGGGCAGGCTAGG + Intronic
1064000541 10:11660511-11660533 GCCAGGGGCTGGGGGAGGGGAGG + Intergenic
1064241482 10:13633576-13633598 CTCATGGGGTGGGGCAGGGTAGG - Intronic
1065215085 10:23440157-23440179 CCCAGGGGCTGGGAGAGGGGCGG + Exonic
1065925790 10:30433404-30433426 CCAAGAGGCTGCGGCAGGGTGGG - Intergenic
1066994494 10:42551833-42551855 CCCACAGGCTGGGTGATGGTGGG - Intergenic
1067238726 10:44472776-44472798 ACCAGGGGCTGGGGGAGAGTGGG - Intergenic
1067477958 10:46578824-46578846 CCTGCGGCTTGGGGCAGGGTGGG - Intronic
1067499244 10:46786903-46786925 GCCGCGGGCTGGGGTAGGCTGGG + Intergenic
1067606667 10:47670019-47670041 TCCAGGGGCTGGGGGAGGGAGGG - Intergenic
1069456858 10:68560676-68560698 CCCGAGGGCTGGTGCAGGCTTGG + Exonic
1069718310 10:70534539-70534561 GCAAAGGGCTGGGGCAGGGGTGG + Intronic
1069753600 10:70760480-70760502 GCCAGGGTCTGGGCCAGGGTTGG - Exonic
1069807851 10:71137137-71137159 CCCACCGGCTTTGGCAGGGAGGG - Intergenic
1069962647 10:72087743-72087765 CCCAGCGGCTGGGGCAGGCCCGG + Intronic
1070158839 10:73853320-73853342 CCGACAGGATGGGGCAGGGGTGG - Intronic
1070703414 10:78619544-78619566 ACCAAGGGCTGCGGCAGGGATGG - Intergenic
1070788163 10:79174283-79174305 CCCACTGGGAGGGGCAGGGAAGG + Intronic
1071515026 10:86291491-86291513 CCCCTGGGCTGAGGCAGGGCTGG - Intronic
1071784111 10:88880211-88880233 CCCAGGGGCCGGGGCAGGGGAGG + Exonic
1072230307 10:93408941-93408963 CCCACGTGCTGGGAAAGGTTGGG - Intronic
1072709306 10:97705711-97705733 CCCAAGGGCTGGGCTAGTGTTGG - Intergenic
1073124056 10:101139173-101139195 CTGCCGGGCAGGGGCAGGGTTGG - Intergenic
1073192516 10:101661793-101661815 CCCAGGGTCAGGGGCAGAGTGGG - Intronic
1073206005 10:101769762-101769784 CCCACCAGCTGGGGCAAGGTTGG + Intergenic
1073487896 10:103832736-103832758 CACACACACTGGGGCAGGGTGGG + Intronic
1075324733 10:121522119-121522141 GCCAGGGGCTGGGACAGGGAAGG + Intronic
1075753413 10:124791949-124791971 CCCCCGCGCTGGGGCTGGGATGG + Intergenic
1076526949 10:131117943-131117965 CCCCCAGGCAGGGCCAGGGTTGG - Intronic
1076616554 10:131759048-131759070 CTCCAGGGCTGGGGGAGGGTGGG - Intergenic
1076647101 10:131961155-131961177 CCCAGGGGTTGGGGAAGCGTCGG - Intergenic
1076715067 10:132359525-132359547 CCCACGGGCTGGGCTGGGCTGGG + Intronic
1076731758 10:132442765-132442787 CCCACGGGGTGGGCAAGGGGTGG - Intergenic
1076865889 10:133166109-133166131 GCCAGCCGCTGGGGCAGGGTAGG + Intronic
1076908211 10:133373598-133373620 CCCGAGGGCTGGGGCGGGGGCGG - Exonic
1076947835 10:133664529-133664551 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076948825 10:133667839-133667861 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
1076949809 10:133671138-133671160 CCCGCGCGCCGGGGCAGGTTGGG - Intronic
1076950793 10:133674437-133674459 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076951783 10:133677747-133677769 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076952772 10:133681057-133681079 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076953756 10:133684356-133684378 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076954740 10:133740708-133740730 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076955729 10:133744018-133744040 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076956719 10:133747328-133747350 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076957706 10:133750637-133750659 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076958691 10:133753936-133753958 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076959680 10:133757246-133757268 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076960664 10:133760545-133760567 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
1076978958 11:195274-195296 CCCATGGGCTAGGTCAGGGCGGG + Intronic
1077061989 11:621529-621551 GGCTCGTGCTGGGGCAGGGTGGG + Intronic
1077095761 11:798389-798411 CCCACGGCCAGGGGGCGGGTGGG - Exonic
1077177934 11:1199017-1199039 CCCAAGAGCCAGGGCAGGGTCGG - Intronic
1077211242 11:1371863-1371885 CCCACAGGAGGGGGCCGGGTGGG + Intergenic
1077248076 11:1548727-1548749 CGCATGTGCTGGGGCAGAGTGGG + Intergenic
1077327160 11:1968891-1968913 CCCAGCGGGTGGGGCAGGGCTGG - Intronic
1077344419 11:2039694-2039716 CCCTGGGGCTGGAGCTGGGTGGG + Intergenic
1077392694 11:2307365-2307387 TCCACAGGCTGGAGCAGGTTGGG - Intronic
1077403214 11:2369131-2369153 CCCATGGGGTGGGCCAGGGGTGG - Intergenic
1077491633 11:2863321-2863343 GCCTAGGGCTGGGGCAGGCTGGG + Intergenic
1077724614 11:4661591-4661613 CACATGGGCTGGTGCAGGCTGGG + Intergenic
1077726326 11:4678671-4678693 ACCAGGGGCTGGGGGAGGGGAGG - Intergenic
1077907610 11:6546274-6546296 CCAAGGAGCTGGGGCTGGGTGGG - Exonic
1078403063 11:11044898-11044920 CCCCCAGGCTGGAGCAGAGTGGG - Intergenic
1078845637 11:15116402-15116424 CCCACAGGCTGGTGGAGGGATGG + Intronic
1078987076 11:16607134-16607156 CCGAGGGGCTGGGGCAGGACAGG - Intronic
1079098730 11:17527478-17527500 CCCCCGGGCTGATGGAGGGTGGG - Intronic
1079430959 11:20387854-20387876 GACACGGGCCCGGGCAGGGTGGG + Intronic
1081211481 11:40340136-40340158 ACCACGTGCTTGGGCAGTGTGGG - Intronic
1081332969 11:41826686-41826708 GGCACAGGATGGGGCAGGGTGGG + Intergenic
1081763836 11:45595451-45595473 CCCTGGGTCTGGGGCAGGGCAGG - Intergenic
1082000141 11:47389708-47389730 CACTGGGGCTGGGGCAGAGTGGG - Intergenic
1082723070 11:56702741-56702763 GCCAGTGACTGGGGCAGGGTGGG + Intergenic
1082833990 11:57639006-57639028 CCGAAGGGCTGGAGCAGGGCAGG + Intergenic
1083177980 11:60964689-60964711 CCCAAGGTCTGGGGCATGTTGGG + Intergenic
1083265854 11:61546560-61546582 CCCACCGCCTGGGGCAGGGGCGG + Intronic
1083271701 11:61576144-61576166 CCCAAGGGCTGGAACAGAGTTGG - Intronic
1083343354 11:61973185-61973207 CCCCCGGGCTGTGCCAGGGTTGG - Intergenic
1083378858 11:62247915-62247937 TGCACAGGCTGGGGCAGGGAGGG + Intergenic
1083659888 11:64247016-64247038 CCCCCGGGCAGGGGTAGGGGAGG + Intergenic
1083674102 11:64316023-64316045 CCCAAGGGCTGGGGCGGAGCTGG + Exonic
1083753753 11:64778232-64778254 CCCACGGGCGGGGGCGGCGGCGG + Exonic
1083764150 11:64834075-64834097 ACCACAGGGTGGGGCAGGGCTGG + Intronic
