ID: 1103124468

View in Genome Browser
Species Human (GRCh38)
Location 12:118409438-118409460
Sequence AAGAAACAGAATTTTAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1712
Summary {0: 1, 1: 1, 2: 20, 3: 227, 4: 1463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103124468_1103124471 10 Left 1103124468 12:118409438-118409460 CCCGGCCTAAAATTCTGTTTCTT 0: 1
1: 1
2: 20
3: 227
4: 1463
Right 1103124471 12:118409471-118409493 TTTCAGAAAGTACATTGACTTGG 0: 1
1: 0
2: 0
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103124468 Original CRISPR AAGAAACAGAATTTTAGGCC GGG (reversed) Intronic
900012708 1:130981-131003 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900042771 1:486968-486990 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900064209 1:721959-721981 AAAAAACAAAACTTGAGGCCTGG + Intergenic
900211331 1:1457297-1457319 AAAACACAGCATTTTTGGCCAGG + Intronic
900254001 1:1687442-1687464 AAAAAACAAAAAATTAGGCCGGG + Intronic
900259960 1:1721853-1721875 AATATAAAGAATTTTTGGCCAGG + Intronic
900295089 1:1944899-1944921 AATAAAAAGAATATTTGGCCGGG - Intronic
900860514 1:5226036-5226058 AAGAATTAGAATTGAAGGCCAGG - Intergenic
901320336 1:8336114-8336136 ATGATTCAGAATTTGAGGCCAGG + Intronic
901424922 1:9176206-9176228 AAAAATAATAATTTTAGGCCGGG - Intergenic
901517613 1:9759575-9759597 TAGAAACTGTATTTGAGGCCAGG - Intronic
901521530 1:9788570-9788592 AAAAAAAGGAATTTGAGGCCGGG + Intronic
901532147 1:9860293-9860315 CAGAACCAGGATTCTAGGCCGGG + Intronic
901846660 1:11987332-11987354 AATAAACAAAATGTTGGGCCGGG + Intronic
901859732 1:12066646-12066668 AATAAAAAAAAATTTAGGCCGGG - Intronic
901884699 1:12214875-12214897 AAGAAACATAATATTAGACAGGG + Intergenic
901886043 1:12223893-12223915 AAGAAAAAGATGTTTAGGCTGGG + Intergenic
901918238 1:12516651-12516673 AAAAAAAAGAGTTCTAGGCCAGG - Intergenic
902035169 1:13452695-13452717 AAGAATTATAATTTTTGGCCGGG - Intergenic
902271455 1:15308023-15308045 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
902338400 1:15767186-15767208 AAGAAACTTAATCTCAGGCCAGG - Intronic
902354240 1:15885024-15885046 AAAACACTGACTTTTAGGCCAGG - Intronic
902387975 1:16086846-16086868 AAGAAACAAAATGGGAGGCCGGG + Intergenic
902452362 1:16505119-16505141 AAGTAAGAGTATTTTTGGCCAGG - Intergenic
902500632 1:16908742-16908764 AAGTAAGAGTATTTCAGGCCGGG + Intronic
902902061 1:19524524-19524546 AAGAAAGAGAATATCTGGCCTGG - Intergenic
903202750 1:21755868-21755890 AAAAAAAATAAGTTTAGGCCAGG + Intronic
903229982 1:21915752-21915774 AAGAAACTGAATTTTTTGCCGGG + Intronic
903252071 1:22061854-22061876 AAGAAACATCAAGTTAGGCCGGG - Intronic
903426637 1:23258422-23258444 ATGAACCAGAAATTGAGGCCTGG + Intergenic
903440290 1:23382982-23383004 AAGAAAAATAATTAGAGGCCGGG + Intronic
903490714 1:23726114-23726136 AAAAAAAAAAATTTTAGGCCAGG - Intergenic
903495775 1:23766146-23766168 AAAAAATAAAATATTAGGCCAGG + Intergenic
903696899 1:25214419-25214441 AAGAAAAAAAAATTTGGGCCGGG + Intergenic
903706069 1:25286796-25286818 AACAAAAACAGTTTTAGGCCAGG + Intronic
903798338 1:25947309-25947331 AAGAAATAGAGATGTAGGCCAGG + Intergenic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
903991297 1:27271930-27271952 TAAAAAAAAAATTTTAGGCCGGG - Intronic
903992414 1:27282797-27282819 AAAAAACAGGGTTTTGGGCCGGG - Intronic
904029451 1:27525029-27525051 AAGAACCACAAATATAGGCCAGG - Intergenic
904127406 1:28250971-28250993 AAAAAAAAGAATTTTGGGTCAGG + Intergenic
904144570 1:28379573-28379595 AAGAAAAGAAATTATAGGCCAGG - Intronic
904213778 1:28903614-28903636 AAGAAATAGAGTCTCAGGCCAGG - Intronic
904244045 1:29173437-29173459 AAAAAACAACTTTTTAGGCCAGG - Intronic
904565852 1:31428020-31428042 AACAAAAAAAATTTTAGGCTGGG - Intronic
904668653 1:32144939-32144961 AAAAAAAAAAGTTTTAGGCCAGG - Intronic
904687156 1:32268838-32268860 AAGAAACAGGAGTCTAGGGCTGG + Intronic
904687197 1:32269139-32269161 AAGAAACAGGAGTCTAGGCTGGG + Intronic
904735149 1:32626166-32626188 AAAATACAGTATTATAGGCCCGG - Intronic
904808722 1:33149748-33149770 AAGCTAAAGAATTTCAGGCCAGG - Intronic
905102522 1:35537465-35537487 ATTAAACAGAATTGTAGGCTTGG + Intronic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905368360 1:37468305-37468327 ATGAAACAAAATTCAAGGCCAGG + Intergenic
905398651 1:37685368-37685390 AAAAAAAAGAATTTTGGGCCAGG - Intronic
905447594 1:38037153-38037175 AAGAGAAATAATTCTAGGCCGGG + Intergenic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
905649950 1:39649632-39649654 AAGAAACATTATTTTTGGCCGGG - Intergenic
905672493 1:39801189-39801211 AAGATACAAAATTATAGGCTGGG + Intergenic
905738307 1:40347008-40347030 AATAAATAGATTTTTAAGCCAGG - Intronic
905738434 1:40348397-40348419 TTGAAATATAATTTTAGGCCAGG + Intronic
905811072 1:40913636-40913658 AATAAGAACAATTTTAGGCCAGG + Intergenic
905817565 1:40963917-40963939 AAAATACAGAATTTATGGCCAGG + Intergenic
906134163 1:43483844-43483866 AAGAAAAAGAAGTTTTGGGCTGG - Intergenic
906160437 1:43644810-43644832 AAGAAAGAAAATTATAGGCTGGG - Intergenic
906278133 1:44533504-44533526 AAGAAATAAAGTTTTAGTCCAGG + Intronic
906337266 1:44944159-44944181 AAGAAACATAGTTTAGGGCCAGG + Intronic
906496100 1:46305016-46305038 AAGAAATAGAACCTGAGGCCGGG + Intronic
906974004 1:50549482-50549504 AAAAAACAAAATTTAAGGCTGGG + Intronic
907035574 1:51213192-51213214 AAGGAATAGAAGTTAAGGCCAGG + Intergenic
907038112 1:51234707-51234729 AAGACTCATAATTTTGGGCCAGG - Intergenic
907198425 1:52705861-52705883 AATAATAATAATTTTAGGCCGGG - Intergenic
907466009 1:54637485-54637507 AACAAAAAGAGTTTTAGGCCAGG + Exonic
908153483 1:61328712-61328734 AAAAAAAAAAATTATAGGCCGGG - Intronic
908190358 1:61696911-61696933 AAAAAAAAAAAATTTAGGCCAGG - Intronic
908345956 1:63233487-63233509 AAAGAAAAGAAGTTTAGGCCAGG + Intergenic
908374105 1:63516125-63516147 CAGAAGCAGAAAATTAGGCCAGG + Intronic
908653651 1:66364002-66364024 AATTAACAGAATTTCAGGGCAGG + Intronic
908747044 1:67385913-67385935 AAGAAACTGAAGTCCAGGCCGGG + Intronic
909095475 1:71281912-71281934 AAGAATAATAATTTTTGGCCGGG - Intergenic
909168056 1:72254405-72254427 AAGAAAAAGCATATTAGGCCAGG + Intronic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910081341 1:83345959-83345981 GAAAATCAGAATTTTAGTCCTGG - Intergenic
910255444 1:85242701-85242723 AAAAAAAAGAATTCTTGGCCGGG - Intergenic
910274543 1:85434685-85434707 TTAAAACAGAATATTAGGCCAGG - Intronic
910290576 1:85596558-85596580 TAGAAAAATAATTTTAGGCATGG + Intergenic
910670818 1:89770983-89771005 AATAAAATGAATTTTTGGCCAGG + Intronic
910676197 1:89819514-89819536 AAAAAAAAAAATTATAGGCCGGG - Intronic
910835562 1:91505624-91505646 ATGAAACAGACTTTGAGGACTGG - Intronic
910968052 1:92827368-92827390 AAGAGACAGAGTCTTGGGCCAGG - Intergenic
910995201 1:93097103-93097125 AAGACATATACTTTTAGGCCAGG - Intronic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911203644 1:95071250-95071272 ATAAAGCAGGATTTTAGGCCAGG + Intronic
911295610 1:96111305-96111327 AGTAAACATAATTTTAAGCCAGG + Intergenic
911330766 1:96523307-96523329 AAGAAAAAGAATTTTGTGGCTGG - Intergenic
911369690 1:96982018-96982040 AAGAAACAGAATTTAAAGTGGGG + Intergenic
912065386 1:105734039-105734061 AAGAATTATAATTTTTGGCCGGG + Intergenic
912075450 1:105869091-105869113 AAAAACCATAATTTTAGGCAGGG - Intergenic
912248691 1:107988596-107988618 TAGAAAGTGAAATTTAGGCCGGG - Intergenic
912654723 1:111476194-111476216 AGGACACAGAATTTAATGCCAGG + Intronic
912922222 1:113880329-113880351 AAATAACAAGATTTTAGGCCGGG + Intronic
913034873 1:114954872-114954894 AAGAAAAAGAAATAAAGGCCAGG - Intronic
913150869 1:116041643-116041665 AAGAAACAGAAATTGAAGCTTGG + Intronic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914095645 1:144542699-144542721 AAGTAAGAGTATTTTAGGCTGGG - Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
914302875 1:146391270-146391292 AAGTAAGAGTATTTTAGGCTGGG + Intergenic
914516945 1:148382414-148382436 AAGTAAGAGTATTTTAGGCCAGG - Intergenic
914674462 1:149897827-149897849 AAAAAAAAGAATTTTGGGCCAGG + Intronic
914692971 1:150047656-150047678 TAGAAAAATAATTTCAGGCCAGG + Intergenic
914701278 1:150136256-150136278 AAAAAAAAAAATTTGAGGCCGGG + Intronic
914727145 1:150337333-150337355 CAGAAATAGAATTTTATGGCCGG - Intronic
914857254 1:151361839-151361861 AAAAAAAAGAATTGTAGGCAGGG + Intergenic
915199575 1:154216942-154216964 AAAAAAAAAAATTTAAGGCCAGG - Intronic
915221201 1:154376033-154376055 AAAAAAAAGAAATATAGGCCGGG - Intergenic
915397347 1:155595471-155595493 AAGAAAAAGAAATTGAGGCCGGG - Intergenic
915506729 1:156362037-156362059 AAAAAAAAAAAATTTAGGCCGGG - Intronic
915574097 1:156763881-156763903 AAAGAATAGAAATTTAGGCCAGG - Intronic
916098764 1:161375057-161375079 AAGAAATAGTGTTATAGGCCAGG - Exonic
916103259 1:161410982-161411004 AAGAAACTGCATTTTGTGCCAGG - Intergenic
916178862 1:162066906-162066928 AAGAAATACAACTTGAGGCCAGG + Intergenic
916203703 1:162295635-162295657 AAGAGACACAATTTCAGACCAGG + Intronic
916760844 1:167816248-167816270 AAGATAAAAAATTTTAGGTCAGG + Intronic
917230559 1:172832772-172832794 CAGAAACAGGATTTTAGCCCAGG - Intergenic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917547852 1:175991752-175991774 AAGAAACAGAAAGTTAGCCTAGG + Intronic
917857962 1:179117128-179117150 CATAAACAGAAGTATAGGCCTGG - Intronic
918016264 1:180635862-180635884 AAAACACAGAATTTTAGAGCTGG - Intronic
918363171 1:183779543-183779565 AATAAAAAGAAATTTTGGCCAGG - Intronic
918375753 1:183907582-183907604 AAGAAAGAGCATTTCAGGCCAGG - Intronic
918437328 1:184529313-184529335 AAGATACAGGATTTTATGTCTGG + Intronic
918701116 1:187608976-187608998 AAAAAACAGTTTTTTTGGCCTGG - Intergenic
919089097 1:192956639-192956661 AAAAAAAAGAGTTTTAGGCCAGG + Intergenic
919089844 1:192964947-192964969 TAAAAAAAGAATTTTAGGCCTGG + Intergenic
919106271 1:193155480-193155502 AAGAAACACTAGGTTAGGCCAGG + Intronic
919700211 1:200623859-200623881 AAGAAAAAGAAAATTAGGGCCGG - Intergenic
920055175 1:203185965-203185987 GAGAAACAGAATTAGAGGCGAGG - Intronic
920242633 1:204564422-204564444 ATGAAACAGAGTGATAGGCCGGG + Intergenic
920339382 1:205266293-205266315 ATAAAACATAATTTTGGGCCGGG + Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
920768221 1:208853904-208853926 AAGAAGTTAAATTTTAGGCCAGG - Intergenic
921174238 1:212579847-212579869 AAGAAACAGATTTGTAGACTGGG + Intronic
921210240 1:212889802-212889824 CAGAATCGGAATTTGAGGCCAGG - Intronic
921273746 1:213496460-213496482 AAGAAACTTACTTTCAGGCCAGG + Intergenic
921277495 1:213534269-213534291 AAGATGCAAAATTTAAGGCCTGG + Intergenic
921284681 1:213598620-213598642 AAAATACATTATTTTAGGCCGGG + Intergenic
921388953 1:214600162-214600184 AGGATACAGATTTTCAGGCCGGG + Intergenic
921637194 1:217510795-217510817 AAAAAAAAGAATTAGAGGCCAGG + Intronic
921734645 1:218612886-218612908 AAGAAACAAAGCTTTTGGCCGGG - Intergenic
921858486 1:220015167-220015189 AAGAAAAAGAATTCAAAGCCGGG + Intronic
921867788 1:220104678-220104700 ATAAAATAGAATTTTAGTCCAGG - Intronic
922090172 1:222388266-222388288 AGGAAACAACATTTTAGGCAGGG - Intergenic
922164291 1:223101956-223101978 AAGAAAGAGGTTTATAGGCCAGG - Intergenic
922261145 1:223947471-223947493 AAAAAACAAAACTTGAGGCCTGG + Intergenic
922487230 1:225983697-225983719 AAGAATGCGTATTTTAGGCCAGG - Exonic
922546609 1:226462635-226462657 AAACAACAGAAATGTAGGCCGGG - Intergenic
922735930 1:227978269-227978291 AAAAAACAAAACTTGAGGCCTGG - Intergenic
922936746 1:229428715-229428737 AAGAAATGGCATTTTTGGCCAGG + Intergenic
922943675 1:229491780-229491802 AAAAAAAATAATTTTAGGCCAGG + Intronic
922954830 1:229590248-229590270 AAAAAAAAGAATTTTTGGTCTGG + Intergenic
922971921 1:229749232-229749254 AAGATACAAAATTTCAGGCCAGG + Intergenic
923187327 1:231586867-231586889 AAAAAACTAATTTTTAGGCCTGG + Intronic
923450524 1:234112868-234112890 AAGAATGTGAATTATAGGCCGGG - Intronic
923488638 1:234462073-234462095 AAGAAAGAAAAATTGAGGCCAGG - Intronic
923567504 1:235087480-235087502 AAAAAAAAAAATTCTAGGCCAGG - Intergenic
924308597 1:242717304-242717326 AAGAAATAGTATGTTAAGCCAGG - Intergenic
924342314 1:243049650-243049672 AAAAAACAAAACTTGAGGCCTGG + Intergenic
924518272 1:244783861-244783883 AAGAAACTGAGGTTTAGGCCAGG - Intergenic
1063255972 10:4327840-4327862 TAGAAATAGAGTTATAGGCCAGG + Intergenic
1063442318 10:6082840-6082862 AAGAAACAGAAGTGTAGACTTGG - Intergenic
1063587255 10:7363639-7363661 AAGAAAAAGAGGTTTAGGCAGGG - Intronic
1063657137 10:8002218-8002240 AAGAATTACAATTTTAGGTCAGG - Intronic
1063847883 10:10151300-10151322 AAATAAAAGAATTTCAGGCCAGG - Intergenic
1063867439 10:10381113-10381135 AAGAAACTGAAGTTCAGGCCGGG + Intergenic
1064213533 10:13380948-13380970 AAAGAACAGAATTTTTGGCCAGG + Intergenic
1064227700 10:13501849-13501871 AAAAAAAAAAATCTTAGGCCAGG + Intronic
1064369288 10:14737324-14737346 TAGAAAAAACATTTTAGGCCAGG + Intronic
1064532412 10:16323778-16323800 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
1064661260 10:17610351-17610373 AAGAAGTGCAATTTTAGGCCAGG + Intronic
1064692646 10:17933682-17933704 CAGAAACAGAATTTGAGCCTGGG + Intergenic
1064773405 10:18749047-18749069 CAGATAAAGAATTTTGGGCCAGG - Intergenic
1065047936 10:21760878-21760900 AAGAGGCAGTATTTTAGGCCAGG + Intronic
1065212913 10:23422131-23422153 AAGAAACATAATTTATGGCATGG - Intergenic
1065222763 10:23513138-23513160 AAGGAATAGAATCTTGGGCCAGG + Intergenic
1065336710 10:24659608-24659630 AAGAAAGAGGATTCTGGGCCGGG - Intronic