1084098147 11:66926721-66926743 GCCAGGGGCTGGGGGTGGGTGGG - Intronic
1084113929 11:67030977-67030999 CCCAGGGGCTGCGTTAGGGTAGG - Intronic
1084295535 11:68211581-68211603 CCCACGGGCAGGTACAGAGTAGG - Intronic
1084310398 11:68313076-68313098 CCCGCGGGCTCGGGCAGGTGAGG - Intronic
1084968430 11:72756423-72756445 CCCCAGGGCTGGCCCAGGGTGGG - Intronic
1085022404 11:73217934-73217956 CAGCCGGGCTGGGGCAGGGGCGG + Intergenic
1085200651 11:74699830-74699852 CCCACGGTCTGGGACAGGGAGGG + Intronic
1088920839 11:114258807-114258829 CCCATCGGCTGGAGCAGAGTAGG - Intronic
1089009242 11:115119277-115119299 CCCAAGGGAAGGGGGAGGGTGGG + Intergenic
1089140121 11:116277893-116277915 CACAGGGGCTGTGGCAGGGCTGG + Intergenic
1089352207 11:117828182-117828204 CCCACTTGCTGGGGCGGGTTGGG + Intronic
1089494947 11:118903140-118903162 GCCCCGTGCAGGGGCAGGGTGGG - Intronic
1089567315 11:119378550-119378572 CCCAAGAGCTGGGGGAGGGGAGG + Intronic
1089596778 11:119585486-119585508 CCTCGGGGCTGGGGGAGGGTGGG + Intergenic
1089692299 11:120194372-120194394 CCCAGGGGCAGGAGCAGGGGTGG - Intergenic
1090225962 11:125072498-125072520 CCCAGGGGCTGGGCCAGGCTGGG - Intronic
1090411631 11:126513377-126513399 GGCACTGGCTGGGGTAGGGTGGG + Intronic
1090820497 11:130337486-130337508 CACGCGGGGTGGGGCCGGGTTGG + Intergenic
1091198614 11:133753174-133753196 CCCAAGGAATGGGGAAGGGTCGG + Intergenic
1202810142 11_KI270721v1_random:24071-24093 CCCAGCGGGTGGGGCAGGGCTGG - Intergenic
1202827405 11_KI270721v1_random:94883-94905 CCCTGGGGCTGGAGCTGGGTGGG + Intergenic
1091387735 12:105317-105339 CCCGCTGGCAGGGGCAGGGTGGG + Intronic
1092111750 12:5969413-5969435 CCAACAAGCTGGGGCAGGGCTGG + Intronic
1093879983 12:24393180-24393202 CCCACTGCCTGGGGCAGCCTGGG + Intergenic
1093939859 12:25041176-25041198 CGCCATGGCTGGGGCAGGGTGGG + Intronic
1095095370 12:38145022-38145044 CCCACTGGCTGGTGCAAGGCTGG + Intergenic
1095304150 12:40620763-40620785 CCCACCGGCCGGGGCAGTGAGGG + Intergenic
1095696334 12:45148116-45148138 CCCAGCCCCTGGGGCAGGGTAGG + Intergenic
1096073411 12:48788401-48788423 CCCAAGGCCTGCCGCAGGGTGGG - Intronic
1096183643 12:49564842-49564864 TCCAGGGGCTGGGGCTGGGCTGG + Exonic
1096230996 12:49896872-49896894 CCGACAGAATGGGGCAGGGTTGG + Intronic
1096792339 12:54053067-54053089 CTCTGGGGCTGGGGCAGGGAGGG + Intronic
1097263252 12:57731525-57731547 TCCAGGGGCTGGGACAGGCTAGG - Intronic
1098136141 12:67404173-67404195 GCCAGGGGCTGGGGTGGGGTGGG + Intergenic
1100177790 12:92050641-92050663 TCCATGGACTGGGGAAGGGTTGG + Intronic
1101397671 12:104362816-104362838 CCCACGGCTAGGGGCAGGGGTGG + Intergenic
1101503982 12:105330402-105330424 CCCACATCCTGGGGCAGGGAGGG + Intronic
1102050125 12:109856074-109856096 CCCACAGGCTGGAACATGGTAGG + Intronic
1102201357 12:111059885-111059907 CCCAAGGTCGGGGGCAGGGAAGG - Intronic
1102548971 12:113677247-113677269 CCCTCGGGCAGAGGCAGGTTTGG - Intergenic
1102825963 12:115948186-115948208 GCCAGGGGCTGGGGGAGGCTGGG + Intergenic
1102950747 12:117029451-117029473 CCCAGGGGATGGGGCTGGGAGGG + Intronic
1103122145 12:118389239-118389261 CCCACGGGCTGGGGCAGGGTAGG - Intronic
1103322816 12:120101774-120101796 CCCAGGGGCTTGGGAAGGGGCGG - Intronic
1103526896 12:121575204-121575226 CCCTTGGGCAGGGGCAGGGGAGG - Intronic
1103705110 12:122867231-122867253 CCCACGCGGGGGGGCAGGGGCGG + Exonic
1103909415 12:124344165-124344187 CCCAGGGGCTGGGGCTGGGGAGG + Intronic
1103967077 12:124646714-124646736 CCCGAGCGCGGGGGCAGGGTGGG + Intergenic
1104205439 12:126634390-126634412 ACCACGGGGTCGGGTAGGGTGGG - Intergenic
1104483456 12:129128746-129128768 CCCAAGGGTGGGGGCAGGATGGG - Intronic
1104538520 12:129641137-129641159 TCCATGGACCGGGGCAGGGTGGG - Intronic
1104866964 12:131961475-131961497 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104885513 12:132104843-132104865 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104971834 12:132534239-132534261 TCCATGGGCTGCGGGAGGGTGGG + Intronic
1105271010 13:18875371-18875393 CCCACGGCAGGGGGCAGGTTGGG - Intergenic
1105344324 13:19559934-19559956 CCCAAGGGCTGGGGCGGAGCTGG - Intergenic
1105511817 13:21058417-21058439 ACCAAGGGGTGGGGTAGGGTGGG - Intronic
1105522448 13:21142902-21142924 ACCAGGGGATGGGGCAGGGGAGG - Intronic
1105535710 13:21261640-21261662 CCCAAGGGCTGGGGCGGAGCTGG + Intergenic
1108342967 13:49515747-49515769 ACTACGGGCTGGGGTAGGGATGG - Intronic
1109837556 13:67878518-67878540 TACACTGGCTGTGGCAGGGTGGG - Intergenic
1110356758 13:74575894-74575916 TCCACGGCCTGGGGCCGGGCCGG - Intergenic
1113419001 13:110155315-110155337 ACCACCCGCTGGGGCACGGTGGG + Exonic
1113743309 13:112725658-112725680 CTCACTGGCTGGGGCATGGGAGG - Intronic
1113786748 13:113006099-113006121 CCCAGTGGCTGGGACAGGGCAGG - Intronic
1113805846 13:113109746-113109768 CTCGCGGGCTGAGGCAGGTTCGG + Intronic
1113861080 13:113487682-113487704 GCCAGGGGCTGGGGCAAGGGAGG + Intronic
1114057099 14:18980230-18980252 TCCATGGGCTGGGGAAAGGTGGG + Intronic
1114105448 14:19421516-19421538 TCCATGGGCTGGGGAAAGGTGGG - Intronic
1114430122 14:22653651-22653673 CTCACAGTCTGGGGCTGGGTGGG - Intergenic
1115650981 14:35403114-35403136 CCGAGGGGGTGGGGCAGGGCAGG + Intronic
1118615522 14:67572255-67572277 CCGACGGGCTGGGCCTGGGCGGG + Exonic
1119420798 14:74506656-74506678 CCCAAGGTCTGGGCCAGGGAAGG - Intronic
1121444033 14:93967374-93967396 CCCACCGCCTGGTGCAAGGTAGG + Intronic
1122000455 14:98646827-98646849 CACAGGGACTGTGGCAGGGTAGG + Intergenic
1122020307 14:98832561-98832583 TCCACGGGCTGGGGTGGGGAGGG - Intergenic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122548531 14:102538137-102538159 CCCACTGGCAGGGGCAGGCCGGG + Intergenic
1122900890 14:104781932-104781954 CCCACTGGCAGGGGCATGGAGGG - Intronic
1122959573 14:105088272-105088294 CCCAGGGCCTGGGACCGGGTTGG - Intergenic
1202858183 14_GL000225v1_random:64232-64254 CCCACATCCTGGGGCAGGTTGGG + Intergenic
1123449318 15:20350173-20350195 CCCATGGGCAGGGGGAGAGTGGG + Intergenic
1123498350 15:20853949-20853971 TCCATGGGCTGGGGGAAGGTGGG - Intronic
1123555581 15:21427577-21427599 TCCATGGGCTGGGGGAAGGTGGG - Intronic