1065346167 10:24749874-24749896 AAGAAATAAAAATTTGGGCCGGG - Intergenic
1065537924 10:26732823-26732845 CACTAACAGATTTTTAGGCCGGG + Intronic
1065850281 10:29782063-29782085 TAAAAACAGAAATTAAGGCCGGG + Intergenic
1065914236 10:30339189-30339211 AAGAGACAGAATCTTGGGCCGGG + Intronic
1066038172 10:31515797-31515819 AAGAAACAGAATATTGTGGCAGG - Intronic
1066330777 10:34419549-34419571 AAGAAACATTATTTAAGGCAAGG + Intronic
1066536258 10:36395635-36395657 AATAAAAAGAGTTTTAGGCCGGG + Intergenic
1066641132 10:37555388-37555410 AAGAAACTGCATTTTGGGCCAGG + Intergenic
1066643965 10:37586251-37586273 AATAAAAAGAGTCTTAGGCCAGG + Intergenic
1066975416 10:42363813-42363835 AGGGAAGAAAATTTTAGGCCGGG + Intergenic
1067115446 10:43432335-43432357 AAAAAAAAAAATTTTAGGCCAGG - Intergenic
1067126418 10:43519758-43519780 AAGAACTAACATTTTAGGCCAGG - Intergenic
1067269487 10:44777119-44777141 AAGAAATAGAAATTTAAGGCCGG - Intergenic
1067410058 10:46056262-46056284 AAAAAATACATTTTTAGGCCAGG + Intergenic
1067486830 10:46658445-46658467 AAAAAAAAGAATTACAGGCCGGG + Intergenic
1068033547 10:51732218-51732240 AAGAAAAGGAAATTTGGGCCAGG - Intronic
1068054362 10:51992692-51992714 ACGCTACATAATTTTAGGCCTGG - Intronic
1068072483 10:52213127-52213149 AAGAAATAGAAGTTTAGTCCTGG + Intronic
1068531764 10:58197003-58197025 AAGAAACAGGATTCCAGGCTGGG + Intronic
1068801819 10:61149618-61149640 AAGCAATAGAATTTTAGAACTGG + Intergenic
1069008117 10:63340647-63340669 AAGAAACAAAAGGATAGGCCAGG + Intronic
1069018091 10:63454016-63454038 TACAAACAGAATTGGAGGCCGGG - Intronic
1069027281 10:63556415-63556437 AAAAAATAGAATCATAGGCCAGG - Intronic
1069440194 10:68421457-68421479 AAGAAAGACTATTTTGGGCCGGG + Intronic
1069444905 10:68464215-68464237 ATGTATCAAAATTTTAGGCCAGG + Intronic
1069449871 10:68508416-68508438 AAAAAAAAGAATTCTAGGCCAGG + Intronic
1069466514 10:68644196-68644218 AAGAAACAAAATCAAAGGCCAGG - Intronic
1069471484 10:68694893-68694915 TAGAAATGGAATTTCAGGCCAGG - Intergenic
1069494121 10:68887575-68887597 AAGAAAGAAAATATTAGGCTGGG - Intronic
1069516063 10:69078189-69078211 AAAAAACAGTATTTCTGGCCGGG - Intergenic
1069660729 10:70121794-70121816 AATAAAAAAAATTTTAGGCCGGG + Intronic
1069775230 10:70923295-70923317 AAAAAAAAAAAATTTAGGCCAGG - Intergenic
1069933117 10:71896879-71896901 TAGGAACAGGGTTTTAGGCCAGG - Intergenic
1070010351 10:72467476-72467498 AAAATACAGAAAATTAGGCCGGG - Intronic
1070193367 10:74132955-74132977 AATAAACAGATTTATGGGCCAGG + Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070436526 10:76399025-76399047 ATGATACAAAATTTTAGACCTGG - Intronic
1070516952 10:77217001-77217023 CAAAAACTGAATTTTTGGCCAGG + Intronic
1071269194 10:83991382-83991404 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1071588750 10:86850794-86850816 AAAAAGGAGAACTTTAGGCCAGG - Intronic
1071623524 10:87144923-87144945 AAAAAAAAGAATTACAGGCCGGG - Intronic
1071949822 10:90689919-90689941 AAAAACCAGAATATTAGGCTGGG - Intergenic
1072113716 10:92348191-92348213 AAAAAAAAAAATTTTTGGCCAGG + Intronic
1072128895 10:92473223-92473245 AATAAAAAGAATTTTGGGCCGGG - Intronic
1072156589 10:92729454-92729476 AAAACACAGACATTTAGGCCAGG + Intergenic
1072172920 10:92884192-92884214 AGAAAACAAAACTTTAGGCCAGG - Intronic
1072419721 10:95280078-95280100 AAAAAAACAAATTTTAGGCCAGG + Intronic
1072538952 10:96383924-96383946 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
1072544326 10:96422830-96422852 AAAGAACAGAATTTCAGGCCGGG + Intronic
1072568233 10:96635910-96635932 AAGAAAAAGAAAACTAGGCCGGG + Intronic
1072631302 10:97148573-97148595 AAAAAATAAAGTTTTAGGCCAGG - Intronic
1072797871 10:98370181-98370203 AAAAAATTGAAATTTAGGCCAGG + Intergenic
1072979104 10:100084861-100084883 AAAAACAACAATTTTAGGCCAGG - Intergenic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073294170 10:102428726-102428748 TAGAAAAATATTTTTAGGCCAGG + Intronic
1073505835 10:103988582-103988604 CAGAAACAGAATTTAAATCCAGG - Intronic
1073896975 10:108172772-108172794 AAAAAAAAAAATTATAGGCCGGG - Intergenic
1073953597 10:108840523-108840545 CAGAAACAAAATTTGAGTCCAGG + Intergenic
1073957956 10:108893868-108893890 AAGAAACATAAAGTTAGGTCTGG - Intergenic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1073968215 10:109015629-109015651 TGAAAACAGTATTTTAGGCCGGG + Intergenic
1074396009 10:113098409-113098431 AAAAAATTGTATTTTAGGCCGGG + Intronic
1074512594 10:114129823-114129845 AATAAATAGCATTTTTGGCCAGG - Intronic
1074515073 10:114159657-114159679 AAAAAAAAGAATTTTAGGCTAGG + Intronic
1075108089 10:119555928-119555950 AAGAATCAGCATTTGGGGCCAGG + Intergenic
1075128325 10:119719033-119719055 AAGAAAAGAAAATTTAGGCCAGG - Intergenic
1075387480 10:122066696-122066718 AAGCTACAGATTTTTAGGCCAGG - Intronic
1075752711 10:124786512-124786534 AAAAAAAAGAAGTTCAGGCCAGG + Intronic
1075774433 10:124971118-124971140 AACAAACAGAATTCAAGGCCAGG - Intronic
1076393846 10:130124190-130124212 AAAAAAGAACATTTTAGGCCAGG + Intergenic
1076406681 10:130216909-130216931 AAGAAAGGGGATTCTAGGCCGGG - Intergenic
1076785509 10:132747751-132747773 AAAAAACAGATTTATAGGCCAGG + Intronic
1076969045 11:123185-123207 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1077347128 11:2066619-2066641 ATGATACAGTATTATAGGCCAGG + Intergenic
1078002715 11:7510797-7510819 AAGAAATAGTATTTTAAGCCAGG - Exonic
1078052160 11:7975253-7975275 AAGAAACATAGATTCAGGCCAGG + Intronic
1078226198 11:9393676-9393698 AAGAAAAAGGAAATTAGGCCTGG - Intronic
1078470882 11:11585649-11585671 ATGAAAAAGATTTTTCGGCCGGG - Intronic
1078598443 11:12710029-12710051 AAAAAATGGAATTGTAGGCCAGG + Intronic
1078632676 11:13017756-13017778 AAGAAAAAGAAAGTTAGGCTGGG - Intergenic
1078654025 11:13221575-13221597 AAAAAACAGTATTTTAGGCCAGG - Intergenic
1078865622 11:15294859-15294881 TAGAAATAACATTTTAGGCCAGG + Intergenic
1078959064 11:16241919-16241941 ATAAAACAGAATTTTATTCCTGG + Intronic
1079041777 11:17066022-17066044 ATAAATCAGTATTTTAGGCCAGG + Intergenic
1079048428 11:17130507-17130529 TAAAAACACTATTTTAGGCCGGG + Intronic
1079406532 11:20152169-20152191 AAAAAAAAAAAATTTAGGCCGGG + Intergenic
1079885810 11:25987378-25987400 ATGAAACATCATATTAGGCCAGG - Intergenic
1080336362 11:31202265-31202287 AAGCTACACAATTTTATGCCAGG + Intronic
1080403697 11:31959660-31959682 ATGAAACAGATGTTTGGGCCAGG - Intronic
1080537302 11:33234351-33234373 AAGAAAAAGAAAATTAGGCCGGG + Intergenic
1080624926 11:34020357-34020379 AAATAAAACAATTTTAGGCCAGG + Intergenic
1080812697 11:35721197-35721219 TATAAAAAGAATTATAGGCCAGG - Intronic
1080951806 11:37042453-37042475 ATTAAACAAAATTATAGGCCAGG - Intergenic
1081057505 11:38428850-38428872 TTGAAAAAGAATTTAAGGCCAGG + Intergenic
1081320369 11:41685079-41685101 AAGAATAAGAACTTTAGGCCAGG + Intergenic
1081746584 11:45477381-45477403 AAGAAACAGAATCATAGCTCTGG - Intergenic
1081831169 11:46116666-46116688 AAAAAACAAAAATTTAGGCCGGG + Intronic
1081895994 11:46587082-46587104 AAGAAACACAACTTCAGGTCAGG + Intronic
1081923282 11:46799701-46799723 ATTAAAATGAATTTTAGGCCGGG + Intronic
1082017828 11:47505336-47505358 AAAAATCAGTATGTTAGGCCAGG + Intronic
1082056567 11:47822549-47822571 AAGAAAAAAAATTTTTGGCCGGG - Intronic
1083437303 11:62651407-62651429 AAGAAACATAGCTTTTGGCCGGG - Intronic
1083455098 11:62773437-62773459 AAAAAAAAAAATTGTAGGCCGGG - Intronic
1083653020 11:64214640-64214662 AAGAAAGAAAAGTGTAGGCCAGG - Intronic
1083686349 11:64378170-64378192 AATAAAGAAAATTCTAGGCCGGG - Intergenic
1083798176 11:65030490-65030512 AAAAAAAAAAATTATAGGCCAGG - Intronic
1083905242 11:65664836-65664858 AAAATACAGAATTCTGGGCCAGG - Intergenic
1083947123 11:65930081-65930103 AAAACAAAAAATTTTAGGCCGGG + Intergenic
1083977877 11:66138592-66138614 AAGAAACACAATATCAGGGCTGG - Intronic
1084058883 11:66656433-66656455 AAAAAATAGAAAATTAGGCCAGG - Intronic
1084293723 11:68195859-68195881 AATAAAATGAATTTTTGGCCAGG + Intronic
1085048549 11:73367647-73367669 GATAACCAGCATTTTAGGCCTGG - Exonic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1085137831 11:74109775-74109797 AATAAAAAGAATTTGAGGCCGGG + Intronic
1085178678 11:74513222-74513244 AAAACACAGAATATCAGGCCGGG + Intronic
1085473866 11:76776195-76776217 AAGAAACAGAATTTGTGGGCTGG - Intergenic
1086122174 11:83315607-83315629 AAAAAAAAAAATTTCAGGCCAGG - Intergenic
1086452169 11:86927724-86927746 AATAAAAAGAATACTAGGCCGGG + Intronic
1087275845 11:96159717-96159739 AAGAATCAGTGGTTTAGGCCGGG - Intronic
1087391116 11:97536680-97536702 AAGAGAAAGAATTTTTGGCCAGG - Intergenic
1087544285 11:99564381-99564403 TATAAACAGAATTGTTGGCCAGG - Intronic
1087789283 11:102390333-102390355 AAAAGACACAACTTTAGGCCAGG - Intergenic
1087950253 11:104212476-104212498 ACAAAAGAAAATTTTAGGCCGGG + Intergenic
1088219168 11:107549144-107549166 AGAAATCAGAATTTTAGGCTGGG - Intronic
1088264375 11:107975453-107975475 ATGAAACAGGGTCTTAGGCCAGG + Intergenic
1088298971 11:108334823-108334845 AAGAACTACAACTTTAGGCCGGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1088840796 11:113626101-113626123 AGACAACAGAAATTTAGGCCAGG + Intergenic
1088915233 11:114222606-114222628 AAGAACCAGGATCTTTGGCCAGG + Intronic
1089034470 11:115372316-115372338 AAGAAAAATAATTTTAGGAAAGG - Intronic
1089245936 11:117120046-117120068 AACAAACAAAAAATTAGGCCAGG + Intergenic
1089404304 11:118184731-118184753 AAAAAAAATAGTTTTAGGCCAGG - Intergenic
1089933243 11:122335560-122335582 TAGAAACAGAATTCTAGAGCTGG + Intergenic
1089956358 11:122574864-122574886 TATAAACAGGGTTTTAGGCCCGG + Intergenic
1090009398 11:123032937-123032959 TAAAAAAAAAATTTTAGGCCAGG + Intergenic
1090175029 11:124641006-124641028 AAGAAAGGCTATTTTAGGCCGGG + Intronic
1090232485 11:125118500-125118522 AAGAAACAGACCTTAGGGCCGGG - Intergenic
1090419989 11:126568067-126568089 AAGAAACAGAAATTAATGGCAGG + Intronic
1090778144 11:129983271-129983293 AATAAAAAGATTTTTAGACCAGG - Intronic
1090778191 11:129983591-129983613 TAAAAATAGATTTTTAGGCCGGG - Intronic
1090815689 11:130293164-130293186 TAAAAAGATAATTTTAGGCCTGG + Intronic
1090864939 11:130691382-130691404 AAGAAACTGACTTTTGGGGCCGG - Intronic
1091904981 12:4178054-4178076 AAGAAACCTCATTTAAGGCCAGG + Intergenic
1092114773 12:5992166-5992188 TAGAAACAGAACTTTAGGCTGGG + Intronic
1092127091 12:6082258-6082280 AAAGAACATATTTTTAGGCCAGG - Intronic
1092236247 12:6811804-6811826 AAGAAAAGAAATTTTTGGCCGGG - Intronic
1092396162 12:8128690-8128712 TAGAAACTGAACTTTTGGCCGGG - Intronic
1092636109 12:10451360-10451382 TAAAAAAAGATTTTTAGGCCGGG + Intronic
1093094317 12:14955060-14955082 AAGAAAAATAATTTTATGTCTGG - Intronic
1093127507 12:15348461-15348483 AAAAAAAAAAATTATAGGCCGGG + Intronic
1093169448 12:15843436-15843458 AAAAAAAAAACTTTTAGGCCTGG + Intronic
1093421307 12:18977836-18977858 AATAAAAAGAGGTTTAGGCCGGG + Intergenic
1093503978 12:19843497-19843519 AAGAAAAAGAGTTCTAGGCCGGG + Intergenic
1093571989 12:20677078-20677100 AAGAATCAGAATTTGAAGACAGG - Intronic
1093891673 12:24528786-24528808 TGGAAACAGAATTTTAGAACTGG - Intergenic
1094011661 12:25816254-25816276 AAAAAAAGGAATTTGAGGCCAGG - Intergenic
1094189672 12:27684402-27684424 AAATAAAAGAATTTTAGGCCGGG - Intronic
1094458401 12:30665033-30665055 AAGAAAAAGATTTATAGGCTGGG - Intronic
1094463552 12:30725372-30725394 AAGTAACAGAATTTAAACCCAGG + Intronic
1095144899 12:38714917-38714939 AAGGAACTTATTTTTAGGCCTGG - Intronic
1095219386 12:39591414-39591436 AATAAAAATAATATTAGGCCAGG + Intronic
1095528167 12:43152870-43152892 AAAAAATAGAAATTTAGGCTGGG - Intergenic
1095652653 12:44630946-44630968 AAGAAAAAAGATTTTAGGCAAGG - Intronic
1095761238 12:45839157-45839179 AAAAAAAAGATTTTTAGGCTGGG - Intronic
1096074078 12:48791111-48791133 AAAAAATGAAATTTTAGGCCGGG + Intergenic
1096165868 12:49423425-49423447 AAAAAATAGAGTATTAGGCCAGG - Intronic
1096213693 12:49786608-49786630 AAAAAATAGAAAATTAGGCCAGG - Intergenic
1096299168 12:50410697-50410719 AAAATAAAGAATTCTAGGCCGGG - Intronic
1096357981 12:50958574-50958596 AAAAAAGATTATTTTAGGCCGGG - Intronic
1096644080 12:53019101-53019123 TAGAAATATAATTTAAGGCCGGG + Intronic
1096689330 12:53309767-53309789 AAGAAATAGAATTTTGGGGATGG - Intronic
1097019839 12:56012566-56012588 AAAAAAAAGTAATTTAGGCCAGG - Intronic
1097244284 12:57598223-57598245 AAGAATCCAAATTGTAGGCCGGG + Intronic
1097259223 12:57705817-57705839 AGAAAACGGAATTTTTGGCCAGG - Intronic
1097789769 12:63802871-63802893 AAGATACAGTCTTTTAGGCCAGG + Intronic
1097918752 12:65048613-65048635 AACAGAAAGAATTTTAGGCCTGG + Intergenic
1098169562 12:67732957-67732979 AAGAAAAAGCATTTCAGGCCGGG - Intergenic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1098658117 12:73058488-73058510 AAGAAACATAATTTTAGAGTTGG + Intergenic
1098889664 12:75996441-75996463 AAAAAAAAGAAAGTTAGGCCGGG - Intergenic
1099227928 12:79992032-79992054 CAAAAAAAGATTTTTAGGCCAGG + Intergenic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1099855552 12:88160848-88160870 AAGAACCAGAATTTCATACCTGG - Exonic
1099921527 12:88962960-88962982 AAAAAAAATAAGTTTAGGCCGGG - Intergenic
1100176958 12:92041874-92041896 CAGAAACAGGATTTGAGCCCAGG + Intronic
1100284611 12:93153310-93153332 TAGAAATAGGATTTCAGGCCGGG - Intergenic
1100326880 12:93548375-93548397 AAGAATAAGAATTCTAGCCCTGG - Intergenic
1100547436 12:95616540-95616562 AAGAAACTGAATTTTAATCTTGG - Intergenic
1100668800 12:96786474-96786496 AGGAAACAAAATTTCAGGCCAGG - Intronic