1123591825 15:21864908-21864930 TCCATGGGCTGGGGGAAGGTGGG - Intergenic
1125499618 15:40231248-40231270 CCTAAGGGCTGGGGCTGGGGAGG + Intergenic
1125512460 15:40299450-40299472 TCCATTGGCTGGGGCAGGATCGG + Intronic
1125762115 15:42103909-42103931 CCCAAGGGCTTGGGCTGGGCTGG - Intergenic
1126009431 15:44288780-44288802 CCCTTGGGCAGGTGCAGGGTCGG + Exonic
1126566656 15:50108214-50108236 CCCACTGCCTGGGGCTGGGGTGG - Intronic
1127776635 15:62269307-62269329 CTCACAGGTTGGGGCAGGGGTGG + Intergenic
1128146430 15:65334675-65334697 CCCAGGGGGTGGGACAGGCTGGG + Intronic
1128311161 15:66632437-66632459 CCCAAGAGCTGGGGCAGGTCTGG - Intronic
1128594483 15:68930998-68931020 CCCAATGGCTGGGGAAGGATCGG - Intronic
1128745544 15:70111703-70111725 CCCAGGGGCTGGGGGTGGGCTGG + Intergenic
1129466934 15:75729441-75729463 CCCAGGGCCTGGGGGCGGGTGGG - Intergenic
1129467583 15:75732491-75732513 CCCAGAGCCTGGCGCAGGGTGGG - Intergenic
1129906468 15:79191114-79191136 CCCAAGGCCTCGGGCAGGTTTGG + Intergenic
1130099576 15:80882134-80882156 GCTACGGTCAGGGGCAGGGTGGG + Intronic
1130126592 15:81099124-81099146 CCCCAGGGTTGGGGAAGGGTGGG + Intronic
1130168393 15:81486260-81486282 CCCAGAGGCCTGGGCAGGGTTGG - Intergenic
1130531244 15:84748860-84748882 CCGACGGCCGGGGGCGGGGTGGG - Intronic
1130652897 15:85772388-85772410 CCCTCTGGCAGGGCCAGGGTGGG - Intronic
1130788926 15:87131124-87131146 GTCAGGGGCTGGGGCAGGGTGGG + Intergenic
1130915332 15:88300247-88300269 CCCACGTTATGGGGCAGGGGAGG - Intergenic
1130984238 15:88834364-88834386 GCCAGGGGCAGGGGCAGGGTGGG - Intronic
1131526745 15:93158772-93158794 TCCCAGGGCTGGGGCAGGGCGGG + Intergenic
1132375350 15:101325081-101325103 GCCTGGGGCTGGGGCTGGGTTGG - Intronic
1202963925 15_KI270727v1_random:154787-154809 TCCATGGGCTGGGGGAAGGTGGG - Intergenic
1132577691 16:671510-671532 CCCACGTGCTGGAGCCAGGTGGG + Intronic
1132682257 16:1147527-1147549 GCCAAGGGCTGGGGGAGGGGGGG - Intergenic
1132712539 16:1275972-1275994 AACACAGGCTGGGGCATGGTCGG - Intergenic
1132829385 16:1919949-1919971 CCAACGGGCTGGCTCGGGGTGGG + Intergenic
1132928946 16:2448800-2448822 CCCACTTCCTGGGGCAGGGGTGG - Intronic
1133034883 16:3028993-3029015 CCCTCAGGCTGGTGCGGGGTGGG + Intronic
1133205154 16:4228786-4228808 CCCCGGGGCTGGGGAAAGGTGGG + Intronic
1134056562 16:11173931-11173953 CCCCCAGGATGAGGCAGGGTCGG - Intronic
1134201077 16:12199525-12199547 CCCACAGGAGGGGGCAGGGGTGG - Intronic
1134748988 16:16610855-16610877 CCCAGGGGCTGGAGCATGGCAGG + Intergenic
1134996475 16:18742774-18742796 CCCAGGGGCTGGAGCATGGCAGG - Intergenic
1135470967 16:22730259-22730281 TCCATGGACTGGGGCAGGGTTGG - Intergenic
1136144974 16:28311171-28311193 CCCAGGGGCAGGGGCTGGATCGG - Intronic
1136265278 16:29113403-29113425 CCCACAAGCTGAGGCAGGGCCGG - Intergenic
1136280112 16:29203451-29203473 GCCAGGGGCTGGCGCAGGGGAGG - Intergenic
1136519452 16:30786700-30786722 CCCGGGGGCCGGGGCAGGGGCGG - Intronic
1137290738 16:47050365-47050387 CCCACCTGCTGGGGGAGGGAGGG - Intergenic
1137673172 16:50291221-50291243 TCCTGTGGCTGGGGCAGGGTGGG + Intronic
1137702724 16:50508409-50508431 CTCAAGGGCAGGGGCAGGGGTGG + Intergenic
1138536006 16:57660631-57660653 CCCACCAGATGGGGCTGGGTGGG + Intronic
1138622346 16:58222163-58222185 CCCACGGGCTGTGGCAAGAGTGG + Intergenic
1139087065 16:63599687-63599709 CACAGTGGCTGGGGTAGGGTAGG - Intergenic
1139354881 16:66361473-66361495 CACACTGGGTGGGGCTGGGTTGG - Intergenic
1139373014 16:66480079-66480101 CCCAGGGGCTCGAGCAGGGGTGG + Intronic
1139511615 16:67431220-67431242 CCAGCGGGCTGGGGCGGGGCGGG - Exonic
1141283980 16:82654120-82654142 CCCACTGGCTGGTGCAGTGTAGG - Intronic
1142028103 16:87825083-87825105 CCCCCGGGGTGGGAAAGGGTGGG - Intergenic
1142054082 16:87981335-87981357 CCCACAAGCTGAGGCAGGGCCGG - Intronic
1142108551 16:88319064-88319086 CCACCAGGCTGGGGCAGGATGGG + Intergenic
1142466448 17:140092-140114 CCCATGGGCTAGGTCAGGGCGGG + Intergenic
1142594626 17:1023458-1023480 GCCCTGGGCTGGGGCAGGGCCGG - Intronic
1142618166 17:1148679-1148701 TCCACGGACCGGGGAAGGGTGGG - Intronic
1142717669 17:1755777-1755799 CCCAGGAGCTGGGGCAGCGTGGG + Intergenic
1143078528 17:4365608-4365630 CCGCCCGGCTGGGGGAGGGTAGG - Intronic
1143523859 17:7461665-7461687 CCCAAGGGCTGGAGAAGGGATGG + Exonic
1143579918 17:7819422-7819444 CCTCCGGGCTGGGGCATGTTGGG - Intronic
1143619658 17:8073619-8073641 GCCTCGGGCTGGGCCTGGGTTGG + Intronic
1143958846 17:10697650-10697672 CCCAGGGGCCGGCGCACGGTAGG + Exonic
1144037630 17:11381758-11381780 CCCACAGGCATGGGCAGGGGAGG - Intronic
1144429011 17:15173629-15173651 CCCACTGCCTGGGGTAGGGAAGG - Intergenic
1144482649 17:15640316-15640338 CCCATGGGCTGTGGCTGTGTGGG + Intronic
1144712207 17:17409274-17409296 GCCCAGGGCTGGGGCAGGGAAGG - Intergenic
1144778160 17:17795245-17795267 CCAAGGGCCTGGAGCAGGGTGGG + Exonic
1144916038 17:18724716-18724738 CCCATGGGCTGTGGCTGTGTGGG - Intronic
1145973014 17:28968003-28968025 CCCACAGCCTCAGGCAGGGTGGG - Intronic
1146377634 17:32305268-32305290 TCCAAGGCCTGGGGCTGGGTTGG + Intronic
1146522554 17:33537395-33537417 AGCACGTGCTGTGGCAGGGTGGG - Intronic
1146657280 17:34642095-34642117 GGCTGGGGCTGGGGCAGGGTGGG - Intergenic
1146846167 17:36183234-36183256 GCCCCGGGCTGGGGCCGGTTCGG + Intronic
1147190045 17:38733219-38733241 CCCACCTGCTGGGGCAGGGCAGG - Intronic
1147307259 17:39572823-39572845 CCCACGGCCTGGAGCAAGGCAGG + Intergenic
1147767942 17:42849412-42849434 TCCAAGGACTGGGGCAGGGGAGG - Intronic
1148152281 17:45403991-45404013 CACTCAGGCCGGGGCAGGGTGGG - Intronic
1148167036 17:45490792-45490814 ACCGCGGGCCGGGGCAGGGCCGG - Intergenic
1148860564 17:50602330-50602352 GGCACAGGCTGGGGCAGGGCAGG - Intronic
1148945732 17:51260399-51260421 CACACGGGGCGGGGCTGGGTAGG + Intergenic
1149063524 17:52453122-52453144 TCCAAGGTCTGGGGCAGGATGGG - Intergenic
1149134522 17:53348504-53348526 CACAGGCGATGGGGCAGGGTGGG + Intergenic
1149140064 17:53421575-53421597 TCCACAGACTGGGGGAGGGTGGG - Intergenic
1149431073 17:56595929-56595951 CCGAGGGGCGGGGGGAGGGTGGG + Intergenic
1149672642 17:58429229-58429251 GCCAGGGGCTGGGGAAAGGTGGG + Intronic