1100835938 12:98567236-98567258 AAAAAAAAAAATTGTAGGCCGGG + Intergenic
1101005302 12:100395906-100395928 AAGAAATACATTTCTAGGCCAGG - Intronic
1101111504 12:101491047-101491069 AAGAAACATAAATTTTGGCTGGG + Intergenic
1101154320 12:101913408-101913430 TGGAAATAGTATTTTAGGCCGGG + Intronic
1101330575 12:103754652-103754674 AAGAATTAGAGTTCTAGGCCAGG + Intronic
1101514841 12:105425147-105425169 AAAAAAAATGATTTTAGGCCCGG - Intergenic
1101983938 12:109431082-109431104 AATAAACATAATATGAGGCCAGG + Intronic
1102087452 12:110154333-110154355 AAAAAAAAGTATTTTTGGCCGGG + Intronic
1102104255 12:110307052-110307074 AAGAAAAAGAAATTGTGGCCGGG - Intronic
1102139144 12:110600215-110600237 ATAAAACTGTATTTTAGGCCGGG - Intergenic
1102150002 12:110682492-110682514 CAGAAATGGGATTTTAGGCCAGG - Intronic
1102161807 12:110775243-110775265 TAGAAATAGAATTCAAGGCCGGG + Intergenic
1102198924 12:111044163-111044185 AAGAAACAGACTTGAAGGCAGGG - Intronic
1102305189 12:111799460-111799482 AAAAAAAAAAATTTTTGGCCAGG - Intronic
1102331332 12:112034200-112034222 AAGAAACTATATTATAGGCCAGG + Intronic
1102373081 12:112398960-112398982 AAAAAACAAAAATATAGGCCAGG + Intergenic
1102476950 12:113194981-113195003 AAGTAAAAAATTTTTAGGCCAGG - Intergenic
1102540529 12:113616053-113616075 AAGAAAAAGAAAATCAGGCCTGG + Intergenic
1102639121 12:114350935-114350957 AAGAAACACATTTGTGGGCCAGG - Intergenic
1102978201 12:117221577-117221599 AAAAAAAACAAATTTAGGCCGGG - Intronic
1103082360 12:118035335-118035357 AAGAAACAGGATGGCAGGCCTGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103152567 12:118653903-118653925 AAGAAACAGAATTTGAACCCAGG - Intergenic
1103313292 12:120029940-120029962 AAAAAACAAAATTCTGGGCCGGG - Intronic
1103320427 12:120089675-120089697 AAGAAACAGAAGTTGAGGCCGGG - Intronic
1103344348 12:120239286-120239308 AAAATACAAAAATTTAGGCCAGG + Intronic
1103380562 12:120491084-120491106 AAGGAACAGACTTTGAGGCCAGG - Intronic
1103449977 12:121021833-121021855 AAGAAAAAGAAATATAAGCCTGG + Intronic
1103529643 12:121591950-121591972 AAGAAAAAGAAAAATAGGCCGGG + Intergenic
1103531893 12:121608200-121608222 AACAAACAAAATTTCAAGCCAGG - Intergenic
1103673912 12:122640880-122640902 AAGAAAAAGCAGTTCAGGCCGGG - Intergenic
1103775908 12:123366154-123366176 AATAAAAAATATTTTAGGCCGGG + Intergenic
1103890851 12:124238098-124238120 TAGAAATAGAATTTGAGGCCAGG - Intronic
1104703635 12:130926188-130926210 ATAAAACAGAATTTTTGGCCGGG + Intergenic
1105275152 13:18915546-18915568 AAGAAATAAAATAATAGGCCGGG + Intergenic
1105341561 13:19530818-19530840 AAGAAAAAAAATTTAGGGCCGGG - Intronic
1105383280 13:19907019-19907041 AAGAAACAAAATTGCAGTCCAGG - Intergenic
1105413472 13:20191071-20191093 AAAAAACAATATTTTAGCCCAGG + Intronic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1105787262 13:23761827-23761849 AAAAAACAGAAGCTTGGGCCGGG + Intronic
1105916317 13:24920065-24920087 TAGAAACTGATTTTTAGGCTGGG - Intronic
1105933553 13:25076030-25076052 TCAAAAAAGAATTTTAGGCCAGG + Intergenic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1106272697 13:28169751-28169773 AAAAATAATAATTTTAGGCCGGG + Intronic
1106399827 13:29419047-29419069 AAGAAACAAAAAGTTAGGTCAGG - Intronic
1106523230 13:30516931-30516953 AAGGTTCAGAATTTTAGGCTAGG + Intronic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1106831225 13:33585396-33585418 AAAAAAAAGTATTATAGGCCAGG + Intergenic
1106844702 13:33725956-33725978 AAAGAACAAAAGTTTAGGCCGGG + Intergenic
1107025426 13:35796704-35796726 AAAGAACAGAGTTTCAGGCCTGG - Intronic
1107193801 13:37622949-37622971 AAGAAACAGCAAATGAGGCCGGG + Intergenic
1107484246 13:40811193-40811215 AAGAAAAGCAATTGTAGGCCAGG + Intergenic
1107504759 13:41022583-41022605 AACAAAAAGAAATCTAGGCCAGG + Intronic
1107679155 13:42830060-42830082 CAGAGACAGAATTTTATTCCAGG - Intergenic
1107846080 13:44514562-44514584 TATAAAAAGAAGTTTAGGCCAGG + Intronic
1107856075 13:44616646-44616668 AAAAAAAAGCACTTTAGGCCAGG - Intergenic
1108060495 13:46528479-46528501 TAAAATCATAATTTTAGGCCAGG + Intergenic
1108062561 13:46548169-46548191 AAGAAATAGATTTTTAGGGCGGG - Intergenic
1108234562 13:48389857-48389879 AAGAAACAGGATATTTGGCAGGG + Intronic
1108381766 13:49861476-49861498 AAAGAAAAGAAGTTTAGGCCAGG + Intergenic
1108486328 13:50930054-50930076 AAGAAACAGAACTTTGGTGCTGG - Intronic
1108792562 13:53989454-53989476 AAAAAACAGAATTTTTGGGTAGG + Intergenic
1108874773 13:55032412-55032434 AGAAAACAGACATTTAGGCCAGG + Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1109687136 13:65835552-65835574 AATTAACACAATTTTAGCCCTGG - Intergenic
1109769029 13:66945483-66945505 AAGTAACAGTATTTTAGGAGAGG - Intronic
1110140298 13:72121176-72121198 AAGTAACTGAATTTTAGACTAGG + Intergenic
1110250931 13:73379700-73379722 AAGAAACTGATTTTTTGGCTGGG + Intergenic
1110431956 13:75434850-75434872 AACATACACAATTATAGGCCTGG + Intronic
1110689399 13:78414373-78414395 AAGAAAGGGCATTTTAGGCTGGG + Intergenic
1110859667 13:80334070-80334092 AAAAAACTGAATTAGAGGCCGGG + Intergenic
1111241408 13:85480604-85480626 AACAAACAAAATTTTAGGCCAGG - Intergenic
1111345609 13:86949894-86949916 AAAATACAAAATATTAGGCCGGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1111661722 13:91220539-91220561 AAGAAACAATTATTTAGGCCAGG + Intergenic
1111936915 13:94567125-94567147 AAAAAACAAAATTATGGGCCAGG - Intergenic
1112129917 13:96511561-96511583 AAGAAACAGAATTTTAAAAATGG - Intronic
1112401095 13:99079031-99079053 AAGAAAAATAATTTTATGACAGG + Intronic
1112438340 13:99407652-99407674 AAGAAATACAAAATTAGGCCGGG - Intergenic
1112598915 13:100835581-100835603 AAAAAGAAGATTTTTAGGCCGGG - Intergenic
1112614913 13:100994318-100994340 AAGAAACAGACGAATAGGCCTGG + Intergenic
1112781877 13:102909547-102909569 AAAAATAAGAATCTTAGGCCAGG - Intergenic
1112997085 13:105587248-105587270 AAGAAAAAGAATTCTAGGGCCGG + Intergenic
1113081528 13:106525538-106525560 AAGAAACAGTATTTCAGCCAAGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114325037 14:21580457-21580479 AAGAAACAGAATTTCAGGGTTGG + Intergenic
1114661746 14:24350623-24350645 TAAAAAGTGAATTTTAGGCCGGG + Intergenic
1115179436 14:30605189-30605211 AAGAATCAGAATCTCAGGCCAGG - Intronic
1115232121 14:31172306-31172328 AAGAAAAAGTATTTAAGTCCAGG + Intronic
1115252437 14:31363683-31363705 AAAAAAAAGTATTTTAGGCTGGG + Intronic
1115588265 14:34837066-34837088 ATGAAACATTCTTTTAGGCCAGG - Intronic
1115998687 14:39219817-39219839 AAAAAAAAGACTTTTAGGGCTGG + Intergenic
1116388852 14:44366656-44366678 AAGAAAAGGATTTTCAGGCCGGG - Intergenic
1116819447 14:49613509-49613531 AAAAAAAAAAAGTTTAGGCCAGG + Intronic
1116836489 14:49773422-49773444 AAAAAAAAAAATTTAAGGCCAGG + Intronic
1116975020 14:51106189-51106211 AAAAATAATAATTTTAGGCCGGG - Intergenic
1117180921 14:53190743-53190765 TATAAAGAAAATTTTAGGCCAGG - Intergenic
1117309497 14:54507609-54507631 AATAAAAAGTATCTTAGGCCGGG - Intergenic
1117643209 14:57822738-57822760 AAGCCACAGAATTTTAGGGTAGG - Intronic
1117755371 14:58969293-58969315 AAGAGAAAGATTTTTAGGCCAGG - Intergenic
1118325340 14:64776735-64776757 AAGAAATACCCTTTTAGGCCGGG - Intronic
1118570574 14:67190784-67190806 AATAAACATATTTTTAGGCTAGG - Intronic
1118646923 14:67849576-67849598 AGAAAAAACAATTTTAGGCCAGG - Intronic
1118880022 14:69817979-69818001 AAGAATTTGGATTTTAGGCCGGG - Intergenic
1119019395 14:71094769-71094791 AAGAAACAGAAATATTAGCCAGG + Intronic
1119060158 14:71465660-71465682 AAGAAACAGAATGTTAAGGATGG - Intronic
1119088162 14:71755296-71755318 AAGAAAGGCAATTTCAGGCCAGG - Intergenic
1119392568 14:74301147-74301169 AAAAAAAAAGATTTTAGGCCAGG - Intronic
1119403593 14:74381275-74381297 AAGAAACAGCATTTCTGGCAAGG - Intergenic
1119547842 14:75485915-75485937 AAGAAACACCATCTGAGGCCAGG + Intergenic
1119632376 14:76244227-76244249 AAGAACCAGAGTTCTTGGCCAGG + Intronic
1119819022 14:77597826-77597848 AAAAAAAAGAATTTTAGGCCAGG + Intronic
1120164392 14:81180592-81180614 AAGAAACCAATTTTTAGGCCAGG - Intronic
1120419782 14:84269265-84269287 AATAAATACAATTTCAGGCCGGG + Intergenic
1120773561 14:88408620-88408642 CAGTAACGGAAGTTTAGGCCAGG - Intronic
1120911049 14:89667264-89667286 AAAACAAAGAATTTTAGGCAAGG - Intergenic
1121351517 14:93177142-93177164 AAGAAAAAGAAAACTAGGCCTGG + Intergenic
1121392123 14:93584503-93584525 CAGAAACACAACTGTAGGCCTGG - Intronic
1121423825 14:93834127-93834149 AAGAAACAGAAGTCCAGGCAGGG - Intergenic
1121628288 14:95403575-95403597 AATAAATAAAATTTTTGGCCAGG + Intergenic
1121651214 14:95560317-95560339 AAACAACAGAAATTTTGGCCGGG + Intergenic
1122526727 14:102391353-102391375 AAAAACCATAGTTTTAGGCCTGG - Intronic
1122556321 14:102582513-102582535 AAAAAAAAAAATTATAGGCCGGG - Intergenic
1122657576 14:103272779-103272801 AAGAAAAGCAATTTTTGGCCGGG + Intergenic
1123587694 15:21773794-21773816 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123624332 15:22216359-22216381 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123801056 15:23821218-23821240 AAAATACAAAATATTAGGCCAGG - Intergenic
1123852314 15:24371649-24371671 AAGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123909191 15:24950115-24950137 AATAAACAAAATGTGAGGCCAGG - Intronic
1124699823 15:31903201-31903223 AAAAAACAGAAATCCAGGCCAGG - Intergenic
1124891145 15:33734186-33734208 CAGTAACATAATATTAGGCCTGG - Intronic
1124946859 15:34276604-34276626 AATAAAAATAATTTTAGACCAGG + Intronic
1125010490 15:34867718-34867740 AAGAAACATAATCATAGGCTTGG + Intronic
1125556355 15:40588599-40588621 AAAAATCAGAATTCTAGACCAGG + Intergenic
1125572406 15:40730815-40730837 AAAAAAGAAAAATTTAGGCCGGG - Intronic
1125604807 15:40934040-40934062 AAGAAACATGATTTTAGGCTGGG + Intronic
1125620951 15:41061309-41061331 AATAAATAAAAGTTTAGGCCGGG + Intronic
1125658844 15:41380431-41380453 TAGAAACAGAATTTTAGGATGGG - Intronic
1125841548 15:42805966-42805988 AAGACACTGATTTTTAGGCCAGG + Intronic
1125910569 15:43434963-43434985 AAGAAAGTAAATTTTAGGCTGGG + Intronic
1126030401 15:44491750-44491772 AAGAAACATAGTTTGGGGCCAGG + Intronic
1126139510 15:45425812-45425834 AAGAAACAGGGTTTTGGGCCGGG + Intergenic
1126152693 15:45537491-45537513 AAAAATAATAATTTTAGGCCAGG + Intergenic
1126661517 15:51037811-51037833 AAGAAACAGAAATTCAGGCAAGG - Intergenic
1126774044 15:52084500-52084522 AAAAAAAAGAATCTTGGGCCAGG + Intergenic
1127134615 15:55906798-55906820 AAAAAATAAAATTTTAGGCTGGG + Intronic
1127416055 15:58758187-58758209 GAGAAAAAAAATTTTTGGCCAGG - Intergenic
1127416564 15:58763496-58763518 GAAAAACTGAATTTTAGGCTGGG + Intergenic
1127421160 15:58807656-58807678 AATAAAGACTATTTTAGGCCGGG - Intronic
1128066612 15:64768803-64768825 AAAAAAAGGAATTTAAGGCCGGG + Intronic
1128201080 15:65808704-65808726 AAAAAATATATTTTTAGGCCAGG - Intronic
1128272091 15:66319232-66319254 AAAAAACAGAATCTTGGGGCTGG - Intronic
1128352351 15:66899626-66899648 AAGAAAAAGAAATGGAGGCCAGG - Intergenic
1128426255 15:67544521-67544543 ATGAAACAAAATTTTAGTTCTGG - Intronic
1128472728 15:67968522-67968544 GAGAAACAGAATGTCAGTCCTGG + Intergenic
1128678014 15:69625999-69626021 ATAAAAGAAAATTTTAGGCCAGG - Intergenic
1129086755 15:73102071-73102093 CAGAATCTGAATTTTAGTCCAGG + Intronic
1129433213 15:75516605-75516627 AACATACATAAATTTAGGCCAGG - Intronic
1129471793 15:75760188-75760210 AATAAACAGTACATTAGGCCGGG + Intergenic
1129494729 15:75967755-75967777 AAGAATCAGATTTTGCGGCCAGG - Intronic
1129864504 15:78894701-78894723 AAAATACATGATTTTAGGCCGGG - Intronic
1129972622 15:79793179-79793201 AAAAAAATAAATTTTAGGCCAGG - Intergenic
1130182185 15:81641556-81641578 AAGAAACCTGATTTTAGACCAGG - Intergenic
1130372200 15:83294526-83294548 AAGATACTCAATATTAGGCCAGG - Intergenic
1130658234 15:85808317-85808339 AAGAAAAAGAGGTTTGGGCCGGG - Intergenic
1131017795 15:89072178-89072200 AAGAAACAAATGTTTGGGCCAGG + Intergenic
1131242695 15:90760744-90760766 GAGAAACAGAATTTGAGGGAAGG - Exonic
1131331115 15:91500350-91500372 AAGAATTAAAATTTTTGGCCGGG + Intergenic
1131964751 15:97830233-97830255 AATAAACTGTATTTCAGGCCAGG + Intergenic
1131992098 15:98102474-98102496 AAAAAAAAGAACTTTTGGCCTGG - Intergenic
1132101016 15:99023616-99023638 AGAAAAAAGAATTTAAGGCCAGG - Intergenic
1132413279 15:101602052-101602074 AAAAAATCAAATTTTAGGCCAGG + Intergenic
1132531026 16:449654-449676 AAAAAAAAAAGTTTTAGGCCGGG + Intronic
1132812090 16:1805079-1805101 AAACAACACAAGTTTAGGCCAGG - Intronic
1132888512 16:2193310-2193332 AAAAATAAGAATTTCAGGCCGGG - Intronic
1133070304 16:3242372-3242394 AAAAAAAAGAATCATAGGCCGGG + Exonic
1133103449 16:3492773-3492795 AAACAACAGAAAATTAGGCCGGG + Intergenic
1133163040 16:3924710-3924732 AAGAAAAAGAATTTTGGGTCAGG + Intergenic
1133196326 16:4173364-4173386 AAAAAAAAAAATTTGAGGCCGGG - Intergenic
1133623208 16:7546029-7546051 AAGAAAAAGAAAATCAGGCCAGG + Intronic
1133943617 16:10330338-10330360 AAAAAAAAAAATTTCAGGCCGGG - Intronic
1133977490 16:10609913-10609935 AATATTCAGAAATTTAGGCCAGG + Intergenic
1134119694 16:11575096-11575118 AAAAAAAAGAACTTTAGGCCGGG - Intronic
1134146046 16:11763402-11763424 ATGAAACAGTAATTTGGGCCTGG - Intronic
1134467375 16:14491466-14491488 AAGAAACAAAACTTCAGGCCAGG + Intronic
1134602143 16:15541895-15541917 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1134815194 16:17199924-17199946 AAGAAACAGCATTTAGGGGCCGG + Intronic
1134869997 16:17643840-17643862 CAGAAGCTGAATGTTAGGCCTGG + Intergenic
1135013296 16:18903118-18903140 AAAAAACAAAATTTATGGCCGGG - Intronic
1135296807 16:21286793-21286815 AAGATACTTAATTTTAGGCCGGG + Intronic
1135320226 16:21490714-21490736 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135327994 16:21539646-21539668 AAAAAACAGCATTATAGGCTGGG + Intergenic
1135337701 16:21617430-21617452 AAGAAAAAAAAAATTAGGCCAGG + Intronic
1135362652 16:21828410-21828432 AAAAAACGGAAATTTTGGCCAGG + Intergenic
1135373061 16:21922204-21922226 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135438728 16:22448498-22448520 AAAAAACAAAATTTATGGCCGGG + Intergenic
1135529813 16:23243438-23243460 TAGAAAAAAATTTTTAGGCCAGG - Intergenic
1135542479 16:23342540-23342562 TAGAAACAGAATTGCAGGCTGGG - Intronic
1135554095 16:23421043-23421065 CAGAAACAGCATTTTGGGCCAGG - Intronic
1135717917 16:24788941-24788963 AAATAAAAGAATTTTGGGCCGGG - Intronic
1135767273 16:25188514-25188536 AAAAAAAAGAAAATTAGGCCAGG + Intergenic
1135953560 16:26937273-26937295 AAGAAAAAGAGGTTTAGGCCGGG - Intergenic
1136149339 16:28336628-28336650 AAAAAACGGAAATTTTGGCCAGG + Intergenic
1136330453 16:29572412-29572434 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136338347 16:29625670-29625692 AAAAAACAGCATTATAGGCTGGG + Intergenic
1136424527 16:30160667-30160689 AAAAAACATATTTTTGGGCCGGG + Intergenic
1136445081 16:30312132-30312154 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136649054 16:31650309-31650331 AACAAACAAAATTATAGGTCTGG - Intergenic
1136852580 16:33624834-33624856 AAGAAACAGAATATTATGTGGGG + Intergenic
1137640761 16:50026677-50026699 AAAAAACATATTTTTTGGCCAGG + Intronic
1137862586 16:51861545-51861567 AAGAAATATAATTTTATTCCAGG - Intergenic
1138603127 16:58069404-58069426 AAGAAACAGAACATGAGGCCAGG - Intergenic
1138614494 16:58154055-58154077 AAAAAAATGAATTTTAGGCTGGG + Intergenic
1138660417 16:58513457-58513479 GAGAAACAGAATGTTTGGGCAGG + Exonic
1139306523 16:65991025-65991047 AATAAACAGACTTTTTGTCCAGG - Intergenic
1139424415 16:66870396-66870418 AAGAAAAAGAAGCATAGGCCGGG + Intronic
1139454741 16:67064499-67064521 TAAAAACATAATTTTAGGGCTGG - Intronic
1139456753 16:67085653-67085675 AAGATACTAAATTTTAGGCTGGG - Intronic
1139456804 16:67085971-67085993 AAGATACTAAATTTTAAGCCGGG - Intronic
1139702248 16:68715128-68715150 CAGAAAGGGAATTTGAGGCCGGG + Intronic
1140054838 16:71516549-71516571 AAGAAAAAAAAAATTAGGCCGGG + Intronic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140171229 16:72607231-72607253 CAAAAACTGAATTTTTGGCCAGG + Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140373242 16:74424629-74424651 AAGAAAAAAAAAATTAGGCCAGG + Intergenic
1140432981 16:74920684-74920706 TAGAAAATGTATTTTAGGCCAGG - Intronic
1140531512 16:75670790-75670812 AAAAAATAAAATTTTACGCCTGG - Intronic
1140688115 16:77453150-77453172 AAGAAACTTTATTTTAGGCTGGG - Intergenic
1140710664 16:77674262-77674284 AAAAAAAAGAGTTTGAGGCCGGG + Intergenic
1141345951 16:83246030-83246052 AAGAAATAGGAATTTGGGCCAGG - Intronic
1141537010 16:84688833-84688855 AAGAAAAAGAAGTTTAGACTGGG - Intergenic
1141590404 16:85064978-85065000 AGGAAATACAATTATAGGCCGGG - Intronic
1141691828 16:85601043-85601065 AGGAGGCAGAATTTTAAGCCAGG + Intergenic
1141931328 16:87206127-87206149 AAAGAAAAGAAGTTTAGGCCAGG + Intronic
1141956835 16:87377860-87377882 AAAAAACAGAAATCTAGGCCAGG + Intronic
1142041078 16:87894581-87894603 AAAAAACAGCATTATAGGCTGGG + Intronic
1142374269 16:89698780-89698802 AAAAAAAAAAATTCTAGGCCGGG - Intronic
1142451631 16:90175937-90175959 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1203114181 16_KI270728v1_random:1473302-1473324 AAGAAACAGAATATTATGTGGGG + Intergenic
1142579358 17:931846-931868 AAAAAAAAAAATTTTTGGCCGGG + Intronic
1142726330 17:1817331-1817353 AAAAAAAACAGTTTTAGGCCAGG - Intronic
1142795870 17:2306419-2306441 AAAAACAACAATTTTAGGCCAGG + Intronic
1143220750 17:5259659-5259681 AAGGAAGAAAATGTTAGGCCAGG + Intergenic
1143222089 17:5271156-5271178 AAGAAACAGTATCTCAGGCTGGG + Intergenic
1143454366 17:7056649-7056671 AAGCAACAGAAATTTGAGCCAGG - Intergenic
1143581319 17:7828737-7828759 AAATTACAGAATTTTAGGCCAGG - Intronic
1143656626 17:8298103-8298125 AAGAAGAAAAAGTTTAGGCCGGG - Intergenic
1143666125 17:8362029-8362051 AAGAAAATGAATTTAAGGCCAGG + Intergenic
1144165619 17:12607425-12607447 AAAAAACAGATTTTGTGGCCCGG - Intergenic
1144691810 17:17271522-17271544 AAGAAAAATATGTTTAGGCCTGG + Intronic
1144963266 17:19058950-19058972 AAAACACAGAAATGTAGGCCGGG + Intergenic
1144964424 17:19067090-19067112 ACAAAACAGAAATGTAGGCCGGG - Intergenic
1144971893 17:19115575-19115597 AAAACACAGAAATGTAGGCCGGG - Intergenic
1144983543 17:19185083-19185105 AAAAACCAGAAATGTAGGCCGGG + Intergenic
1144984682 17:19193156-19193178 AAAAACCAGAAATGTAGGCCGGG - Intergenic
1145082186 17:19903197-19903219 AAGAAAAAGAATTTTGGGCTAGG - Intergenic
1145127990 17:20317552-20317574 AAAAAACAAAATTTTGGGCCAGG - Intronic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145821666 17:27841517-27841539 AGAGAACAGAATTTTAGGTCTGG - Intronic
1145837369 17:27964714-27964736 AAGAACCAGAATTTGAACCCAGG - Intergenic
1146007314 17:29168799-29168821 AAGAAATATAATTCAAGGCCAGG + Intronic
1146070761 17:29679009-29679031 TTGAAATAGCATTTTAGGCCGGG - Intronic
1146173224 17:30648614-30648636 AGGGAACAGCATTTTAGGCAGGG + Intergenic
1146204583 17:30891666-30891688 AAGAAACAGTAATTTCAGCCGGG - Intronic
1146346686 17:32064646-32064668 AGGGAACAGCATTTTAGGCAGGG + Intergenic
1146391987 17:32431065-32431087 AAGGAAAAGAGATTTAGGCCAGG - Intergenic
1146534163 17:33635350-33635372 CAGAAACAGAAGTTTAGGTTAGG + Intronic
1146723680 17:35140883-35140905 CAGATAAAGAATTTCAGGCCGGG - Intronic
1146876208 17:36413657-36413679 AATAAAAATAATTTTAGGCCAGG - Intronic
1146895358 17:36536808-36536830 AAGAAAGTGAATTTGGGGCCAGG - Intronic
1147063175 17:37899216-37899238 AATAAAAATAATTTTAGGCCAGG + Intergenic
1147294588 17:39471925-39471947 GAGAATTAGAATTTGAGGCCTGG + Intronic
1147404389 17:40200490-40200512 AAAAAAAAAAAATTTAGGCCGGG + Intergenic
1147411434 17:40255618-40255640 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1147432335 17:40379972-40379994 AAGAAAAAGAAGTTTTGGCCAGG - Intergenic
1147627879 17:41911419-41911441 AAGAAACATAATTTTATTCCAGG + Intronic
1147846656 17:43409027-43409049 TAGAAACAGAATGTGAAGCCGGG - Intergenic
1148005234 17:44422483-44422505 AAAAAAAAAAATTTTAGGCTAGG - Intronic
1148055418 17:44791728-44791750 AAAAAAAAAAAATTTAGGCCGGG - Intergenic
1148096750 17:45057713-45057735 AAAAAACAGTAATTCAGGCCAGG + Intronic
1148252581 17:46097028-46097050 CAGAAACAGAATTTCATGGCTGG - Intronic
1148369263 17:47083276-47083298 CAGAAACAGAATTTCATGGCTGG - Intergenic
1148372986 17:47114957-47114979 AAGAAAGAGAAATGTAGGCTGGG - Intergenic
1148603846 17:48913646-48913668 AAAAAACAGATTTCTGGGCCGGG - Intronic
1149033121 17:52105535-52105557 AAGAATAAGGATTTGAGGCCAGG - Intronic
1149587029 17:57797440-57797462 AAACAATAGAATTTTGGGCCAGG + Intergenic
1149759148 17:59213884-59213906 AAAAAACAGAATATTAGGTATGG - Intronic
1149779046 17:59381870-59381892 AGCAAACAGAATTTCAGACCAGG - Intronic
1149800928 17:59566525-59566547 AGGCAATAGAATTTTAGGGCTGG - Intronic
1149841069 17:59965321-59965343 AAGAAAACGAAGTTTAGGTCGGG + Intronic
1150011351 17:61507290-61507312 CAAGAACAAAATTTTAGGCCAGG - Intergenic
1150311553 17:64132979-64133001 AAAAAACAGATTTCCAGGCCAGG + Intergenic
1150368386 17:64612370-64612392 AAGAAATCTTATTTTAGGCCAGG + Intronic
1151226179 17:72649886-72649908 AAGAAACAGAGGTGTAGGCTGGG - Intronic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151524297 17:74653403-74653425 CAGTAACAGAATTTTTGGCTGGG - Intergenic
1151628932 17:75296784-75296806 AAGAAACACACTATCAGGCCAGG - Intergenic
1151734448 17:75930309-75930331 AAGTAGCAGAATTTCAGTCCTGG - Intronic
1151762765 17:76115822-76115844 AAGAAAAAAATTTTTAGGCCAGG + Intronic
1152764921 17:82131133-82131155 AAGAAAAATAAATGTAGGCCAGG + Intronic
1152813638 17:82394283-82394305 AAGAAAGTGCATCTTAGGCCGGG - Intronic
1152872383 17:82763442-82763464 AAGAGACAGGGTTTTGGGCCAGG + Intronic
1153199983 18:2638091-2638113 AAGAAACAGAAATTTAGCCCGGG + Intergenic
1153205525 18:2695603-2695625 TAAAAAAAAAATTTTAGGCCGGG - Intronic
1153229575 18:2923122-2923144 AAGAAATACAATTTTAAGGCTGG + Intronic
1153931056 18:9880119-9880141 AAGAAAAATAAATTTAGGCCAGG - Intergenic
1154019119 18:10647330-10647352 ATTAAACAGGATTCTAGGCCGGG - Intergenic
1154113557 18:11591253-11591275 GAGTAACAGAATTTTAGACCTGG - Intergenic
1154185095 18:12175894-12175916 ATTAAACAGGATTTTAGGCCAGG + Intergenic
1154358009 18:13637091-13637113 AACAAAAAAAACTTTAGGCCAGG - Intronic
1154466776 18:14652673-14652695 AAGAAATAAAATAATAGGCCGGG + Intergenic
1154938533 18:21087375-21087397 AAGAAACAGATTGGTAGACCTGG + Intronic
1155070313 18:22309314-22309336 TAGAAACAGATTTGTAGGCAGGG + Intergenic
1155194911 18:23465074-23465096 AAAAAATAGCATTCTAGGCCGGG + Intronic
1155211390 18:23605214-23605236 ATAAAACAGAATTCTGGGCCGGG - Intronic
1155487768 18:26365300-26365322 CAAGAACAGAATTATAGGCCAGG - Intronic
1155644158 18:28057368-28057390 AAGAAATGAAATTTGAGGCCAGG + Intronic
1156098387 18:33563947-33563969 ATGAAATAGAATTTGAGGCCGGG + Intergenic
1156217983 18:35020907-35020929 AAGAAACAGAATTATTTGTCTGG + Intronic
1156879762 18:42062796-42062818 GAGGAACAGGATTTTAGGCAGGG - Intronic
1157016844 18:43725627-43725649 TAGAAAAAAATTTTTAGGCCAGG + Intergenic
1157033892 18:43947683-43947705 AAGTAACGAAATTTTAAGCCTGG + Intergenic
1157249849 18:46085337-46085359 AAGAAAGATAGTTTGAGGCCGGG + Intronic
1157463780 18:47926973-47926995 GAGAAACAAAATATTAGGCTAGG + Intronic
1157717748 18:49900683-49900705 GAGAAACAGAATTTTAGAGTGGG - Intronic
1157781966 18:50447439-50447461 GAGAAACATAATTTTAGATCCGG - Intergenic
1157892176 18:51428168-51428190 AACATACAGAATTCTAGGCAGGG + Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158407408 18:57172500-57172522 CAGAAACATAATTTGAGCCCAGG - Intergenic
1158463091 18:57664209-57664231 AAGAAAGGCAATCTTAGGCCAGG + Intronic
1158465431 18:57685950-57685972 CAAAAACACAATTGTAGGCCGGG + Intronic
1158504587 18:58035252-58035274 AAAAAAACAAATTTTAGGCCAGG + Intergenic
1159414073 18:68121127-68121149 AAGAAGCATAATTTTAGGAGGGG - Intergenic
1159563444 18:70021124-70021146 AAGGAACAGAATTTTAGAAATGG + Intronic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1160645850 19:193111-193133 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1160709805 19:545936-545958 AAAATACAGAAATTAAGGCCGGG - Intronic
1160953897 19:1680879-1680901 AAAAAACATGACTTTAGGCCCGG - Intergenic
1161100640 19:2419495-2419517 AAGAAAAAGAAATCTAGGCTGGG - Intronic
1161263921 19:3354195-3354217 AAAAAAAAGATTTGTAGGCCAGG - Intergenic
1161292964 19:3505713-3505735 ACAAAACAGGTTTTTAGGCCAGG - Intergenic
1161339855 19:3735492-3735514 TTTAAAAAGAATTTTAGGCCGGG - Intronic
1161787799 19:6338868-6338890 AAAAAAAAGATTTTAAGGCCAGG - Intergenic
1162047043 19:8006811-8006833 GAAAAACAAAATTGTAGGCCAGG - Intronic
1162289062 19:9765075-9765097 AAGAAAAAGTATTTCAGGCTAGG + Intronic
1162406370 19:10476803-10476825 AAAAAAAAAAATTTTTGGCCGGG - Intergenic
1162655966 19:12129913-12129935 AAAAAAAGGAATTTTTGGCCAGG + Intronic
1162851172 19:13432116-13432138 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1162900007 19:13789392-13789414 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1162914630 19:13867544-13867566 AACAAACAAAAATTTGGGCCAGG - Intronic
1162989192 19:14291447-14291469 AGGGAACAGCATTTTAGGCAGGG - Intergenic
1163054464 19:14707844-14707866 AAGAAACAAAGTTTATGGCCGGG - Intronic
1163078842 19:14921082-14921104 AAGAACTGGAGTTTTAGGCCAGG + Intergenic
1163092585 19:15031174-15031196 AAGAAACACTACTTTAGGCCGGG - Intergenic
1163407191 19:17130173-17130195 AAGATATAGAATTTTTGACCAGG + Intronic
1163480272 19:17551388-17551410 AAAAAAAAGAAATGTAGGCCGGG - Intronic
1163556476 19:17996307-17996329 AAAAAATAAAATTTTAAGCCTGG + Intronic
1163865068 19:19766627-19766649 TAAAAACAGAATTATAGGTCGGG + Intergenic
1163926033 19:20344521-20344543 ATGTAAAATAATTTTAGGCCAGG + Intergenic
1164026176 19:21355287-21355309 AAGAAAAAAAACTTTAAGCCGGG - Intergenic
1164212758 19:23114645-23114667 AAGAAAAACAACTTTAGGGCCGG - Intronic
1164218172 19:23169459-23169481 AGAAAACAGATTCTTAGGCCAGG - Intergenic
1164255989 19:23528780-23528802 AAGAAACACAATCTTGGGCTGGG + Intronic
1164267163 19:23630591-23630613 AAAAAAAAAAAATTTAGGCCAGG + Intronic
1164269477 19:23658387-23658409 AACAAAGACAATTTTGGGCCAGG + Intronic
1164313810 19:24069299-24069321 AAGAAACACAATCTTGGGCTGGG - Intronic
1164444344 19:28304226-28304248 CAGAAAGATAGTTTTAGGCCAGG + Intergenic
1164484956 19:28647396-28647418 TCTAAAAAGAATTTTAGGCCAGG - Intergenic
1164702988 19:30298964-30298986 AATAATCTGCATTTTAGGCCTGG + Intronic
1164774694 19:30843896-30843918 AATAAACATTTTTTTAGGCCGGG + Intergenic
1164802156 19:31086269-31086291 AAGAGTCAGAAAGTTAGGCCAGG - Intergenic
1165171652 19:33896404-33896426 AAGAAAAACATTTTTTGGCCAGG + Intergenic
1165214314 19:34258902-34258924 AAAAAAATGAATTTTAGGTCTGG + Intronic
1165402221 19:35609030-35609052 AAGAAGCAGAAAGTGAGGCCAGG + Intergenic
1165431185 19:35774272-35774294 AAAATATAGAATATTAGGCCAGG - Intergenic
1165578872 19:36845120-36845142 AACAGAAAGAAATTTAGGCCAGG + Intronic