1150490836 17:65573252-65573274 CCCCCAGTCTGGGGGAGGGTGGG + Intronic
1150640993 17:66949339-66949361 CCCTGGGTCTGGGCCAGGGTGGG - Intergenic
1151677489 17:75606079-75606101 TCCAGGTGGTGGGGCAGGGTTGG + Intergenic
1151890572 17:76948571-76948593 CAGAAGGGCTGGGGCGGGGTAGG - Intronic
1152144859 17:78562020-78562042 GCCACAGGCTGGGGAAGGGGAGG - Intronic
1152279784 17:79378600-79378622 CCCAGGTGCTGGGGCTGTGTGGG + Intronic
1152332399 17:79680752-79680774 CCCCCTGCCTGGGGCAGGGTGGG - Intergenic
1152339323 17:79715693-79715715 CCCATGGGCAGGGGGAGAGTGGG - Intergenic
1152555848 17:81052767-81052789 CCCACAGGTTGGGGCTGGGTGGG + Intronic
1152821749 17:82441112-82441134 TCCACGGGCGGGGGAAGGGGAGG - Exonic
1153053902 18:926668-926690 GCCAGGGCCTGGGGGAGGGTAGG + Intergenic
1153262476 18:3237965-3237987 TCCAGGGACTGGGGCAGGGGTGG + Intergenic
1153596367 18:6729603-6729625 CCCACGGGCTGGAGTGGGGGCGG - Intergenic
1154172463 18:12061469-12061491 CCCATGGGAGGGGGCAGGTTGGG + Intergenic
1154231403 18:12559169-12559191 CCCACGGGGTGGGGTGGGGTGGG + Intronic
1154416571 18:14178658-14178680 CCCACGGCAGGGGGCAGGTTGGG + Intergenic
1154456356 18:14530375-14530397 TCCATGGGCTGGGGGAAGGTGGG - Intronic
1157106457 18:44778796-44778818 CCCAAGGGCTGGGGCAGACCAGG + Intronic
1157339904 18:46769574-46769596 CCCAGGGCCAGAGGCAGGGTCGG + Intergenic
1157478171 18:48036467-48036489 CCCATGGGGTGGGGCGGGGAGGG + Intronic
1157502943 18:48203658-48203680 CCCAGGGGGTGGGGCAGTGGGGG - Intronic
1157513441 18:48294764-48294786 CCCCAGGGCTGTGGCAGGGAAGG + Intronic
1158403360 18:57140648-57140670 TCCACGGGCTGGTGCAGGGCAGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160568683 18:79801966-79801988 CCCAGGTGGTGGGTCAGGGTGGG + Intergenic
1160575091 18:79848700-79848722 CCCACGGGCTGGGGCACAGCTGG + Intergenic
1160707227 19:535317-535339 CCCACGGCCTGGGCCAGGGCAGG + Intronic
1160773934 19:846237-846259 GCCATGGGCTGGGGCCGCGTGGG + Exonic
1160810286 19:1010288-1010310 CCCACGGGCTCGGGAAGGTCAGG + Exonic
1160813856 19:1026587-1026609 CCGCCGGGCTGGCGCGGGGTTGG - Exonic
1160927935 19:1555954-1555976 CCGCCGGGCTCGGGCAGCGTGGG + Exonic
1161153756 19:2721908-2721930 CCCAGGGGCCTGGGCAGGGGCGG + Intronic
1161388233 19:4008039-4008061 CCTAAGGGCTCGGGCTGGGTGGG - Intronic
1161395281 19:4042230-4042252 GACACGCGCTGGAGCAGGGTTGG - Intergenic
1161570261 19:5026670-5026692 CCCTTGGGATGGGTCAGGGTGGG + Intronic
1161583185 19:5091742-5091764 GGCAGGGGCTGGGGAAGGGTGGG + Intronic
1161958471 19:7509240-7509262 CCCTGGGGCCGGGGAAGGGTGGG + Intronic
1162017483 19:7853347-7853369 CCCAGGGGCGGGGACAGGGATGG + Intronic
1162345406 19:10115448-10115470 AGCAGGGGCTGGGGCAGGGATGG + Intronic
1162372686 19:10288771-10288793 GCCACGGGCAGGGGCGGGGTGGG + Intergenic
1163250347 19:16123000-16123022 CCCACTGCCTGGTGCAGGGGAGG - Intronic
1163494609 19:17639001-17639023 CCCTCGGGAAGGGGCAGGGCTGG + Intronic
1163540213 19:17904368-17904390 CCTAAGGCCTGGGGCAGAGTAGG + Intergenic
1163657846 19:18558001-18558023 CCCCCGGGCTGCGGTGGGGTGGG + Intronic
1163677811 19:18664064-18664086 ACCAAGGGCTGGGGGAGGGGAGG - Intronic
1163773811 19:19206337-19206359 CCCAGGGAATGGGGCAGGGAGGG + Intergenic
1164210459 19:23093569-23093591 TCCCCGGGCTGGGACAGGGCTGG + Intronic
1164476546 19:28579889-28579911 CTCAAGGGCAGGTGCAGGGTGGG - Intergenic
1164621871 19:29700893-29700915 CCCAGGTCCTGGGGCAGGGCAGG - Intronic
1164833189 19:31338953-31338975 CGGACAAGCTGGGGCAGGGTAGG - Intronic
1165112582 19:33510969-33510991 ACCATGGGCTGGGGGTGGGTAGG - Intronic
1165793121 19:38504265-38504287 CCCACGGGCTGGGCCAACTTCGG + Exonic
1165938962 19:39405738-39405760 CCCACTTGCTGGGGTTGGGTGGG - Intergenic
1166105587 19:40596690-40596712 CCTGGGGGCTGGTGCAGGGTTGG + Intronic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166216018 19:41335629-41335651 CCCAAGGCCCGGTGCAGGGTAGG - Intronic
1166920772 19:46227535-46227557 CCCCAGGGCAGGGGCAAGGTGGG - Intergenic
1167145379 19:47678466-47678488 CCCGCGGGCTTGGGCTGGATGGG + Intronic
1167145752 19:47680218-47680240 CCCGCGGGCTTGGGCTGGATGGG - Exonic
1167744883 19:51344935-51344957 CCCACCGGCTGGGCCAGGCCAGG + Intergenic
1167888771 19:52523136-52523158 CCCTCAGGCTGGGGCAGGACGGG + Intergenic
1167898153 19:52598406-52598428 CCCTCTGTCTGGGGCAGGGTGGG + Intronic
1167915795 19:52739373-52739395 CCCTCAGGCTGGGACAGGTTGGG - Intergenic
1167941048 19:52946159-52946181 CCCTCAGTCTGGGGCAGGGCGGG - Intronic
1167946428 19:52992693-52992715 TCCAGGGGCTGGGGCTGGGCAGG + Intergenic
1167987957 19:53334272-53334294 TCCAGGGGCTGGTGCAGGGCAGG - Intronic
1168056166 19:53866462-53866484 CCCCCGGGGAGGGGCAGGGCGGG - Intronic
1168315202 19:55482007-55482029 ACCACGGGCGGGGGCGGGGGCGG - Exonic
1168651970 19:58097594-58097616 CCCAGGGGCTGGAGCAGGGAAGG - Intronic
924997903 2:380790-380812 CCCAGGGGCTGGGCTGGGGTGGG + Intergenic
925010493 2:481643-481665 CCCACGTCCTGGAGCAGGGGAGG + Intergenic
925027852 2:623708-623730 GCCATGGGCTGGGGCGGCGTGGG + Intergenic
925041900 2:738710-738732 CCTCAGGGCTGGGGCAGGGCAGG + Intergenic
925100725 2:1243276-1243298 CCCCTGGGCTGGGACAGTGTTGG - Intronic
925675345 2:6356279-6356301 CTCAGAGGCTGGGGCAGGGCTGG - Intergenic
926010207 2:9400924-9400946 TCCCCTGGCTGGGGCAGGGCGGG + Intronic
926131240 2:10304176-10304198 CCTGGGGGCTGGGGCAGGGCCGG - Intronic
926141596 2:10371416-10371438 CCCAGGGGGTGGGGTGGGGTGGG + Intronic
926155647 2:10452519-10452541 CACCAGGGCTGGGGCAAGGTAGG - Intergenic
926274598 2:11393970-11393992 ACCACGGGCTGCGGAAGAGTGGG + Intergenic
926600118 2:14833294-14833316 CCCACTTGCCAGGGCAGGGTTGG + Intergenic
926742798 2:16126179-16126201 CACACAGGCTTGGGCTGGGTTGG + Intergenic
928948226 2:36791254-36791276 TCCACGGGCTGAGGTTGGGTGGG - Intronic
929557830 2:42936631-42936653 GCCCCAGGCAGGGGCAGGGTGGG - Intergenic
929811611 2:45193566-45193588 CTCCAGGGCTGGGTCAGGGTAGG - Intergenic
932397220 2:71456322-71456344 GCCAGGGGCTGGGGGAGGGGAGG - Intronic
932493971 2:72137607-72137629 CCCACGGGGCAGGGCAGGGCAGG - Intronic