1165586866 19:36924533-36924555 AAAAAATAACATTTTAGGCCAGG + Intronic
1165611925 19:37162217-37162239 AAGAATCATACTTTTAGGCCGGG - Intronic
1165682283 19:37788374-37788396 AAAATACAAAATTTTTGGCCGGG + Intronic
1165719394 19:38068322-38068344 AAGAATCTGATTTTTCGGCCGGG - Intronic
1165836341 19:38758910-38758932 AATACAAAGAAGTTTAGGCCAGG - Intronic
1165871158 19:38974375-38974397 AAAAAATATATTTTTAGGCCGGG - Intronic
1166152958 19:40887871-40887893 TTGAAACAGATTTTAAGGCCGGG + Intronic
1166216798 19:41341169-41341191 AAGATACAAAAAATTAGGCCGGG + Intronic
1166378310 19:42341134-42341156 TAAAAACAGAATTTTTGGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166641672 19:44499461-44499483 GAGATACAGAATTTAAGTCCAGG - Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1166863382 19:45822366-45822388 AAGAAACAAAACTTGAGGCGAGG - Intronic
1166967824 19:46540892-46540914 AAGAAGAGGAAATTTAGGCCGGG - Intronic
1167058306 19:47127299-47127321 AAAATACAAAATTTTAGGCATGG - Intronic
1167063657 19:47167805-47167827 AAAAAAAATTATTTTAGGCCAGG - Intronic
1167150898 19:47708988-47709010 AAGAAACAGCCATTTAGGCTGGG - Intergenic
1167194091 19:48014960-48014982 AAGAAACGGGATTTGAGGCTGGG + Intronic
1167229747 19:48274799-48274821 AAGAAACATAACTCTAGGCCAGG - Intronic
1167303157 19:48691320-48691342 AAGAAAAAAAATTGTAGGCCGGG - Intergenic
1167319383 19:48786772-48786794 AAGAAATAGCACTTGAGGCCGGG + Intergenic
1167371422 19:49084886-49084908 AATAAAGATAATTTGAGGCCAGG - Intergenic
1167431234 19:49455599-49455621 AAAAAAAAGAAGTTGAGGCCAGG + Intronic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1167481918 19:49737910-49737932 AAGAAACAGAAAAATAGGCCGGG - Intergenic
1167610073 19:50502900-50502922 AACAAACAAAAAATTAGGCCAGG - Intergenic
1167656779 19:50770069-50770091 ACAAAAAAGAATTTAAGGCCTGG + Intergenic
1167864439 19:52313114-52313136 AAGAGAAAGAATTATAGGCTGGG - Intronic
1167864486 19:52313431-52313453 AAAAAAAAGAATTATAGGCCAGG - Intronic
1167883330 19:52480600-52480622 AAAAAAAAAAATTTTTGGCCGGG + Intronic
1167998427 19:53425605-53425627 GAGTAAAAGAGTTTTAGGCCAGG - Intronic
1168050561 19:53826611-53826633 ATGCAACAGAATATTAGTCCTGG - Intergenic
1168139791 19:54377966-54377988 AAAAAAAAAAACTTTAGGCCAGG + Intergenic
1168518590 19:57030396-57030418 CATAAAAAGAATTATAGGCCAGG + Intergenic
1168545011 19:57242883-57242905 AAGAGACAGGATTTTAACCCAGG - Intronic
1168610889 19:57798874-57798896 AAGAAATAGCACTTGAGGCCAGG + Intronic
1202645536 1_KI270706v1_random:136395-136417 AAGAAATAGAATTTAAGGGCCGG - Intergenic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
925345266 2:3167671-3167693 AAGAACCAGACATTTAGGCCGGG + Intergenic
925391426 2:3497000-3497022 AAGAAACAGAACTCTAGGCGGGG - Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
926348642 2:11974399-11974421 CAAAGAGAGAATTTTAGGCCAGG - Intergenic
926350735 2:11991769-11991791 AAAGAAAAGAAGTTTAGGCCGGG - Intergenic
926912716 2:17866058-17866080 AAAAAATAGAGTTTTAGGCCGGG - Intergenic
927147346 2:20175019-20175041 AAAAAAAAGAATTCTGGGCCAGG + Intergenic
927185689 2:20480512-20480534 AAAAAAAAAAATTTCAGGCCAGG + Intergenic
927330343 2:21855269-21855291 AAGAATCTGAATTTCAGTCCAGG - Intergenic
927562898 2:24085938-24085960 AATAACAGGAATTTTAGGCCGGG + Intronic
927704409 2:25288137-25288159 AAGAAACACTTTTTTTGGCCAGG + Intronic
927726032 2:25423953-25423975 TAGAATCCTAATTTTAGGCCAGG - Intronic
927754191 2:25695537-25695559 CAAAAATAGAATCTTAGGCCGGG - Intergenic
927775154 2:25897132-25897154 AAAAAACAAAAATTAAGGCCAGG - Intergenic
927795634 2:26046027-26046049 AAGAAAAGGAATTTGAGGCCCGG + Intronic
927900297 2:26814028-26814050 TAGAAACAGAATTCCAGGCCGGG + Intergenic
927916158 2:26937999-26938021 AAGAAACCAGATTTTAGGCCAGG - Intronic
928349676 2:30538352-30538374 ATGAAAAAGAAAATTAGGCCAGG + Intronic
928539513 2:32271079-32271101 AATAAAAAGCATTCTAGGCCAGG - Intergenic
928681850 2:33710842-33710864 AAGAAAAAGAATTAGAGGCCAGG + Intergenic
928718255 2:34088673-34088695 AGGAAAGAAAATTTTAGACCGGG - Intergenic
929148952 2:38730926-38730948 AAAAAAAAGAATCTCAGGCCAGG + Intronic
929154828 2:38780021-38780043 AAGAAAAGGACTTTAAGGCCGGG + Intronic
929397896 2:41544481-41544503 AAGAAAGAGAATATAAGGCTGGG - Intergenic
929432069 2:41895643-41895665 AAGAAACTGAAATTCAGGGCAGG + Intergenic
929494750 2:42430812-42430834 AAAAGACCGATTTTTAGGCCAGG + Intergenic
929523329 2:42675429-42675451 AAGAAAAAGAATTTTGAGGCTGG - Intronic
929811994 2:45197823-45197845 GAGAATCTGAATTATAGGCCCGG + Intergenic
929863087 2:45695857-45695879 AAGAAACAGATTTTAACGTCAGG + Intronic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
930009843 2:46928321-46928343 AAGAAAAAGAACTCCAGGCCAGG + Intronic
930045414 2:47167396-47167418 AATATAAAAAATTTTAGGCCGGG + Intronic
930369451 2:50485014-50485036 TAGAAACAGAATTTGAACCCAGG - Intronic
930637861 2:53825509-53825531 AAAAAAAAAAATTTGAGGCCGGG + Intergenic
930782871 2:55240821-55240843 AAGGAATAGTATTTTAGCCCTGG - Intronic
930788758 2:55300804-55300826 AAGAAACCAATTTTTGGGCCAGG - Intronic
930801890 2:55451388-55451410 AAGAACATGAATTCTAGGCCGGG - Intergenic
930829947 2:55732363-55732385 AAGAAATAGAGCTCTAGGCCAGG - Intergenic
931278466 2:60765374-60765396 AAAAAAGAGAATTATAGGCTGGG - Intronic
931280429 2:60786524-60786546 AAAAAAAAAAATTTCAGGCCAGG - Intronic
931302185 2:60991036-60991058 AAAAAATAAAATGTTAGGCCAGG - Intronic
931436404 2:62251028-62251050 AAAAAATAGCATTTTAAGCCAGG - Intergenic
931437825 2:62264237-62264259 AAGAAAAAGAGCTTCAGGCCAGG - Intergenic
931568229 2:63639439-63639461 AAGAAATAAACTTCTAGGCCAGG - Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931663838 2:64595847-64595869 AAAGAATAGAATTTTAGGGCTGG + Intergenic
931805055 2:65796255-65796277 AAGAAACATGATTTTAGGGAGGG + Intergenic
932026851 2:68142552-68142574 ATGAAATAGTATTCTAGGCCAGG - Intronic
932139447 2:69262684-69262706 AAGAAACACAATGTAGGGCCTGG + Intergenic
932251626 2:70249470-70249492 AAGAAATAGCTGTTTAGGCCGGG + Intergenic
932655087 2:73603562-73603584 AATAAAGAATATTTTAGGCCAGG + Intronic
932663228 2:73675160-73675182 AATAAAGAATATTTTAGGCCAGG + Intergenic
933389083 2:81648554-81648576 TTAAAACAGAATCTTAGGCCAGG - Intergenic
933916585 2:87000654-87000676 AAGAGAGAGAATGTAAGGCCTGG + Intronic
934006409 2:87769260-87769282 AAGAGAGAGAATGTAAGGCCTGG - Intronic
934300312 2:91772789-91772811 AAGAAACAGACTTGTCTGCCTGG - Intergenic
934507942 2:94909962-94909984 AAGAAATAGAATTTAAGGGCCGG - Intergenic
934691311 2:96362037-96362059 TAAAAACAGAATGTGAGGCCAGG - Intronic
934692992 2:96376222-96376244 CAGAACCAGAATTTAAGGGCAGG + Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
934912615 2:98273232-98273254 CAAAAAGAGAATTTTAAGCCAGG - Intronic
935290136 2:101603221-101603243 AATAAAATGCATTTTAGGCCGGG + Intergenic
935396131 2:102611139-102611161 AAGAAAGAAAATTTTTGGCCGGG - Intergenic
935770061 2:106410168-106410190 AAGAGAGAGAATGTAAGGCCTGG - Intronic
935789374 2:106577068-106577090 AAAAAACACAACCTTAGGCCGGG - Intergenic
935910034 2:107885756-107885778 AAGAGAGAGAATGTAAGGCCTGG + Intronic
935968151 2:108502632-108502654 AAGAGAGAGAATGTAAGGCCTGG + Intronic
936131818 2:109850886-109850908 AAGAGAGAGAATGTAAGGCCTGG + Intronic
936212879 2:110520599-110520621 AAGAGAGAGAATGTAAGGCCTGG - Intronic
936422019 2:112375155-112375177 AAGAGAGAGAATGTAAGGCCTGG - Intronic
936436730 2:112514086-112514108 AAGAAACTCATTTTTAGGCCAGG + Intronic
936442787 2:112569852-112569874 AAAAAACAAAATTTGAGGCCGGG - Intronic
936781109 2:116034053-116034075 TAGAAATAGTATTTTAGGCCTGG + Intergenic
936938927 2:117863065-117863087 AAGAATCACTATTTTTGGCCAGG + Intergenic
937101250 2:119271808-119271830 AAAATATAGCATTTTAGGCCAGG - Intergenic
937184890 2:120030848-120030870 AATAAACATAATTTGAGGCCAGG - Intronic
937206873 2:120242417-120242439 ATTAAAAATAATTTTAGGCCAGG + Intronic
937211014 2:120271008-120271030 AGGACACAGAATTTTAGGAGGGG + Intronic
937429633 2:121827272-121827294 ATTGAAAAGAATTTTAGGCCCGG - Intergenic
937435512 2:121877193-121877215 AAGAAATAAAACTTTGGGCCGGG - Intergenic
937712141 2:124990276-124990298 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
938476876 2:131624078-131624100 AAGAAAATGAATTCTGGGCCGGG + Intergenic
938659615 2:133472172-133472194 AACAAGCAGAATTTTAGGGCAGG - Intronic
938818363 2:134928254-134928276 AAGAAATACAATGTGAGGCCGGG - Intronic
938825163 2:134997523-134997545 AACAAAAAAAAATTTAGGCCAGG + Intronic
938849281 2:135243913-135243935 AAAAAAAAAAATTTAAGGCCGGG - Intronic
939083926 2:137694735-137694757 AAGAAAAAAAATTCTAGGTCTGG + Intergenic
939154249 2:138505459-138505481 AAGAAAAAAAATTATAGGCCAGG + Intronic
939395822 2:141628521-141628543 AAGAAACAGGATTTTAAGAATGG + Intronic
939861343 2:147424249-147424271 AAGTTAGAGAATTTTAGGCTAGG + Intergenic
940122910 2:150287586-150287608 AAGAAACAGAAGTTCATGGCTGG - Intergenic
940207002 2:151214068-151214090 AAAAAAAAAAAGTTTAGGCCGGG + Intergenic
940230659 2:151447834-151447856 AAATAACAGAATTCCAGGCCAGG - Intronic
940264235 2:151819758-151819780 AAAAAAAAGACTCTTAGGCCAGG + Intronic
940789120 2:158013289-158013311 ATGAAAAAGAATTATTGGCCAGG - Intronic
940880762 2:158944522-158944544 AAAGAATAGAAATTTAGGCCTGG + Intergenic
941470875 2:165885387-165885409 TAGATACAGAATTTGAGGCAAGG - Intronic
941685912 2:168448530-168448552 TAGAAAAAGAATTTCAGGACTGG - Intergenic
941821133 2:169844292-169844314 AAGAAATCGAATATGAGGCCGGG - Intronic
941912446 2:170776671-170776693 AAAAAACAGCTTTTAAGGCCGGG - Intergenic
941976941 2:171415643-171415665 AAAAAAGAATATTTTAGGCCAGG - Intronic
942018610 2:171843336-171843358 AAGAACAATAACTTTAGGCCAGG + Intronic
942230555 2:173857691-173857713 AAAAATTAGAATTCTAGGCCAGG + Intergenic
942572774 2:177330274-177330296 AAGAAATATATTTTTGGGCCAGG - Intronic
943063947 2:183067801-183067823 AAAAAACACAATTTTTGGCCAGG - Intergenic
943120549 2:183729651-183729673 AAGAAAAATAATTTTATGTCTGG - Intergenic
943134947 2:183898211-183898233 AACAAAAACAATTTCAGGCCGGG + Intergenic
943313508 2:186356828-186356850 AAAAAACAAATATTTAGGCCAGG + Intergenic
943598955 2:189891516-189891538 AAAGAAAAGAATTTTCGGCCGGG - Intronic
943651809 2:190465694-190465716 AAAAAACAGAAGTTTATGGCCGG + Intronic
943672130 2:190674350-190674372 AAGAAACAGAAGTCTAGGTAGGG - Intronic
943928296 2:193817536-193817558 AAGAAAAAGAATGTTAGTGCTGG - Intergenic
943928299 2:193817602-193817624 AAGAAAAAGAATGTTAGTGCTGG - Intergenic
944132662 2:196363533-196363555 AAGAAAAATAAATCTAGGCCAGG + Intronic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944333584 2:198502070-198502092 AATAAACAAAAGTTAAGGCCAGG - Intronic
944554441 2:200873908-200873930 AATTAACAGATTTGTAGGCCTGG + Intronic
944565896 2:200990863-200990885 AAAATACAAAATTTAAGGCCAGG - Intronic
944642084 2:201738003-201738025 AAAATACAGAATTTTTGGCCTGG + Intronic
944703886 2:202269330-202269352 AAAAAAAAAAAATTTAGGCCAGG - Intronic
944774069 2:202943939-202943961 CAAAAACAGGAGTTTAGGCCGGG - Intronic
944949175 2:204727644-204727666 AAGAAACAGGAATTTATGCTGGG + Intronic
945042640 2:205755071-205755093 AAGAAACAGAGGTCCAGGCCAGG - Intronic
945083366 2:206107943-206107965 TAAAAACAGGATATTAGGCCGGG - Intergenic
945130326 2:206564023-206564045 GAAATAAAGAATTTTAGGCCGGG - Intronic
945257474 2:207814220-207814242 AAAAAAAATATTTTTAGGCCGGG - Intergenic
945960559 2:216129969-216129991 AAGAAACACACTTTTAGGCCAGG - Intronic
946237975 2:218336774-218336796 AAAAAAAAGAATTGAAGGCCAGG - Intronic
946240264 2:218349622-218349644 AAGAATAAGAAATTGAGGCCAGG - Intergenic
946279081 2:218653280-218653302 AAAAAAAAAAATTTCAGGCCGGG + Intronic
946512617 2:220375540-220375562 AAAAAACAGAAAATTAGGCATGG - Intergenic
946920865 2:224581099-224581121 AAAAAACAGAACTATTGGCCGGG + Intronic
947435737 2:230070388-230070410 AAGAAATAGCAATATAGGCCGGG - Intergenic
947576384 2:231278317-231278339 CAGAAGCACAATTTTAGGTCAGG - Intronic
947678234 2:232004875-232004897 AAAAATGAGAATTTTAGACCAGG - Intronic
947778951 2:232739802-232739824 AAAAAACAAATATTTAGGCCGGG + Intronic
947987769 2:234463567-234463589 ATGAAATACAATTTTAGGCCAGG - Intergenic
949002301 2:241622920-241622942 AAGAAACCCACTTTGAGGCCAGG + Intronic
1168974913 20:1957512-1957534 AAGAAACAGGATTTGAACCCAGG - Intergenic
1169096434 20:2903389-2903411 AAGAAATAGAATTATTGGCTGGG + Intronic
1169305556 20:4487377-4487399 AAAAAAGAGAATTAGAGGCCAGG + Intergenic
1169342129 20:4804631-4804653 AAGAAAGAAAAGTTTTGGCCAGG - Intronic
1169448133 20:5689166-5689188 CAGAAAAATAAATTTAGGCCTGG + Intergenic
1169462257 20:5805894-5805916 ATTAAACACAAATTTAGGCCAGG - Intronic
1169487882 20:6048488-6048510 CAGAATCAGAATTTGAGCCCAGG - Intronic
1169560223 20:6791940-6791962 AAGAAAAATAATTGTAGGCTGGG + Intergenic
1169885294 20:10391999-10392021 AAAAAACAGATTATCAGGCCAGG + Intergenic
1170183661 20:13562579-13562601 AATAAAAAGTATTATAGGCCAGG + Intronic
1170521385 20:17189485-17189507 AAGAAAACTAATTTTAGGGCTGG + Intergenic
1170987995 20:21275647-21275669 AAAAAAAAGAATTTTATGGCCGG + Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171285110 20:23930468-23930490 AAAAAACAGAACTCTAGCCCAGG + Intergenic
1171895500 20:30755312-30755334 AAGAAATAGAATTTAAGGGCTGG - Intergenic
1172224166 20:33293540-33293562 TTAAAACAGTATTTTAGGCCAGG + Intronic
1172455466 20:35068813-35068835 AATTAAAACAATTTTAGGCCGGG - Intronic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1172681751 20:36721233-36721255 AAGAAATAGATTTTTTGGCCTGG + Intronic
1172887431 20:38240704-38240726 AAGAATGAGAATTTGAGCCCAGG + Exonic
1172937705 20:38632257-38632279 AAAAAAAAAAAATTTAGGCCGGG - Intronic
1172961019 20:38799721-38799743 AAGAACCACAAGTTCAGGCCAGG + Intergenic
1173207965 20:41009144-41009166 TAGAAACAGGATTTTACGGCCGG - Intergenic
1173525600 20:43730184-43730206 AAAAAATATTATTTTAGGCCAGG - Intergenic
1173531030 20:43769664-43769686 AAGATCCAGAATTTAAGCCCAGG - Intergenic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1173767170 20:45623163-45623185 AAGAAAAACAAAATTAGGCCAGG + Intronic
1174243145 20:49154568-49154590 AAGAAACACAATTCCTGGCCAGG + Intronic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174613835 20:51820669-51820691 AAGAAACAGGTTTATGGGCCGGG + Intergenic
1174617952 20:51850952-51850974 ATGAAACACATTTTAAGGCCGGG + Intergenic
1174638475 20:52022225-52022247 AAGAAACAGGAAAATAGGCCAGG - Intergenic
1174672558 20:52321775-52321797 AAGAAACAGACACTTAGGTCAGG - Intergenic
1174820157 20:53719617-53719639 AAGAAACACAATTTTGGAGCTGG + Intergenic
1174826943 20:53776995-53777017 ACAAAACAAAAATTTAGGCCAGG + Intergenic
1175058077 20:56216388-56216410 AAGAAATAGAATTTTCAGCCAGG + Intergenic
1175103590 20:56597750-56597772 AAGAAAAAGTGTTTAAGGCCAGG - Intergenic
1175647006 20:60683487-60683509 CAGAAACAGAATTTGAATCCAGG - Intergenic
1176006780 20:62869277-62869299 AAAAAAAAGAATTTTGGGCTGGG - Intergenic
1176137980 20:63533359-63533381 ATAAAAGAAAATTTTAGGCCGGG - Intronic
1176279656 20:64293105-64293127 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1176606350 21:8836353-8836375 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1176807741 21:13505000-13505022 AAGAAATAAAATAATAGGCCAGG - Intergenic
1176897014 21:14391838-14391860 GAGAAACAGATTTTTAAACCAGG - Intergenic
1176912389 21:14581653-14581675 AAGAAATATTATTTTTGGCCAGG - Intronic
1176988855 21:15469972-15469994 AAGGAGTAGAATTTTAGGTCAGG + Intergenic
1177238451 21:18424010-18424032 AAGAAAGAGAAGTTTCAGCCTGG + Intronic
1177249671 21:18576624-18576646 AAGAACCAGAATGTTAAGTCTGG - Intergenic
1177461305 21:21414762-21414784 AAGAAATACAATTTGTGGCCGGG - Intronic
1177543841 21:22530790-22530812 AAAAAAAAGAATGTTAGGCTGGG + Intergenic
1177910100 21:27020165-27020187 AAAAAACATTATTTTTGGCCAGG + Intergenic
1178111301 21:29372747-29372769 AAAAAAAAAAATTTTAGGTCTGG - Intronic
1178149872 21:29781963-29781985 TAGAAACAGTAGGTTAGGCCGGG - Intronic
1178448759 21:32671760-32671782 AAGAAAGGGCATTTTAGGCCAGG + Intronic
1178528691 21:33356260-33356282 ATGAAACAGAATGTTAGGAATGG - Exonic
1178841919 21:36144635-36144657 AAATAAAAAAATTTTAGGCCAGG + Intronic
1178841938 21:36144806-36144828 AAATAAAAAAATTTTAGGCCAGG + Intronic
1178964487 21:37103296-37103318 AAGAAAGAGAGTTCTAGTCCAGG - Intronic
1179020405 21:37635511-37635533 AAAAAACAAAATAATAGGCCAGG - Intronic
1179520697 21:41942565-41942587 AAGAAACAGACTCTTGGGGCAGG + Intronic
1179665585 21:42910028-42910050 TAGAAACAGGAGTTTTGGCCAGG + Intronic
1179772803 21:43635942-43635964 AAAAAACAGAATCATAGGCCAGG + Intronic
1180356424 22:11846053-11846075 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1180381837 22:12146273-12146295 AAGAAATAGAATTTAAGGGCCGG - Intergenic
1180795044 22:18599239-18599261 AAAAAACATATTTTTTGGCCGGG - Intergenic
1180941564 22:19662651-19662673 AAAGATAAGAATTTTAGGCCAGG - Intergenic
1181101610 22:20544368-20544390 AAAGAACAGAAATTTAGGCCGGG + Intronic
1181226694 22:21396077-21396099 AAAAAACATATTTTTTGGCCGGG + Intergenic
1181251955 22:21538775-21538797 AAAAAACATATTTTTTGGCCGGG - Intergenic
1181302834 22:21893590-21893612 TAGAAAAAGTTTTTTAGGCCAGG - Intergenic
1181327587 22:22061771-22061793 TGGAAACAGCTTTTTAGGCCAGG + Intergenic
1181875521 22:25937571-25937593 AAAAAAAAGAATGTCAGGCCAGG - Intronic
1182206588 22:28634213-28634235 AAGAAACAGAAATTTCTGGCCGG + Intronic
1182327434 22:29524415-29524437 AGGAAACAGATTCTGAGGCCAGG + Intronic
1182328688 22:29534657-29534679 AATAAAAAGCATTTTAGGCTGGG + Intronic
1182328732 22:29534971-29534993 AAAAAAAAGCATTTTAGGCCGGG + Intronic
1182369760 22:29802503-29802525 AATAAAAAAAATTTAAGGCCGGG + Intronic
1182381056 22:29888340-29888362 AAAAAACAACCTTTTAGGCCAGG - Intronic
1182753961 22:32663591-32663613 AAGAAAAAGAGGTTTAGGCTGGG - Intronic
1182967026 22:34532021-34532043 AGGAAACAGAAGCTTAGGGCTGG - Intergenic
1183049512 22:35249353-35249375 AAGAAAGAAAATTAAAGGCCAGG - Intergenic
1183159365 22:36101481-36101503 AAGAAAAAGAAGTTTAGGCTGGG - Intergenic
1183171957 22:36194883-36194905 AAGAAAAAGACTTTTGGCCCTGG + Intronic
1183206737 22:36424608-36424630 AAGAAACTGAAATTTAAGCAGGG - Intergenic
1183217872 22:36492811-36492833 AAGAAATACACTTTTAGGCCAGG - Intronic
1183307826 22:37092303-37092325 AAGAAAAAGAAATTCAGGCATGG - Intronic
1183397366 22:37579727-37579749 AAAAAACAGCATCTTGGGCCAGG - Intronic
1183519084 22:38286083-38286105 AAAAAAAAGAATTATAGACCAGG - Intergenic
1183527976 22:38335541-38335563 AATAAAAAGAATTATAGGGCCGG + Intronic
1183760784 22:39815157-39815179 AAGAAATACATTTTAAGGCCTGG + Intronic
1183894392 22:40956738-40956760 AAGAAACACACTCTTAGGCCAGG + Intronic
1183894443 22:40957050-40957072 AAGAAACATACTCTTAGGCGGGG + Intronic
1183988338 22:41581692-41581714 AAAATACAAAATATTAGGCCGGG + Intronic
1184207210 22:43012948-43012970 AAGATACAAAAATTAAGGCCGGG - Intronic
1184299340 22:43546573-43546595 AATAAAGAGATTTTCAGGCCGGG + Intronic
1184571298 22:45326529-45326551 AATAAAAAAAAATTTAGGCCGGG + Intronic
1184719273 22:46300389-46300411 TAAGAAAAGAATTTTAGGCCTGG - Intronic
1185362446 22:50416624-50416646 AAGAAAAAAAAGTGTAGGCCAGG - Intronic
949121976 3:396343-396365 TAAAAACAGAATTTAAGGCATGG + Intronic
949135746 3:562762-562784 AAGACATAAAAATTTAGGCCGGG - Intergenic
949994872 3:9608657-9608679 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
950079604 3:10211780-10211802 AAAAAATTGAAATTTAGGCCGGG + Intronic
950130798 3:10545232-10545254 AAGAAAACCATTTTTAGGCCGGG + Intronic
950234058 3:11303372-11303394 AAAAAAAAGAATTTTCCGCCAGG + Intronic
950384537 3:12647303-12647325 AAAAAAAAGAAATTCAGGCCAGG + Intronic
950733186 3:14980456-14980478 AAGAGTAAGAATTTTAGGCTGGG - Intronic
950951944 3:17009415-17009437 AAGAAGAACAATTTCAGGCCAGG - Intronic
951118737 3:18897499-18897521 AAGAAATAGAATTTTAGCAAAGG + Intergenic
951577199 3:24126095-24126117 TAAAAAAAGAATTCTAGGCCAGG + Intronic
952359134 3:32612134-32612156 AGTAAACAAAATATTAGGCCAGG - Intergenic
952571940 3:34728160-34728182 AAGATACTGAATATTAGGCAAGG + Intergenic
952703989 3:36358168-36358190 AAAAAAAAGAATCATAGGCCAGG - Intergenic
952775650 3:37043535-37043557 AAAAAAAAAAATTTGAGGCCAGG - Intronic
953046899 3:39301644-39301666 AAAAAACAAAATTTTGGGCTGGG + Intergenic
953068302 3:39495482-39495504 AAGAAAAGAAATTATAGGCCAGG + Intronic
953281113 3:41558407-41558429 TAGAAACACAACTCTAGGCCAGG + Intronic
953425385 3:42792682-42792704 AAAAAGTAGAGTTTTAGGCCAGG + Intronic
953646938 3:44763981-44764003 CAGAAAGGGAATCTTAGGCCAGG - Intronic
953671639 3:44967730-44967752 AAAAATCAGAATTTTAGAGCTGG + Intronic
953823379 3:46229512-46229534 AAGAAACTGAACTTAAGGACTGG + Intronic
954166170 3:48760060-48760082 AAAAAACAAAAATGTAGGCCAGG + Intronic
954183808 3:48901577-48901599 AAAAAAAAGAATTATGGGCCGGG + Intergenic
954252221 3:49376831-49376853 AAGAAACAGCATTCTTGGCTGGG + Intronic
954269517 3:49496653-49496675 AAGAAAAAAAAATTTAGGCCGGG - Intronic
954276661 3:49546530-49546552 AAGAAACAGCATTCTTGGCTGGG - Intergenic
954454377 3:50589599-50589621 TAAAAAAATAATTTTAGGCCGGG + Intergenic
954551997 3:51489491-51489513 AAGAAAAAGAAATATAGGCTGGG + Intronic
954571870 3:51647806-51647828 AAGGAAAAAAATTTTAGGCTGGG - Intronic
954811177 3:53249263-53249285 TAAAAACAAATTTTTAGGCCAGG - Intronic
954968410 3:54630904-54630926 AAAAAACACAATGATAGGCCAGG + Intronic
955061878 3:55499676-55499698 TAGAAATAAAATTTAAGGCCAGG + Intergenic
955147555 3:56335098-56335120 TAGAAATAGCATTTTAGGCTGGG - Intronic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
956611284 3:71126187-71126209 AAGAAAAGAAATTTTTGGCCGGG + Intronic
956825500 3:72994126-72994148 AAGAATTGGATTTTTAGGCCAGG + Intronic
956961446 3:74407248-74407270 AAAAAATAGAATATTTGGCCTGG - Intronic
957245258 3:77708478-77708500 AAGAAAAAGAATCCTAGGGCAGG + Intergenic
957350402 3:79017546-79017568 AAGAAACAGAAGTTGAGTCGTGG + Intronic
957724091 3:84042125-84042147 TAAAAACAGCATTTAAGGCCAGG - Intergenic
957848657 3:85775929-85775951 AAGAAACATAATTTTAGTACAGG + Intronic
958117687 3:89242730-89242752 AAGAAAGAAAATACTAGGCCAGG - Intronic
958926436 3:100162676-100162698 AAGAGACATACTTTCAGGCCAGG + Intronic
959164219 3:102757030-102757052 AAGAAACACAATTTTAAGAAGGG - Intergenic
959468201 3:106716053-106716075 AAGAAAAAGAGGTTTAGGCTGGG - Intergenic
959514652 3:107251163-107251185 ATGAAAAAGGGTTTTAGGCCAGG - Intergenic
959891945 3:111566847-111566869 AAAGAACAGAATTTTAGGGCAGG + Intronic
960094950 3:113680514-113680536 AAAAAACAAACTTTTTGGCCAGG + Intronic
960123092 3:113967365-113967387 AAGAAAGAGAAATGTAGGCAAGG - Intronic
960610214 3:119548739-119548761 AAGAAACAGAGTCCCAGGCCGGG + Intronic
960962039 3:123078101-123078123 AAGAACATTAATTTTAGGCCGGG - Intronic
961387209 3:126529469-126529491 CAGAAACAGAATTTGACCCCAGG - Intronic
961589558 3:127966608-127966630 GAGAAAGAGAAGTTGAGGCCAGG + Intronic
961839735 3:129699062-129699084 AGGAAAGAAACTTTTAGGCCAGG + Intronic
961923994 3:130456816-130456838 AAGAAAAAAAATTTTATCCCAGG - Intronic
961941759 3:130645571-130645593 AAGAAATACTATTTTTGGCCAGG - Intronic
962108137 3:132414779-132414801 AAGAAAAAAATATTTAGGCCGGG - Intergenic
962213716 3:133501822-133501844 AAGAAAGAGGATTCTGGGCCGGG + Intergenic
962225189 3:133600223-133600245 AAAAAAAAGAATTGCAGGCCAGG - Intronic
962300054 3:134231775-134231797 AAGAAACAGAACTTTGGGTAAGG - Intronic
962511240 3:136102680-136102702 AAGAAATAGGATTTTACACCAGG + Intronic
962544658 3:136420492-136420514 AACAATGGGAATTTTAGGCCTGG - Intronic
962593945 3:136920499-136920521 AAGAAACAGAATTATAGTTGAGG - Intronic
962780494 3:138710787-138710809 AAGAAAAAGTGTTTTAGGCTGGG + Intronic
962821135 3:139047939-139047961 AAGAAACTGAAGTTTAGGAGAGG - Intronic
963083946 3:141419689-141419711 ATGAAAGAGATTTGTAGGCCAGG + Intronic
963109947 3:141680188-141680210 AAGAAATACATTTTTTGGCCAGG + Intergenic
963111184 3:141689430-141689452 ATTAAAAAGTATTTTAGGCCAGG - Intergenic
963125659 3:141813420-141813442 CAAAAATAGATTTTTAGGCCGGG - Intronic
963594165 3:147304190-147304212 ATTAAACAGAATTTCAGGGCTGG - Intergenic
964110310 3:153080419-153080441 TAAAAACATAATTTTGGGCCGGG - Intergenic
964116615 3:153142493-153142515 AAAAAACATAATTACAGGCCAGG + Intergenic
964297375 3:155248763-155248785 AAGAACCAGGATTTAAGGCAAGG - Intergenic
964359051 3:155875211-155875233 AAAACACAGGATTTAAGGCCAGG - Intronic
964847671 3:161061344-161061366 TAGCAACAGAATCTTAGACCTGG - Intronic
964867013 3:161273019-161273041 AAGAAAAAGAATTTATGGGCCGG - Intergenic
965255377 3:166400324-166400346 ATGAAAGAGAATTTTAGGCCTGG + Intergenic
965645203 3:170872824-170872846 ATAAAACTGTATTTTAGGCCGGG - Intergenic
965755862 3:172026365-172026387 AAGAGAAACAATTCTAGGCCGGG - Intergenic
965935333 3:174102615-174102637 GAAGAACAGAATTTTAGGCACGG + Intronic
965944806 3:174227016-174227038 ATTAAACATAATTTTAGGCCTGG + Intronic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
966038449 3:175449371-175449393 AAGAAAATTAATGTTAGGCCAGG - Intronic
966145794 3:176810522-176810544 CAGAAACAGAATTTGGAGCCTGG + Intergenic
966240300 3:177748427-177748449 AAGAATGAAAATTTTAGGCTGGG + Intergenic
966387985 3:179422329-179422351 ATAAAACAGAATATAAGGCCAGG + Intronic
966402490 3:179562284-179562306 AAAAAAAAAAATTTCAGGCCGGG - Intergenic
966546484 3:181155017-181155039 AAATAACAGAAATTTAGGCTAGG - Intergenic
966550111 3:181195289-181195311 TAGAAAAAGAATTTACGGCCAGG - Intergenic
966953852 3:184852720-184852742 AACAAACAGAGTTCTGGGCCTGG + Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
968018329 3:195359760-195359782 AAAACACAGTACTTTAGGCCAGG - Intronic
968189306 3:196655876-196655898 AAGAAACACATATTTAGGCCAGG + Intronic
968371831 3:198226415-198226437 AAAAAACAAAACTTGAGGCCTGG - Intergenic
968419539 4:472354-472376 AGGAAAATGAATTTTAGGGCTGG - Intronic
968822334 4:2864115-2864137 AAATAACAGAATTTATGGCCGGG + Intronic
968828895 4:2921421-2921443 AAAGAAAAGAATTTTCGGCCGGG - Intronic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
968865923 4:3211197-3211219 AAGATAAACAATTTTAGGCCGGG - Intronic
969049127 4:4360221-4360243 AATAAAAAGAGGTTTAGGCCGGG - Intronic
969514192 4:7637433-7637455 CTGAAACAGAATTTTAGACAGGG + Intronic
969695764 4:8733432-8733454 AAGAAAAAGAATACAAGGCCGGG + Intergenic
970329266 4:14962475-14962497 AAGAGAAGGTATTTTAGGCCTGG + Intergenic
970567991 4:17351240-17351262 AAGAAACAGAATCTATGGACAGG - Intergenic
970975571 4:22039460-22039482 AAAGAAAAGAATTTTCGGCCAGG - Intergenic
971093815 4:23375230-23375252 AGAAAACAGAATCTAAGGCCAGG + Intergenic
971431629 4:26574248-26574270 AAGAAAAAAAAAGTTAGGCCAGG + Intergenic
971582806 4:28364559-28364581 AAGAAAGTGAGTTTTAGGCCGGG + Intronic
971605960 4:28657938-28657960 TAGAAACAGAATTTAAAGCCGGG - Intergenic