932691282 2:73915865-73915887 ACCTAGGGCTGGGGCAGGGATGG + Intronic
933684698 2:85133679-85133701 CCGCCGAGCTGGGGCATGGTGGG - Exonic
935396946 2:102619500-102619522 CCCGCGGGCGGGGGCGGGGCGGG - Intergenic
936090952 2:109501142-109501164 CCCAGGGGCAGGGGCGGGGGAGG - Intronic
936152199 2:110027970-110027992 TCCAGGGCCTGGGGCAGGGGAGG + Intergenic
936192479 2:110343443-110343465 TCCAGGGCCTGGGGCAGGGGAGG - Intergenic
936755901 2:115712020-115712042 TCCATGGACTGGGGCAGGGGAGG + Intronic
937874275 2:126809510-126809532 TCCCCGGGCTTGGGCAGAGTAGG + Intergenic
938087560 2:128411507-128411529 CCGGGGGCCTGGGGCAGGGTCGG - Intergenic
938203089 2:129392939-129392961 ACCAGAGGCTGGGGAAGGGTTGG + Intergenic
938220263 2:129560318-129560340 CCCACTGGCTGGGGCAAGTTGGG - Intergenic
938284071 2:130093330-130093352 TCCATGGGCTGGGGGAAGGTGGG - Intronic
938285211 2:130107902-130107924 TCCATGGGCTGGGGGAGGGTGGG - Intronic
938334717 2:130481895-130481917 TCCATGGGCTGGGGGAAGGTGGG - Intronic
938335861 2:130496445-130496467 TCCATGGGCTGGGGGAAGGTGGG - Intronic
938353962 2:130624219-130624241 TCCATGGGCTGGGGGAAGGTGGG + Intronic
938355105 2:130638775-130638797 TCCATGGGCTGGGGGAAGGTGGG + Intronic
938430388 2:131230991-131231013 TCCATGGGCTGGGGGAGGGTGGG + Intronic
938431536 2:131245563-131245585 TCCATGGGCTGGGGGAAGGTGGG + Intronic
938475207 2:131604174-131604196 TCCATGGGCTGGGGGAAGGTGGG + Intergenic
938540484 2:132280458-132280480 CACACGGGTTGGGGCAGGGGAGG + Intergenic
938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG + Intronic
939508926 2:143082856-143082878 TCCATGGGGTGGGGTAGGGTGGG - Intergenic
941661955 2:168204233-168204255 CCCACGGGGTGCGGCAAGGTAGG - Intronic
943972417 2:194428085-194428107 TCCAGGTGCTGGGGCAGGGGTGG + Intergenic
946185498 2:217978563-217978585 CCCGGGGGCGGGGGCAGGGGCGG - Intronic
946277591 2:218643018-218643040 CCCACGGGCTGGGGCTGCAGTGG + Exonic
948897687 2:240934901-240934923 CACTCGGCCTGGGGCAGGGAGGG - Intronic
948961151 2:241338475-241338497 CACAGTTGCTGGGGCAGGGTAGG + Intronic
949006891 2:241654837-241654859 CCCAGGGTCTGGGCCTGGGTGGG - Intronic
949023075 2:241752251-241752273 CCCAAGGGCTGGGGTGCGGTCGG + Intronic
1172482196 20:35277764-35277786 CCCACGGGCTGGGCTCGGGCTGG + Intergenic
1172595615 20:36149235-36149257 CAAAGGGGCTGGGGCAGGGATGG - Intronic
1172656550 20:36541669-36541691 CCCACGGACTGGGACGTGGTAGG + Intronic
1172658068 20:36549055-36549077 CCTGCGGGCAGGGGCAGGGTGGG - Exonic
1172967134 20:38844968-38844990 CCCAGGGGGTGGGGTGGGGTGGG - Intronic
1173009701 20:39170587-39170609 CTAACTGGATGGGGCAGGGTAGG + Intergenic
1173426419 20:42947346-42947368 GCCAGGGGCTGGGGGAAGGTTGG - Intronic
1173734342 20:45348581-45348603 CCGGCGGGCTCGGGCAGGGCGGG - Intergenic
1175305946 20:57975626-57975648 CCCCCTGGCTGGGACAGGCTGGG + Intergenic
1175515979 20:59570173-59570195 GCCAAGGGCTGGGGAAGGGGAGG - Intergenic
1175826372 20:61938599-61938621 CCCAGTGGCAGGTGCAGGGTGGG - Exonic
1176301400 21:5100714-5100736 CCCAGGGGCTGGGCCAGGGCAGG + Intergenic
1176418982 21:6499219-6499241 CCCGCGGGCGTCGGCAGGGTCGG - Intergenic
1176742381 21:10616345-10616367 CCCTCGGGCTGAGGCAGAGGTGG - Intergenic
1176817810 21:13622961-13622983 TCCATGGGCTGGGGGAAGGTGGG + Intronic
1176856762 21:13980602-13980624 CCCACGGCAGGGGGCAGGTTGGG - Intergenic
1176867820 21:14063611-14063633 CCCACGGCAGGGGGCAGGTTGGG + Intergenic
1178244255 21:30936208-30936230 CCAATGGGTTGGGGAAGGGTGGG - Intergenic
1178257676 21:31069600-31069622 CCCTTGGGCTGGGGCGGGGATGG + Intergenic
1178762322 21:35414976-35414998 TCCAGGGCTTGGGGCAGGGTAGG + Intronic
1179344849 21:40546900-40546922 TCCAGGGGCTGGGGCTGGGGTGG + Intronic
1179801756 21:43814549-43814571 CCCTCGGCCTGGGTCAGGTTGGG + Intergenic
1179855631 21:44161185-44161207 CCCAGGGGCTGGGCCAGGGCAGG - Intergenic
1179919668 21:44500602-44500624 CTCACGGGAAAGGGCAGGGTGGG + Intronic
1180414283 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG + Intergenic
1180475586 22:15702842-15702864 TCCATGGGCTGGGGAAAGGTGGG + Intronic
1180681318 22:17628840-17628862 CCCACAGGCCGGGACAGGGCGGG - Intronic
1180749023 22:18111562-18111584 TCCAGGGGCGGGGGCAGGGAAGG - Intronic
1180932994 22:19606056-19606078 CCCACGGGCTGGCCCTGGGCAGG - Intergenic
1180960193 22:19759027-19759049 GCCAAGGGCAGGGGCAGGGCTGG + Intronic
1180980579 22:19876345-19876367 GGCAGGGGCCGGGGCAGGGTGGG - Intronic
1181023223 22:20114085-20114107 CCCCCTTGCTGGGGCAGGGAAGG - Intronic
1181027246 22:20133122-20133144 CCTGCAGGCTGGGGCTGGGTGGG + Intronic
1181459591 22:23078377-23078399 GCCACGGGGTGGGGCAAGGCTGG - Intronic
1182454362 22:30440347-30440369 CCCACACACTGGGGCAGGGAGGG - Intergenic
1182894179 22:33845168-33845190 CCCAGGGGCTGGGGGAGGTAAGG - Intronic
1183256649 22:36766719-36766741 CACATGGGCTGGGGAAGGTTTGG - Intronic
1183280494 22:36929573-36929595 CCTTCGGGCTGGGGCAGAGCTGG - Intronic
1183346948 22:37313227-37313249 CCCATGGGCAGGGCCAGAGTGGG - Intronic
1183529703 22:38346764-38346786 AGCAGGGGCTGGGGCAGGATGGG + Intronic
1183622487 22:38982554-38982576 GCCCAGGGCTGGGGCAGGGGCGG - Intronic
1183787185 22:40036597-40036619 CCCATGGCCTGGAGAAGGGTTGG - Exonic
1183937520 22:41271883-41271905 GCCCAGGGCAGGGGCAGGGTGGG - Intronic
1184109351 22:42385742-42385764 CCCAGGGCCTGGCACAGGGTGGG + Intronic
1184111306 22:42397157-42397179 CCCAGCGGCTGGGGCCGGGGAGG - Intronic
1184195706 22:42926324-42926346 CCCATCGGCCTGGGCAGGGTGGG + Intronic
1184375190 22:44107611-44107633 CCCAGAGGCTGGGGGTGGGTAGG - Intronic
1184645218 22:45891575-45891597 CCCCTGGGCTGGCGCAGGGCAGG - Intergenic
1184661879 22:45969207-45969229 CCACCTGGCTGTGGCAGGGTGGG - Intronic
1185157314 22:49201832-49201854 TGGACTGGCTGGGGCAGGGTTGG - Intergenic
1185317862 22:50186458-50186480 CCCCAGGGCTGGGGCGGGGAGGG + Intronic
1185408896 22:50672678-50672700 CCCAGGGGAGGGGGCAGGATGGG - Intergenic
950450119 3:13060660-13060682 CACAGCTGCTGGGGCAGGGTGGG + Intronic
950469893 3:13177946-13177968 CCCTAGGCCTGGGGCTGGGTGGG + Intergenic
950525144 3:13518918-13518940 CCCACGGGCTGGGGCCTGCCTGG - Intergenic
950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG + Intergenic
950628868 3:14268058-14268080 GCCCTGGGCTGGGGCAGGGGAGG - Intergenic
954010247 3:47630154-47630176 CACGGGGCCTGGGGCAGGGTGGG + Intronic
954385190 3:50240427-50240449 CCCATGGGCTGGTCCAGGGAGGG - Intronic
954416955 3:50397989-50398011 CTCCAGGGGTGGGGCAGGGTGGG - Intronic
954563392 3:51578137-51578159 ACCAGGGGGTGGGGCAGGGGGGG - Intronic
954602036 3:51877701-51877723 CCCAGGGGCTGGGGCATTGGTGG + Intergenic
954625075 3:52017994-52018016 CCCTAGGCCTGGGGCCGGGTTGG + Intergenic
954955479 3:54514761-54514783 GCCAGGGGCTGGGGTGGGGTGGG + Intronic
955631844 3:60982963-60982985 CCAACTCTCTGGGGCAGGGTTGG + Intronic
955930781 3:64054708-64054730 CTGCCGGGGTGGGGCAGGGTGGG - Intergenic
957333041 3:78790871-78790893 TCCAAGGGATGGGGCAGGGAAGG + Intronic
957538117 3:81532088-81532110 GCCAAGGGGTGGGGGAGGGTTGG + Intronic
958732233 3:97972165-97972187 CCCGGAGACTGGGGCAGGGTGGG - Exonic
959109636 3:102106519-102106541 ACCAGGGGCTGGGGCAGTGTTGG - Intronic
960049078 3:113223612-113223634 GCCAGGGGCTGGGGGAGGGAGGG - Intronic
960999208 3:123361487-123361509 GCCAGGAGCTGGGGGAGGGTGGG - Intronic
961218414 3:125180172-125180194 AACAGGGGATGGGGCAGGGTAGG + Intronic
961490643 3:127254848-127254870 CCCACCTGCTGGGGAAGCGTGGG - Intergenic
961649812 3:128411627-128411649 GCCATGGGCTGGGGCAGGAGGGG + Intergenic
961658766 3:128457406-128457428 CACTGGGCCTGGGGCAGGGTGGG - Intergenic
961736259 3:129003822-129003844 CCCACGAGATGGGGCACGGCGGG + Exonic
961886461 3:130099594-130099616 GCCACGTGCTGGGGCAGACTCGG - Intronic
962650216 3:137480914-137480936 CCCAGGGGCAGGGGGTGGGTGGG - Intergenic
963060678 3:141222392-141222414 GCCACAGGCTGGGGCAGGGTAGG - Intergenic
963590684 3:147254302-147254324 CACACAGGCTGGGACAAGGTGGG - Intergenic
965092276 3:164179519-164179541 CCCACGGCGGGGGGCAGGCTCGG - Intergenic
965450530 3:168832883-168832905 TCCATGGTCTGGGCCAGGGTGGG - Intergenic
965604452 3:170484831-170484853 CTCTGGGGATGGGGCAGGGTGGG + Intronic
966525356 3:180913172-180913194 CCCAAGGGGTGGGGAGGGGTCGG - Intronic
966596311 3:181727173-181727195 CCCACTGGCGGGGGCGGGGTGGG - Intergenic
966715544 3:183010191-183010213 CCCAGGGGTTGGGGGAGGGTGGG + Intergenic
967884796 3:194325952-194325974 CCCCGGGGCTGGGGAAGGGCCGG - Intergenic
968086814 3:195877579-195877601 GCAACTGGCTGGGGCAGGGCAGG - Intronic
968092377 3:195907440-195907462 ACCTCGGGCTGGGGCAGAGGAGG + Intronic
968178176 3:196568999-196569021 CCCGGGGGCTGGGGCAGCCTCGG + Exonic
968245788 3:197145864-197145886 GCCAAGGGGTGGGGTAGGGTGGG + Intronic
968659887 4:1794553-1794575 CCCCCAGGCAGGGGCAGGGTCGG - Intronic
968662678 4:1805264-1805286 CTCAAGGGCTGGGCCAGGCTGGG + Intronic
968726757 4:2251424-2251446 CCGCCTGGCTGGGGCAGGGAGGG - Intronic
968997362 4:3954311-3954333 GCCAGGGGCTGGGCCAGGATTGG + Intergenic
969244299 4:5922534-5922556 CCCACGGGAAGGGGCAGGCGTGG + Intronic
969262780 4:6044098-6044120 CCCACGGACTCAAGCAGGGTAGG - Intronic
969303124 4:6309122-6309144 CCCACGGCCAGGGGGAGGCTCGG + Intergenic
969480171 4:7442728-7442750 CCCACGTGCTGGGGCTGGGCTGG - Intronic
969596941 4:8154747-8154769 CCCAGGGCCTGGAGCAGCGTGGG + Intronic
969963979 4:10975342-10975364 CCCACGATCTGGTGCAGGGTTGG - Intergenic
972603253 4:40591172-40591194 GCCAGGGGCTGGGGGAAGGTGGG + Intronic
973567744 4:52205335-52205357 CCCAAAGGTGGGGGCAGGGTGGG + Intergenic
974250510 4:59377835-59377857 CCCACGGGTTGGGGATGGGGTGG - Intergenic
977265051 4:94843996-94844018 CCCAGGGGCTGGGGTATGGGGGG + Intronic
978600181 4:110419239-110419261 CCCTCCGTCTGGGGCAGGGCGGG + Intronic
980253515 4:130348698-130348720 CACACTGGCTGTGGCAGGGTGGG + Intergenic
981026117 4:140078526-140078548 GCCACAGGATGGGGGAGGGTGGG + Intronic
981616284 4:146647922-146647944 CCAAAGGGCTGGGGCTGCGTGGG + Intergenic
982066941 4:151662611-151662633 CTCACCGGCAGGGGCAGGTTGGG - Exonic
982095568 4:151918887-151918909 GCCAAGGGCTGTGGCAGTGTGGG + Intergenic
984200422 4:176713949-176713971 TCCAAGGGCTGTGGCAGGGCAGG + Intronic
984811304 4:183798129-183798151 GCGGCGGGCTGGGGCAGGGCGGG - Intergenic
984918139 4:184741478-184741500 CCCACGGTCGGGGGGAGGCTTGG - Intergenic
985446093 4:190021955-190021977 CCCGCGCGCCGGGGCAGGTTGGG + Intergenic
985451288 4:190065328-190065350 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
985452279 4:190068623-190068645 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
985453264 4:190071920-190071942 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985454254 4:190075213-190075235 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985455242 4:190078506-190078528 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985456230 4:190081806-190081828 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985457214 4:190085100-190085122 CCCGCGCGCCGGGGCAGGTTGGG - Intergenic
985458201 4:190088393-190088415 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985459190 4:190091693-190091715 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985463442 4:190174462-190174484 CCCGCGCGCCGGGGCAGGTTGGG - Exonic
985487341 5:158806-158828 ACCACAGGATGGGGCAGAGTGGG - Intronic
985521093 5:374162-374184 TCCGCGGGCTGGGGCAGCGCGGG - Intronic
985531337 5:435477-435499 CGCACGGTGTGGGGCAGTGTGGG - Exonic
985579963 5:691364-691386 CCCAGGGGCAGGGGCTGGCTGGG + Intronic
985594810 5:783423-783445 CCCAGGGGCAGGGGCTGGCTGGG + Intergenic
985657179 5:1138253-1138275 CCGGCGGGGTGGGGCAGGGCAGG + Intergenic
985778370 5:1857081-1857103 CGCACAGGCTGGGGCGGCGTGGG + Intergenic
986306930 5:6523022-6523044 CACACAGGCTGAGGCAGGGATGG + Intergenic
989173202 5:38494101-38494123 GACACTGGCTGGGACAGGGTGGG + Intronic
989785902 5:45329264-45329286 ACCAGGGGCTGGGGAAGGGGAGG - Intronic
990738234 5:58887375-58887397 GCCTGGGGCTGGGGCAGGGAGGG + Intergenic
991564337 5:67989220-67989242 AAAACGGGCTGGGGCAGGGGAGG + Intergenic
994167043 5:96618783-96618805 CCCACGGGGTGGGGGAGGCTCGG - Intronic
994518071 5:100794945-100794967 CACACTGGCTGTGGCAGGGCAGG - Intergenic