971611888 4:28736373-28736395 AAGAAATGGAATTTCATGCCTGG + Intergenic
971783332 4:31067410-31067432 AAGAACCAGTATTTTAGTCTGGG + Intronic
971827870 4:31650404-31650426 AGGAACCAGGATTTTAGACCAGG - Intergenic
971836486 4:31770506-31770528 AAATAACAGAATTTAAGGGCAGG - Intergenic
971926463 4:33015349-33015371 AATTAACAGAATGTTAGGCCAGG - Intergenic
972218173 4:36920669-36920691 ATGAAACAAAACTATAGGCCGGG - Intergenic
972499288 4:39662496-39662518 AAAAAAAAAAATTATAGGCCGGG - Intergenic
972672372 4:41226096-41226118 AAGATAGTCAATTTTAGGCCGGG + Intergenic
973371759 4:49254812-49254834 AAGAAATAGAATTTAAGGGCCGG - Intergenic
973389246 4:49540504-49540526 AAGAAATAGAATTTAAGGGATGG + Intergenic
973752035 4:54030826-54030848 AAGAATTAGCATTTTAGGCCAGG - Intronic
973889031 4:55351061-55351083 AAAAAAAAAAAATTTAGGCCAGG - Intronic
974004102 4:56538511-56538533 AGAAAACATTATTTTAGGCCGGG + Intronic
974046014 4:56899135-56899157 AATAAATAGAACTATAGGCCAGG - Intergenic
974160673 4:58133964-58133986 AAAATACAGCATTTTAGGCCAGG + Intergenic
974165687 4:58198647-58198669 AAGAAATAGAGTTTTAAGGCCGG - Intergenic
974459673 4:62171336-62171358 AAATAAAAGAATTTTAGGCAGGG + Intergenic
974556360 4:63453717-63453739 AAGAAACATAACTTTTGGCCGGG - Intergenic
974713425 4:65633572-65633594 AAGAAAAATAACTTTAGGCCTGG + Intronic
975177286 4:71302383-71302405 GAGTCACAGAATTTTAGGTCTGG - Intronic
975337502 4:73196291-73196313 AAGCAACAGAAACTAAGGCCAGG - Intronic
975381805 4:73709118-73709140 AAGAACGACAATTTTTGGCCAGG + Intergenic
975464220 4:74691364-74691386 GAGATACAGAATATGAGGCCTGG - Intergenic
975608382 4:76179347-76179369 AAGAAAAAAAACTTGAGGCCGGG - Intronic
975665566 4:76731801-76731823 AACAAACAGAAATTTAAGCTTGG + Intronic
975780106 4:77829697-77829719 ATGAAAACTAATTTTAGGCCAGG - Intergenic
975877559 4:78860969-78860991 AAGACACAGAATGTAAGGCCTGG - Intronic
976099748 4:81548827-81548849 AAGAATCAGAAATTTAGGACTGG - Intronic
976597331 4:86906430-86906452 AAGAATCAGCTTTTTAGGCCAGG + Intronic
976704226 4:88005171-88005193 AAGATTCAGAATTTCAGGACTGG + Intergenic
976749110 4:88436100-88436122 AAGAAACAGGAGTTCTGGCCTGG + Intronic
977087495 4:92621004-92621026 AAAAAAAAGAATTTTAACCCAGG + Intronic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
977582633 4:98742372-98742394 CAGAAAAAGAATTTTAGGCTGGG - Intergenic
977860688 4:101956314-101956336 AAGAAACAAAATGATATGCCCGG - Intronic
978148170 4:105402256-105402278 AAGAAAAAAAAAATTAGGCCTGG + Intronic
978448727 4:108805830-108805852 AAAAAAAAAAATTTCAGGCCAGG + Intergenic
978523060 4:109636537-109636559 AAGAAAGAGAATGTTTGGCCGGG + Intronic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
979050781 4:115928874-115928896 AAGAAAAAGAGGCTTAGGCCAGG + Intergenic
979260521 4:118638891-118638913 AAAAAACAAAACTTGAGGCCTGG - Intergenic
979537417 4:121839269-121839291 AAGACCAATAATTTTAGGCCGGG + Intronic
979892081 4:126110563-126110585 AAAAAAGATAATTTTAAGCCGGG - Intergenic
980117790 4:128696337-128696359 AATAAAAACTATTTTAGGCCAGG - Intergenic
980255041 4:130368946-130368968 AAGAAACATATATGTAGGCCTGG + Intergenic
980502182 4:133670359-133670381 AAAAATCATAATTCTAGGCCAGG - Intergenic
980730185 4:136813106-136813128 AAGAAAATCACTTTTAGGCCGGG + Intergenic
980787904 4:137578431-137578453 TAATAACAGAATTTTAGGCTGGG - Intergenic
980880244 4:138702694-138702716 CAGAAACAGACTGTTTGGCCAGG + Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981477644 4:145203783-145203805 TTGAAAAATAATTTTAGGCCGGG + Intergenic
981546638 4:145900703-145900725 ATAAAATAAAATTTTAGGCCGGG - Intronic
981616108 4:146646622-146646644 AACAAACAGATTATTAGGCCAGG - Intergenic
981706875 4:147669091-147669113 AAAAAAAAGTATTTTTGGCCAGG + Intronic
981817025 4:148842683-148842705 AAGAAATAGAATTTCAGCCAGGG - Intergenic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
981977346 4:150746803-150746825 AAGAAAAACAACTTTTGGCCGGG - Intronic
982017417 4:151168726-151168748 AAGAAATAGCACTTCAGGCCAGG - Intronic
982211726 4:153042408-153042430 AATAAAAGCAATTTTAGGCCAGG - Intergenic
982361880 4:154527370-154527392 AAGAAAAAGAAAATTAAGCCAGG + Intergenic
982367222 4:154592652-154592674 AGGAAGCAGAATTTGAGGCAAGG - Intergenic
982570751 4:157048297-157048319 AAGAAACAGAATTTCAGAGAAGG - Intergenic
982891986 4:160866495-160866517 AAGAAAGAGATTATTAGGCAGGG - Intergenic
983067659 4:163229766-163229788 AAAGAATAGATTTTTAGGCCAGG + Intergenic
983540611 4:168905441-168905463 TAGAAACAGAGTCTCAGGCCGGG - Intronic
983579055 4:169289421-169289443 AAGAAAAAATATTCTAGGCCAGG - Intergenic
983924119 4:173378828-173378850 TAGAAACACATTTTGAGGCCGGG + Intergenic
984329970 4:178302287-178302309 AAAAAATGAAATTTTAGGCCGGG + Intergenic
984433292 4:179676152-179676174 AAAAAACATAAATTTAGGCTGGG - Intergenic
984471241 4:180177086-180177108 AAGAAACAGCAGTTGAGGCCAGG - Intergenic
984524546 4:180842592-180842614 TAAAAACACAATTTCAGGCCTGG + Intergenic
984612580 4:181857417-181857439 AAGAGACTGGATTTTTGGCCAGG + Intergenic
984968072 4:185158529-185158551 TAGTAAAAGAATTTGAGGCCGGG - Intergenic
985032720 4:185806751-185806773 CAAAAACAGGATTCTAGGCCGGG - Intronic
985042708 4:185907493-185907515 AAGAAACACATTTTGTGGCCTGG + Intronic
985221422 4:187709814-187709836 AAAAAAAAAAATTTGAGGCCAGG + Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985278691 4:188265975-188265997 TAGAAAGAGAAGTTCAGGCCAGG - Intergenic
985283062 4:188306156-188306178 AAGAAAAAAAAGTTTTGGCCGGG + Intergenic
985661537 5:1159531-1159553 TAGAAGCAGAATTTAAGACCTGG - Intergenic
985857082 5:2436836-2436858 AAAAATCTGAAATTTAGGCCGGG - Intergenic
986001795 5:3636147-3636169 AAGAACCACAATTTTCGGCCAGG - Intergenic
986346043 5:6836422-6836444 AGGAAATTGAATTTTAGACCTGG - Intergenic
986695280 5:10349687-10349709 AAAAAAAAAAATTTTTGGCCTGG + Intergenic
986918041 5:12648362-12648384 AAGAAAAAGAGGTTTCGGCCGGG - Intergenic
987105250 5:14632382-14632404 AAGAGACAGAAAATTAGACCAGG - Intergenic
987227044 5:15853120-15853142 AAGAGCCAGAATTTGAGCCCAGG + Intronic
987272821 5:16329666-16329688 GAAAAATAGAATTTTGGGCCAGG - Intergenic
987322911 5:16786871-16786893 AAAAAAAAAAATTTTTGGCCGGG + Intronic
987388094 5:17349228-17349250 AAGAGCCAGAATATAAGGCCTGG - Intergenic
987770674 5:22299657-22299679 AAGTTACAGAAATTTAGACCTGG - Intronic
987867525 5:23564565-23564587 ATGAAACAGAATATGAGGCAAGG + Intergenic
988233749 5:28511558-28511580 AAGAAACAGAATTTTATAATTGG + Intergenic
988570276 5:32358363-32358385 AAAAAAGAAAATTTAAGGCCGGG + Intronic
988670168 5:33372626-33372648 TAAAGACAGATTTTTAGGCCAGG - Intergenic
989033668 5:37146470-37146492 AAAAAATAGTCTTTTAGGCCGGG - Intronic
989082382 5:37637044-37637066 AAAATGAAGAATTTTAGGCCAGG + Intronic
989238278 5:39174650-39174672 GAAAAACAGGATTTTAGTCCGGG - Intronic
990040145 5:51369812-51369834 AAAAAAAAGAAGTTGAGGCCAGG - Intergenic
990125138 5:52507495-52507517 AACTAACAGAATTTGTGGCCAGG - Intergenic
990406870 5:55500372-55500394 AACATAAATAATTTTAGGCCAGG - Intronic
990574118 5:57108433-57108455 GAGATTAAGAATTTTAGGCCAGG + Intergenic
990579167 5:57151525-57151547 AAGAAAGAGACTTTAAGGCCGGG + Intergenic
990976759 5:61567645-61567667 AAGAAATAGCATTCTAGGCTGGG - Intergenic
991063081 5:62399169-62399191 AAAATACAAAATATTAGGCCAGG + Intronic
991356411 5:65773645-65773667 AAGAAACTCAATATTTGGCCAGG + Intronic
991477826 5:67042264-67042286 GGGTAACAGAATTTTAGGTCTGG - Intronic
991708704 5:69385253-69385275 AAAAAAAAAGATTTTAGGCCAGG - Intronic
991713184 5:69428204-69428226 AATAAAAAAAAATTTAGGCCGGG + Intronic
992257668 5:74937501-74937523 AAAAAACAGACTTTAGGGCCAGG - Intergenic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992635800 5:78725001-78725023 AAGAAAAATAGTTTCAGGCCAGG + Intronic
992718977 5:79540697-79540719 AAGAAAAAAAATTGTAGGCTAGG + Intergenic
992741451 5:79777474-79777496 TAAAAAAAAAATTTTAGGCCAGG + Intronic
992820333 5:80489627-80489649 AAAAAACAAATTTTTGGGCCGGG + Intronic
992883304 5:81131648-81131670 AAGAAAAAGAGATTGAGGCCAGG - Intronic
992905436 5:81340653-81340675 AAGAATCATACTTTTGGGCCAGG - Intronic
992983393 5:82201178-82201200 AAAAAATATATTTTTAGGCCGGG - Intronic
993318495 5:86441996-86442018 AAGAACCAGAAATTGAGCCCAGG + Intergenic
993463744 5:88218762-88218784 CAAAAACATAATTTTCGGCCTGG + Intronic
993640836 5:90403574-90403596 AAAAATCACAATTTTTGGCCGGG + Intronic
994336657 5:98575062-98575084 TAGAAACAGAATTTGTGTCCAGG + Intergenic
994371179 5:98969408-98969430 AAAAAAAAAAAGTTTAGGCCGGG - Intergenic
994415147 5:99460151-99460173 AAGAAACATAAAATTTGGCCTGG - Intergenic
994477171 5:100286102-100286124 AAAACATAGAATATTAGGCCAGG - Intergenic
994539240 5:101074187-101074209 AAGAAATAGAATTTTAAGGATGG + Intergenic
994741777 5:103628261-103628283 AAGAAATGGAATTTTGGGCTGGG + Intergenic
994797092 5:104317510-104317532 AAGAAATAGCACTTGAGGCCAGG - Intergenic
994964304 5:106648171-106648193 AGGGAACAGATGTTTAGGCCGGG + Intergenic
995036146 5:107536809-107536831 AAGAAGTAGATTTTTCGGCCGGG + Intronic
995075282 5:107976150-107976172 ATAAGACAGACTTTTAGGCCAGG - Intronic
995149033 5:108820828-108820850 AAATAACAGAGTCTTAGGCCAGG + Intronic
995221516 5:109653935-109653957 AAGAAACAGAAATTCAGGAAAGG - Intergenic
995385836 5:111587904-111587926 AAGAAACAGAATCTTATATCTGG - Intergenic
995505001 5:112851188-112851210 ATGAAACAAAATTACAGGCCGGG - Intronic
996189787 5:120525922-120525944 AAGAAACAACATTTTTGGACAGG + Intronic
996196994 5:120620951-120620973 GAGAAAGAGAATTATGGGCCTGG - Intronic
996411018 5:123159260-123159282 AAGAGACAGATATTTAGCCCAGG - Intronic
996560795 5:124826900-124826922 AATAAAAATATTTTTAGGCCAGG - Intergenic
996649763 5:125860974-125860996 AGGAAACAGACTCTTAGGCAAGG - Intergenic
996700086 5:126442259-126442281 AAGAAAAAGCATTTTAGGGAGGG - Intronic
996700140 5:126442585-126442607 TAGGAAAAGCATTTTAGGCCAGG - Intronic
997078844 5:130714679-130714701 GAGAAACAGAATTCAAGTCCAGG - Intergenic
997114159 5:131108292-131108314 TAGAAACAAAATTTTAGAACTGG + Intergenic
997257215 5:132438270-132438292 TAGAAATATAATTTTAGGTCAGG + Intronic
997324415 5:133008242-133008264 AAGAATCAGAAAATCAGGCCGGG + Intronic
997541695 5:134668428-134668450 AAAATACAGAAATTAAGGCCAGG + Intronic
997650454 5:135513752-135513774 AAGATACAGTATTATAGGCCAGG - Intergenic
997829963 5:137141053-137141075 TAGAAATAGAAATTAAGGCCCGG - Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
997978854 5:138456717-138456739 AATAATTAAAATTTTAGGCCAGG + Intergenic
998117036 5:139546020-139546042 AAGAAATAGAATTTAAGGCCAGG - Intronic
998117142 5:139546779-139546801 AAGAAAGAAAATTTAAGGCCAGG - Intronic
998239709 5:140429079-140429101 AAAAAAAAAAATTCTAGGCCGGG - Intronic
998364994 5:141624238-141624260 AATATAAAAAATTTTAGGCCAGG + Intronic
998765984 5:145487828-145487850 AAGAAATGGAATTGGAGGCCGGG + Intronic
999050296 5:148516611-148516633 AAAAAAGGGAATTTTTGGCCAGG - Intronic
999247480 5:150162809-150162831 AAGAAAGAGAAACTTTGGCCCGG + Intergenic
999278050 5:150345412-150345434 AAAAAGAAAAATTTTAGGCCAGG - Intergenic
999792438 5:154953979-154954001 AAAAAAAAAAGTTTTAGGCCAGG - Intronic
1000083055 5:157865378-157865400 AAAAAACAATATTTAAGGCCGGG + Intergenic
1000143072 5:158425644-158425666 AAAAACCACAATTTGAGGCCAGG + Intergenic
1000415297 5:160977966-160977988 TAGAATCAGAATTTTAATCCAGG + Intergenic
1000528770 5:162392072-162392094 AAGAGACAGAATTTTAATCAGGG + Intergenic
1000789437 5:165587110-165587132 AAGGAAGAGAATTTTAGTCTAGG + Intergenic
1000882696 5:166716017-166716039 AAAGAAAAGAGTTTTAGGCCGGG + Intergenic
1000927084 5:167207134-167207156 AAGAATCTGAATTTTAGAACTGG - Intergenic
1000983512 5:167842291-167842313 AACAAAAAAAACTTTAGGCCAGG + Intronic
1001043701 5:168355196-168355218 AAAAAACAGCATTTCAGGCTGGG + Intronic
1001141651 5:169149384-169149406 CAGGAACAGAATTTTAGAGCTGG - Intronic
1001584548 5:172824610-172824632 TATAAAAATAATTTTAGGCCTGG - Intergenic
1001857363 5:175024757-175024779 AAGAAAAACAACTTTCGGCCAGG - Intergenic
1002110832 5:176910792-176910814 AAGAAAAAGAAATTCAGGGCTGG + Intronic
1002353550 5:178604199-178604221 TGAAAACAGAATTTTAGGACTGG - Intronic
1002396644 5:178961518-178961540 AATTAACAGCATTTTTGGCCAGG + Intronic
1002658078 5:180769480-180769502 TAGAATCAATATTTTAGGCCAGG + Intergenic
1002731072 5:181331961-181331983 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1002753462 6:142143-142165 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1002839680 6:894951-894973 AAGAGTCAGAATTTGAGCCCAGG - Intergenic
1002965190 6:1958099-1958121 AAAAAACATATTTTAAGGCCAGG - Intronic
1003064912 6:2895803-2895825 AAAAAAAAGAAGTTTAGGCTGGG + Intronic
1003364289 6:5457672-5457694 AATAAACAGAATTTAATTCCTGG + Intronic
1003528484 6:6918055-6918077 AAATAATAGTATTTTAGGCCTGG - Intergenic
1003579006 6:7322507-7322529 AAAGAACAGAAATTTAGGACGGG - Intronic
1003606328 6:7564847-7564869 AATAAAAAAAATTTAAGGCCAGG + Intronic
1003932989 6:10945007-10945029 AATAAAAAATATTTTAGGCCGGG - Intronic
1004177064 6:13349251-13349273 AAGAATCACAGTTTTAGGCTGGG - Intergenic
1004378848 6:15114934-15114956 CAGAAATAGAGTTATAGGCCAGG + Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1004600277 6:17143206-17143228 ATGAAACAGAATTTAGGGCTGGG - Intergenic
1004683347 6:17918006-17918028 AGGAAACAGAATTCCAGGACAGG - Intronic
1004693499 6:18012526-18012548 AAAAAAAAGTATTTTAGGTCGGG - Intergenic