995120366 5:108530143-108530165 GGCATGGGCAGGGGCAGGGTAGG + Intergenic
995388302 5:111612237-111612259 CCCACGGGGTGGAGGAGGGGCGG + Intergenic
995429479 5:112058257-112058279 CACAGGGTCTGGGGCAGAGTTGG + Intergenic
995844169 5:116476147-116476169 CCCAAGGACTGGGGCAGGGCTGG - Intronic
995861330 5:116643953-116643975 TCCATGGACTGGGGCAGGGGAGG + Intergenic
996538369 5:124602260-124602282 TCCAGGAGCTGGGGCAGTGTGGG + Intergenic
997297532 5:132777303-132777325 CCCGCGGGCGGGGGCAGGGGCGG - Exonic
997472392 5:134124163-134124185 CCCAGGGGCTTTGGCAGGGGTGG + Intronic
997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG + Intergenic
998149355 5:139748026-139748048 CCCGCGGGCTGGCGCAGTGACGG - Intergenic
999282107 5:150372706-150372728 CCCCAGGCCTGGGGCTGGGTGGG - Intronic
1000108326 5:158082277-158082299 CTCATGGGCAGGGGCAGGGGAGG + Intergenic
1001328400 5:170745614-170745636 CTCAGAGGCTGGGGCAGGGCTGG + Intergenic
1001408871 5:171496246-171496268 ACCACGGGCTGGGGAGGGGGTGG + Intergenic
1001568335 5:172714635-172714657 CCGTGGGGATGGGGCAGGGTAGG - Intergenic
1002104503 5:176873474-176873496 CCCAAGGCCTGGGGCAGGTCTGG - Intronic
1002328783 5:178427789-178427811 GCCAGGGGCTGGGGGAGGGAGGG + Intronic
1002399925 5:178986092-178986114 CCCAAGGGCCAGGGCAGGGAGGG - Intronic
1002571693 5:180143267-180143289 CCAGCGGCCTGGAGCAGGGTGGG - Intronic
1002765052 6:232229-232251 TCCACGGACTGGGGCAGGGGAGG + Intergenic
1002861771 6:1085767-1085789 CCCATAGGCTGAGGCAGGCTGGG - Intergenic
1002897124 6:1385800-1385822 CCCTTGCGCTGGGGCAGGGGTGG + Intergenic
1002910761 6:1489293-1489315 CCCCAGGGTTGGGGCTGGGTGGG + Intergenic
1003174818 6:3746630-3746652 CCCACTGGATGGGGCAGAGATGG + Intronic
1003178542 6:3771957-3771979 CCCAAGGGCTGAGGGAGTGTGGG + Intergenic
1003212314 6:4079049-4079071 CCCGCGGGCCGGCGCAGGGGTGG + Exonic
1004036112 6:11925835-11925857 CCCAGGGGCAGGTGAAGGGTGGG - Intergenic
1004262214 6:14118081-14118103 CCCACGGGCTGGGGTTTGGTGGG + Intronic
1005379448 6:25218314-25218336 TCCAGGGGCAGGGGCATGGTGGG + Intergenic
1005968307 6:30742653-30742675 GCAACGGGGTGCGGCAGGGTGGG - Exonic
1006024461 6:31138360-31138382 TCCTGGGGCTGGGGCTGGGTGGG - Intronic
1006299388 6:33185606-33185628 CCCACGGCATGGGGGAGGGGAGG + Intronic
1006301267 6:33194603-33194625 TCCAAGCCCTGGGGCAGGGTGGG - Exonic
1006502442 6:34467094-34467116 GCCAGGGGCTGGGGCAATGTGGG - Intronic
1006516861 6:34550154-34550176 CCAAGGGGATGGGGCAGGGCAGG - Intronic
1007255208 6:40523612-40523634 CCCAGGGGCTGGCACAGAGTAGG - Intronic
1007633062 6:43283431-43283453 CCCGGGGCCTGGGGCAGGGCTGG + Exonic
1007752661 6:44079868-44079890 CCCACTAGTTGGGGCAAGGTCGG - Intergenic
1008692319 6:53993331-53993353 CCCTCAGCCTTGGGCAGGGTAGG - Intronic
1009534211 6:64860423-64860445 CACACTGGCTGTGGCAGGGCTGG + Intronic
1009739315 6:67723325-67723347 CCCACGGCATGGGGGAGGTTCGG - Intergenic
1011697374 6:89924522-89924544 CCCAAGTGGTGGGGCAGAGTTGG + Intergenic
1011960478 6:93082626-93082648 CCCACGTGGTGGAGCAGTGTGGG - Intergenic
1012429718 6:99151881-99151903 CCTACGGTCTGTGGCAGAGTAGG + Intergenic
1012477724 6:99633387-99633409 CCCTGGAGCTGGGGCAGGATTGG + Intergenic
1013043143 6:106456851-106456873 CCCAGGGGATGGAGCAGGTTTGG - Intergenic
1014625432 6:123719251-123719273 GCCACAGGATGGGGCGGGGTGGG - Intergenic
1015201196 6:130583299-130583321 TCCACAGGATGGGGCAGGGATGG + Intergenic
1017096758 6:150811724-150811746 GGCAGGGGCTGGGGCAGGGACGG + Intronic
1017681584 6:156869997-156870019 AGCAGTGGCTGGGGCAGGGTGGG + Intronic
1017817522 6:158026596-158026618 ACCACGGCCTGGGGGAGGCTGGG - Intronic
1017889103 6:158624743-158624765 CCCACATGCAGGGGCAGGGTGGG + Intronic
1018797290 6:167196334-167196356 GCCACGGGCAGGGGCAGGAAAGG - Intronic
1018819007 6:167358430-167358452 GCCACGGGCAGGGGCAGGAAAGG + Intronic
1019487437 7:1295880-1295902 CCCAGAGGCTGGGGCTGGGTGGG - Intergenic
1019698268 7:2460031-2460053 CACACAGGCTGGGGAGGGGTTGG + Intergenic
1019783689 7:2959677-2959699 GCCAGGGGTTGGGGCTGGGTGGG + Intronic
1019886549 7:3910891-3910913 CCCACGCTGTGGAGCAGGGTGGG + Intronic
1020137864 7:5596543-5596565 CCCAGGGTCGGGGCCAGGGTAGG - Intronic
1020466797 7:8489176-8489198 CCCACGTGCTGGGGAAGATTCGG + Intronic
1021253067 7:18355897-18355919 TCCAAGGGCTGGGGCAGGAATGG + Intronic
1021798634 7:24283571-24283593 ACCACGGGCGGGGGTGGGGTGGG + Intergenic
1022442931 7:30448568-30448590 CTCATGGGCTGGTGCAGGATGGG - Intronic
1022559367 7:31333478-31333500 CCCAGGTGCTGGGTCAGGGTAGG - Intergenic
1024564000 7:50666590-50666612 CCCGCGTGCTGGGACAGGGTGGG - Intronic
1025247846 7:57330930-57330952 CCGAAGGGCTGGGGCATGGGTGG - Intergenic
1026930426 7:74220381-74220403 CACACAGGCTGGGGCAGGGCAGG + Intronic
1027267886 7:76504080-76504102 CGTAGGGCCTGGGGCAGGGTGGG + Intronic
1027319697 7:77003942-77003964 CGTAGGGCCTGGGGCAGGGTGGG + Intergenic
1028890554 7:95983498-95983520 CTCATGGTCTGGGGCAGGGAAGG + Intronic
1029355605 7:100049546-100049568 CCGACGCCCTGGGGCAGGGAGGG - Intergenic
1029441087 7:100586900-100586922 CCCCCGGGCTGGGGGCGGGCGGG + Intronic
1029927838 7:104336690-104336712 ACCAAGGGCTGCAGCAGGGTAGG + Intronic
1030059761 7:105613070-105613092 CCCAGAGGCTGGGGCGGGGGTGG + Intronic
1031917185 7:127574633-127574655 CCCAGGAGCTGTGGCAGGGGAGG + Intergenic
1032482235 7:132256400-132256422 ACCAGGGTCTGGGGCAGAGTGGG + Intronic
1033129767 7:138735688-138735710 GCCGAGGGCTGGGGCAGGCTTGG - Intronic
1033228927 7:139581770-139581792 GCCACTGGCTGGGGAAGGGCAGG + Intronic
1033596820 7:142864786-142864808 CCCAAAGGCTGGGGGTGGGTGGG - Intronic
1034100325 7:148445306-148445328 CCCACAGGGTGGGGTGGGGTGGG + Intergenic
1034172193 7:149071257-149071279 CCCACCGGCTCCGGCACGGTGGG - Exonic
1034271514 7:149805502-149805524 CCCCAGGGCTGGGGCAGAGTCGG - Intergenic
1034475839 7:151281347-151281369 GCCAGGGGCTGGGGGAGGGGGGG + Intergenic
1034875938 7:154724754-154724776 GCCAGGGGCTGGGGGAGGGATGG + Intronic
1035029901 7:155850028-155850050 CCCAGGCTCTGGGGAAGGGTGGG + Intergenic
1035608910 8:947800-947822 CACACGGGCTGGCACAGGGTCGG - Intergenic
1035608930 8:947869-947891 CACACGGGCTGGCACAGGGTTGG - Intergenic
1036667603 8:10757642-10757664 CCCACGTGTTGGGGCGGGGGGGG + Intronic
1037514478 8:19616893-19616915 CCACGGGGGTGGGGCAGGGTTGG + Intronic
1037883592 8:22585073-22585095 CCCTCGGGCTGAGGGAGGTTGGG - Exonic
1037936494 8:22918389-22918411 CCCCCGGGCTGAGGCAGGATGGG + Intronic
1038040155 8:23717403-23717425 TCCAGGGCCTGGAGCAGGGTTGG + Intergenic
1038449903 8:27633532-27633554 CCAAGTGGCTGGGGCAGGGGTGG - Intergenic
1038805867 8:30790669-30790691 CCCAGGAGCTGGGGCAGGGAAGG + Intronic
1039465945 8:37784878-37784900 CCCAGGGCCTGGGGCAGGGGTGG + Intronic
1040478686 8:47803950-47803972 TCCAGGGGGTGTGGCAGGGTGGG + Intronic
1041636639 8:60153054-60153076 CCCAAGGGGGGGGACAGGGTGGG + Intergenic
1042172514 8:66005871-66005893 CCCATCGTCTGGGGCAGAGTGGG - Intergenic
1042570273 8:70156500-70156522 CTCACGGCCGGGGGCAGGTTGGG + Exonic
1043395036 8:79827682-79827704 CCCAGGGGCTGGTGGAGGGGAGG - Intergenic
1043759965 8:84055969-84055991 CCCAGGGTCTGTGGGAGGGTAGG - Intergenic
1044584390 8:93856085-93856107 ACAAGGGGCTGAGGCAGGGTGGG - Intergenic
1045478878 8:102577007-102577029 CCCGCAGCCTAGGGCAGGGTTGG + Intergenic
1045782755 8:105886835-105886857 CACACCAGCTGTGGCAGGGTGGG - Intergenic
1046674542 8:117093920-117093942 CACACCAACTGGGGCAGGGTGGG + Intronic
1047292469 8:123541745-123541767 CCCGCGCGCTAGGGCGGGGTTGG - Intergenic
1048222275 8:132552785-132552807 AGCATGGGCTGGGGCGGGGTGGG + Intergenic
1048522472 8:135169507-135169529 CCCAGGGTCTGGGGCATGGGAGG + Intergenic
1049132759 8:140862836-140862858 GCCACAGGGTGTGGCAGGGTGGG - Intronic
1049164043 8:141115836-141115858 CCCTCAGGCTGGGGGAGGGGAGG + Intergenic
1049322468 8:142004044-142004066 CATACGGGCTGCGGCCGGGTTGG - Intergenic
1049462232 8:142735554-142735576 CCCAGTGGGTGGAGCAGGGTGGG - Exonic
1049508994 8:143018466-143018488 CCCCGGGGCGGGGGCAGGGGCGG - Intronic
1049611897 8:143559697-143559719 CCCTGGGGCTGGGACAGGGCTGG + Intronic
1049708224 8:144052431-144052453 CCCAGGTGCGGGGGCGGGGTGGG - Exonic
1049746337 8:144264856-144264878 CCCGAGGGGTGGGGCAGGGCTGG - Intronic
1049748662 8:144273530-144273552 GCCACAGGCAGGGGGAGGGTGGG + Intronic
1049792716 8:144479346-144479368 CCCCCGGGCTGGGGTTGGGATGG + Intronic
1051789790 9:20788283-20788305 GCCAAGGGCTGGAGGAGGGTTGG + Intronic
1052892840 9:33719994-33720016 GCCAGGGGCAGGGGCTGGGTCGG + Intergenic
1053440480 9:38112168-38112190 ACCACGGGCAGGGACACGGTCGG + Intergenic
1057537262 9:95923968-95923990 CCCAAGGCCTGGGTCAAGGTTGG - Intronic
1058432005 9:104928076-104928098 CTCCCGGGCTGCGGCAGGGCAGG - Exonic
1058740589 9:107938750-107938772 ACCACCGGCTGGGGCAGGGCAGG - Intergenic
1058820537 9:108725240-108725262 ACCAAGGGCTTGGGCAGGGCAGG + Intergenic
1059331138 9:113536558-113536580 CCCACAGGTTGGGGGAGGGGAGG - Intronic
1059405823 9:114098070-114098092 CCCGCGGGGCGGGGCTGGGTGGG - Intronic
1059432995 9:114260923-114260945 CCCACAGGCAGGGGAAGAGTTGG - Intronic
1059442002 9:114313213-114313235 TCCAGGGGTTGGGGGAGGGTGGG - Intergenic
1060599898 9:124870411-124870433 CGCACGGGTGGGGGCAGGGTTGG + Intronic
1060968488 9:127724675-127724697 CCCCCGGGCTGGAGCCGGCTGGG + Intronic
1061078214 9:128354591-128354613 CTCCTGGGCTGGGGGAGGGTGGG + Intronic
1061666201 9:132162142-132162164 CCCTCGGGCTGGCGCTGGGTGGG - Exonic
1061669089 9:132178573-132178595 CTCGGGGCCTGGGGCAGGGTAGG - Intronic
1061762144 9:132858334-132858356 CCCAGGGGCAGAGCCAGGGTTGG - Intronic
1061773239 9:132944233-132944255 CCCTCGGGCAGGGGCGAGGTGGG - Intronic
1061871392 9:133522555-133522577 CACTCTGGGTGGGGCAGGGTGGG + Intronic
1061906648 9:133702626-133702648 GCAACGGGCTGGGGCCCGGTGGG - Intronic
1061987517 9:134138109-134138131 CCCAAAGGTTGGGGCAGGTTGGG + Intronic
1062065693 9:134525073-134525095 CCCAAAGGCTGGCTCAGGGTCGG + Intergenic
1062193954 9:135263101-135263123 CCCACGGGCTGGGCCTGGCTCGG + Intergenic
1062289081 9:135786553-135786575 CGGACGGACTGGGCCAGGGTCGG + Intronic
1062338917 9:136084914-136084936 GCCAGGGGCTGGGGCAAGGATGG + Intronic
1062390037 9:136330200-136330222 CCCCGGGGCTGGGGCCGGGAAGG + Intronic
1062429324 9:136519982-136520004 GCTGCTGGCTGGGGCAGGGTGGG + Intronic
1062451443 9:136617373-136617395 CCCACGGGGTGTGGCGGAGTGGG + Intergenic
1062469059 9:136694388-136694410 GCCCCGGGATGGGGTAGGGTGGG + Intergenic
1062474994 9:136722426-136722448 CCCAGGGGCTGGGGGATGGGAGG - Intronic
1062536426 9:137023061-137023083 CCCACGGGAGAGGGCAGGGTCGG + Intronic
1062560024 9:137137374-137137396 CCCACGGGGTGGGGGTGGGTGGG + Intergenic
1062717122 9:138016628-138016650 CCCTCGAGATGGGGCAGCGTAGG - Intronic
1203529549 Un_GL000213v1:126540-126562 TCCATGGGCTGGGGGAAGGTGGG - Intergenic
1185815835 X:3154315-3154337 CCCAAGGCCTTGGGCAGGGGAGG + Intergenic
1185836083 X:3346725-3346747 TCCCCGGGGTGGGGCAGGGTGGG - Intergenic
1186638205 X:11428022-11428044 CCCACGGGTCCGGGGAGGGTGGG - Intronic
1187109613 X:16283336-16283358 TCCACAGGCTGGGGCAGCCTGGG - Intergenic
1188324795 X:28787979-28788001 GCCAAGGGCTGGGACAGGATGGG + Intronic
1189821600 X:44873850-44873872 GCCTCGGGCTCGGGCAGGGACGG + Intronic
1190215220 X:48475479-48475501 ACCACTGGCTGGGGCGGGGGTGG - Intergenic
1192174599 X:68877947-68877969 CCCCAGGGCTGGGGCTGGGTAGG + Intergenic
1192504146 X:71670667-71670689 AGCACTGGCTGGGGCAGGGATGG + Intergenic
1192664399 X:73072617-73072639 ACCAGGGGCTGGGGCAAGGGAGG + Intergenic
1192716422 X:73647462-73647484 TCCATGGGCAGGGGAAGGGTGGG + Intronic
1194394394 X:93363334-93363356 CCTACGGGAAGGTGCAGGGTTGG + Intergenic
1196735100 X:118975714-118975736 CCCATGGACTGTGGCGGGGTGGG + Intronic
1198020710 X:132655137-132655159 ACCAGATGCTGGGGCAGGGTGGG - Intronic
1198438829 X:136641913-136641935 CCCAGGGGGTGGGGCGGGGTGGG - Intergenic
1199846292 X:151694943-151694965 GGCACGGGCGGGGGCAGGGGCGG + Intergenic
1200083046 X:153588868-153588890 CCCAGGGGCTGGGTTAGGGTAGG - Intronic
1200216286 X:154369510-154369532 CCCAGGGGCTGGGGAAAGGGGGG - Intronic
1201177017 Y:11315609-11315631 CCCGCGTGCTGGGGCGGGTTGGG - Intergenic
1201240604 Y:11954076-11954098 TCCCCGGGGTGGGGCAGGGTAGG + Intergenic