1004847157 6:19656876-19656898 AAGAAACATAATTCTAGGCCGGG - Intergenic
1004970164 6:20901377-20901399 AAGAAACAGCTTTAGAGGCCAGG + Intronic
1005343304 6:24864004-24864026 AAAAAACATTATTCTAGGCCGGG + Intronic
1005359142 6:25014118-25014140 GGGAAACAGAATTTTAGGCCTGG + Intronic
1005720361 6:28595425-28595447 AATAAAGAAAATTCTAGGCCAGG + Intronic
1005955973 6:30663729-30663751 AAAAAAAAAAATTTCAGGCCAGG + Intronic
1006015106 6:31074513-31074535 ATCAAACAGAGTTTTAGGACTGG + Intergenic
1006099012 6:31674134-31674156 AAGAAAAGAAACTTTAGGCCAGG + Intergenic
1006120424 6:31801497-31801519 AAGAGAAAGAACTTTTGGCCAGG + Intronic
1006280686 6:33050699-33050721 AAGACACTTGATTTTAGGCCTGG - Intergenic
1006345313 6:33476476-33476498 AAAAATTAAAATTTTAGGCCGGG + Intergenic
1006453483 6:34119098-34119120 AAGAAACAGATGATGAGGCCGGG + Intronic
1006551476 6:34827015-34827037 AAGAAAGAGAAAAATAGGCCGGG + Intronic
1006591260 6:35159532-35159554 AACAAAAAGTATTCTAGGCCGGG - Intergenic
1006944372 6:37775248-37775270 AAAAAAAAAAATCTTAGGCCAGG - Intergenic
1006946695 6:37789316-37789338 AAGAAAAAAATTTGTAGGCCAGG + Intergenic
1006949706 6:37811408-37811430 TAGGAAAAGAATTTCAGGCCGGG - Intergenic
1007200244 6:40101792-40101814 AAGAGAGAGAACTATAGGCCTGG - Intergenic
1007404310 6:41624930-41624952 AATAAAAAGAATAATAGGCCAGG - Intergenic
1007520515 6:42448616-42448638 AAGACACAGAATTTCAGAGCCGG + Intronic
1008047918 6:46870453-46870475 AAGAATAAGATTTTTAGGCCAGG - Intronic
1008295685 6:49773129-49773151 TAGAAACAGATATTTAGGCTGGG + Intergenic
1008740237 6:54598018-54598040 AAGAAAACAAATTTTAGGCTGGG + Intergenic
1009240742 6:61183399-61183421 AAGAAATACATTTTGAGGCCGGG + Intergenic
1009425518 6:63509358-63509380 AAAAAATAGTATTTTTGGCCAGG - Intergenic
1009435622 6:63614823-63614845 TAGAAAAAAAATTTTAGGCTGGG - Intergenic
1009944267 6:70324567-70324589 TAGAAAGAGCATATTAGGCCAGG + Intergenic
1010138846 6:72588559-72588581 AAGAAACAGAAAGTTAAGCCGGG - Intergenic
1010220287 6:73442890-73442912 ACAAAAAAAAATTTTAGGCCAGG - Intronic
1010233349 6:73554667-73554689 AAAAAACATAATTTATGGCCGGG - Intergenic
1010383318 6:75248955-75248977 AAAAGACAGAATTTTGGGCCGGG + Intronic
1010881487 6:81178924-81178946 AAAAAAAAAAAATTTAGGCCAGG + Intergenic
1010983757 6:82398857-82398879 AAAAAACAAAATTTTAGGTCAGG - Intergenic
1011073602 6:83413303-83413325 AACAAAGAATATTTTAGGCCAGG + Intronic
1011080189 6:83481766-83481788 AAGACACAAAATTTAAGGCTGGG + Intergenic
1011289840 6:85765641-85765663 AAAAAACAGGAATTTAGGCCTGG + Intergenic
1011433329 6:87311600-87311622 ATGACACAGTATTTTAGGACTGG + Intronic
1011480830 6:87792081-87792103 TAGAAACAAAAGCTTAGGCCGGG - Intergenic
1011583643 6:88900844-88900866 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1011683428 6:89804734-89804756 AAAATACAAAATTCTAGGCCGGG + Intronic
1011687416 6:89834721-89834743 AAAAAACAAATTTTGAGGCCAGG - Intronic
1012179243 6:96130170-96130192 AAGAAAAAGAATCTTAGACAAGG + Intronic
1012387772 6:98701655-98701677 AAGAATGGGCATTTTAGGCCAGG - Intergenic
1012773479 6:103473004-103473026 AAGAAACAAAATTTTAACTCAGG + Intergenic
1012912251 6:105131709-105131731 CAGAAAGAGAAATCTAGGCCAGG - Intronic
1013136704 6:107289393-107289415 AAGAAAAAGAAATGGAGGCCAGG + Intronic
1013162448 6:107558561-107558583 AAGAACTAGATCTTTAGGCCGGG - Intronic
1013194684 6:107834648-107834670 AAGAAAAAGAATTTGGAGCCAGG + Intergenic
1013442373 6:110183371-110183393 AAGAATCAGAATTTTAGAGCTGG + Intronic
1013517655 6:110903054-110903076 TAAAAACAGAAGTCTAGGCCAGG - Intergenic
1013735562 6:113222766-113222788 ATGAAACAAAAATTCAGGCCGGG + Intergenic
1013815831 6:114096109-114096131 AAGAAGGATAATTTTAGGCAAGG + Intronic
1014018303 6:116560141-116560163 TAGGAACAGAATTTTAGAACTGG - Intergenic
1014040363 6:116818237-116818259 AAAGAAAAGAATTTTCGGCCGGG + Intronic
1014099767 6:117499105-117499127 AATTAAAAGAATTTTAGGCTAGG + Intronic
1014150624 6:118050580-118050602 GAGAAAGAGAGTTTTAGGCAGGG + Intronic
1014225101 6:118838714-118838736 AAAGAAAAGAATTTTCGGCCGGG - Intronic
1014706303 6:124751681-124751703 AAAAGACAGAGATTTAGGCCAGG + Intronic
1014757944 6:125322741-125322763 ATGAAACAAAAGTTTAGGCCAGG - Intergenic
1014809149 6:125866032-125866054 AAGACATATAACTTTAGGCCGGG + Intronic
1015069833 6:129078428-129078450 AAGATACAGAGATTTTGGCCAGG - Intronic
1015098512 6:129446664-129446686 AAAAAACAGAATTTTTGACATGG - Intronic
1015301502 6:131657866-131657888 CAGAAGTAAAATTTTAGGCCAGG + Intronic
1015379518 6:132550858-132550880 CATAAAAAGAATTTCAGGCCTGG - Intergenic
1015875624 6:137819085-137819107 TAAAAAAAGAATTTTAGGCTGGG + Intergenic
1015980113 6:138830017-138830039 AAAACACAGAAATTTAGGCTGGG - Intronic
1016439573 6:144069250-144069272 AAGAAAAAGAGGTTTAGGCCAGG + Intergenic
1016667090 6:146654645-146654667 AATATACACAATTTTTGGCCAGG - Intronic
1016819599 6:148335000-148335022 GAAAAAAAGAATTTGAGGCCGGG + Intronic
1016975515 6:149803810-149803832 AAAAAAAAGCATTTTAGTCCAGG + Intronic
1017136221 6:151149908-151149930 AAGAAAGAGAACATTAGGCTGGG + Intergenic
1017591431 6:155982070-155982092 AAGAAACAGAACTGAAGGACGGG + Intergenic
1017679792 6:156852150-156852172 AAAAAAAAAAATTTGAGGCCGGG + Intronic
1018196237 6:161358312-161358334 AACAAACAAAAATTAAGGCCGGG + Intronic
1018528389 6:164737403-164737425 AAGAAAAAGAAGTTTAGGGCCGG - Intergenic
1018631088 6:165823125-165823147 AAAAAAAAAAATTATAGGCCGGG - Intronic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1018911602 6:168103793-168103815 AAGATAAAAAATTTTATGCCTGG + Intergenic
1019090601 6:169528820-169528842 AATAAAAATTATTTTAGGCCAGG - Intronic
1019479302 7:1259223-1259245 ATAAAACACATTTTTAGGCCGGG - Intergenic
1019534238 7:1520237-1520259 AAGAAAGAATGTTTTAGGCCAGG - Intergenic
1019837478 7:3403227-3403249 AAGAAACAGAAGTATAGGTCAGG - Intronic
1019850511 7:3551834-3551856 AACAAAAAAAAATTTAGGCCAGG - Intronic
1020052543 7:5091475-5091497 AAAAACCAGTACTTTAGGCCGGG + Intergenic
1020178735 7:5904535-5904557 AAAAAAAAAAATTTTTGGCCAGG + Intronic
1020220190 7:6230499-6230521 AAGACACAGAATTTTAAGTCTGG - Intronic
1020227882 7:6294453-6294475 AAGAAAAAGAGGTTTAGGCTGGG - Intergenic
1020304193 7:6820470-6820492 AAAAAAAAAAATTTTTGGCCAGG - Intronic
1020339625 7:7095871-7095893 AATAAACAAAAATTAAGGCCAGG - Intergenic
1020611625 7:10404388-10404410 CAGTAATAGAATTTCAGGCCAGG - Intergenic
1020725037 7:11801491-11801513 CAGAAACAAAATTTTAACCCTGG + Intronic
1020875731 7:13691392-13691414 AAGGACCTGAATTTGAGGCCTGG + Intergenic
1021726605 7:23553281-23553303 ATAAAACAGTTTTTTAGGCCAGG + Intergenic
1021739717 7:23673986-23674008 ATTAAAAAAAATTTTAGGCCAGG - Intergenic
1022110960 7:27231263-27231285 AAAATACAAAAATTTAGGCCAGG + Intergenic
1022166042 7:27763469-27763491 AAGAATCAGACCTTGAGGCCGGG + Intronic
1022194749 7:28053976-28053998 AAGAAATTGAATTTTAATCCTGG - Intronic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022220704 7:28310996-28311018 AAGAATAAATATTTTAGGCCAGG + Intronic
1022325907 7:29331764-29331786 AAGAAATACAATTTGGGGCCAGG + Intronic
1022479876 7:30735911-30735933 AAGGAACAGGATTTTGGTCCTGG + Intronic
1022490038 7:30809880-30809902 AAGAAAGAAATGTTTAGGCCGGG + Intronic
1022543763 7:31165653-31165675 AAGAAACAACCTTTCAGGCCTGG - Intergenic
1022565349 7:31394396-31394418 AAGAAAAACAAGTATAGGCCGGG - Intergenic
1022608854 7:31847932-31847954 AAGAGAGAGATTTGTAGGCCAGG - Intronic
1022674466 7:32485621-32485643 AATCAAGAAAATTTTAGGCCAGG + Exonic
1022687924 7:32613992-32614014 AAAAAAGAGAAATATAGGCCAGG + Intergenic
1022779174 7:33560643-33560665 AAGCAATAGTATTTTAGGACTGG + Intronic
1023181711 7:37491490-37491512 AAAAAACATAATTTTAGGCCGGG - Intergenic
1023402231 7:39798503-39798525 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1023447635 7:40248304-40248326 AAGAATCAAAACTATAGGCCGGG - Intronic
1023810711 7:43909429-43909451 AAAAACCAGTATTTTAGGCCAGG + Intronic
1023829956 7:44033362-44033384 TAGAAATGGAATTCTAGGCCGGG + Intergenic
1024647389 7:51382157-51382179 AACAAACAAAACTTGAGGCCTGG + Intergenic
1024813667 7:53243002-53243024 AAGAAACAAAAGTGGAGGCCGGG - Intergenic
1024909887 7:54435306-54435328 TAGAATCTGAAATTTAGGCCTGG + Intergenic
1024992631 7:55248203-55248225 AAAAAACAAAATTTTGGGCCGGG + Intronic
1025076861 7:55951332-55951354 AAAAAAAACACTTTTAGGCCAGG + Intergenic
1025159767 7:56646409-56646431 AAGCAGCATCATTTTAGGCCAGG + Intergenic
1025166640 7:56718323-56718345 AAGAAAAAGAAAATAAGGCCGGG + Intergenic
1025176569 7:56805210-56805232 AAAAAACAAAACTTGAGGCCTGG + Intergenic
1025695223 7:63771176-63771198 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1025726937 7:64072926-64072948 AAGAAGAATCATTTTAGGCCAGG - Intronic
1025728687 7:64090860-64090882 AACAAACAAAATTTAAGGCCAGG - Intronic
1025766963 7:64464537-64464559 AAGAAAAGTCATTTTAGGCCAGG + Intergenic
1025977826 7:66383244-66383266 GAAAAACAGAATAATAGGCCGGG - Intronic
1026036707 7:66835173-66835195 AAGAAAAAAACATTTAGGCCAGG + Intergenic
1026092266 7:67310140-67310162 ATGGAACAGAATTTAAAGCCAGG - Intergenic
1026338623 7:69416387-69416409 AAGAATGATTATTTTAGGCCAGG - Intergenic
1026368100 7:69670277-69670299 AAATCACAGAATTTTAGGGCTGG - Intronic
1026375147 7:69742690-69742712 AAGAAACTGATTCTTAGGACAGG - Intronic
1026572936 7:71547580-71547602 TTGAAACAGAATTTAAGGCTGGG - Intronic
1026606789 7:71823422-71823444 AAGAAACAGAGGCTTGGGCCGGG + Intronic
1026651738 7:72221928-72221950 AAAGAAAAGAGTTTTAGGCCAGG + Intronic
1026789361 7:73321682-73321704 AATATACAGAATTTTTGGCTTGG + Intronic
1026821616 7:73553376-73553398 AAGAAAAAGAAAACTAGGCCAGG + Intronic
1026855864 7:73754331-73754353 TAAAAAAAGAAATTTAGGCCGGG + Intergenic
1027024925 7:74844304-74844326 AGGTAAAAGAATTTTCGGCCAGG - Intronic
1027062839 7:75099815-75099837 AGGTAAAAGAATTTTCGGCCAGG + Intronic
1027298822 7:76808201-76808223 GAAAATCAGAATTTTAGTCCTGG - Intergenic
1027756040 7:82213194-82213216 AAGAACCAGGATATTGGGCCAGG - Intronic
1027768162 7:82372887-82372909 AATAAACACAATATCAGGCCAGG + Intronic
1027845858 7:83373909-83373931 TAGAAACTCAAATTTAGGCCGGG + Intronic
1027872300 7:83722987-83723009 AAGAAATGGAAATTGAGGCCAGG - Intergenic
1027964338 7:84986851-84986873 AAAAAAAAAAATTTTAGGTCAGG + Intergenic
1028762764 7:94513039-94513061 TAGAAACAGTAATTCAGGCCGGG + Intronic
1029417045 7:100449837-100449859 AAAAAAAATAATTTTAGGCCGGG - Intergenic
1029478309 7:100798384-100798406 AAAATACATAATTTTGGGCCAGG - Intergenic
1029700067 7:102240551-102240573 AAGAAATAAAAGTTCAGGCCAGG - Intronic
1029703825 7:102265058-102265080 AAGAAACAGACTGTGTGGCCGGG + Intronic
1029740270 7:102487634-102487656 TAGAAATGGAATTCTAGGCCGGG + Intronic
1029758266 7:102586808-102586830 TAGAAATGGAATTCTAGGCCGGG + Intronic
1029776204 7:102685886-102685908 TAGAAATGGAATTCTAGGCCGGG + Intergenic
1029792707 7:102862046-102862068 AAGAAACAGACGTTTTGGGCAGG + Intronic
1029863158 7:103597305-103597327 AAGAAAGAGTACTTGAGGCCAGG + Intronic
1029995694 7:105005929-105005951 AAAATACAGAACTTTTGGCCGGG + Intergenic
1030449924 7:109695675-109695697 AAGAAACAAATTTTTTGTCCAGG - Intergenic
1030539611 7:110813609-110813631 ATTAAACAATATTTTAGGCCAGG - Intronic
1031039791 7:116827284-116827306 AAGTGATAGAATTTTAGGCAGGG - Intronic
1031086894 7:117310933-117310955 AAGAAACTAAATTTTAGTCAAGG - Intronic
1031632667 7:124063092-124063114 AAATAAAAGAAGTTTAGGCCGGG - Intergenic
1031654167 7:124331833-124331855 AAGAAATAGAAATTTAGATCTGG + Intergenic
1031741873 7:125442723-125442745 AAAGAACAGAAATTTAGGGCCGG - Intergenic
1031848536 7:126834803-126834825 AAGAAACAGCATTATAGGCTGGG + Intronic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032071997 7:128813683-128813705 CATAAAAAGAATTCTAGGCCAGG + Intronic
1032146113 7:129382608-129382630 AAAAAAAATAATTTTAGGCAGGG + Intronic
1032170075 7:129577399-129577421 AAAAAATAGAATTATAGGCCAGG - Intergenic
1032269508 7:130390934-130390956 AAAAAAAACAATTTTAGGCTGGG + Intergenic
1032449688 7:132019248-132019270 AGGAAAAAGAACTTTAGGCCGGG - Intergenic
1032624141 7:133571377-133571399 AAAAAAGAGAAATTTAGGCCAGG + Intronic
1032653340 7:133902555-133902577 AACATAAAGAATTTTAGGGCCGG + Intronic
1032765440 7:134987067-134987089 AAGAAACTGAAGTTTCTGCCTGG - Intronic
1032834989 7:135663937-135663959 AAGATACAGCATTTGGGGCCGGG - Intronic
1033156309 7:138960079-138960101 GAGAAACAGAATTTGTGCCCTGG + Intronic
1033237439 7:139649369-139649391 AATAAACAAAATCTTAGGCTGGG - Intronic
1033286022 7:140041061-140041083 TAGAAATACAAGTTTAGGCCGGG - Intronic
1033290149 7:140076644-140076666 AAGAAGAGGAAATTTAGGCCAGG + Intergenic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033341907 7:140498782-140498804 AAAAAAAAAAATCTTAGGCCTGG + Intergenic
1033342433 7:140502563-140502585 AAAAAACAAAAAATTAGGCCGGG + Intergenic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034022034 7:147655106-147655128 AAGAAAAAGAAATATGGGCCAGG - Intronic
1034182944 7:149152552-149152574 AAAAAAAAGAAATCTAGGCCAGG - Intronic
1034253350 7:149710166-149710188 AAAAAAAAAAAATTTAGGCCAGG - Intergenic
1034443007 7:151096765-151096787 AAGAAAAGAAAATTTAGGCCAGG - Intronic
1034621134 7:152457923-152457945 AAAGAAAAGAAGTTTAGGCCGGG - Intergenic
1034633111 7:152546174-152546196 AAAAAAAAAAATCTTAGGCCAGG - Intergenic
1034720942 7:153292136-153292158 AAGAAAAAGAATAGGAGGCCAGG + Intergenic
1035209147 7:157314915-157314937 AAGAAAAAGAAAATCAGGCCGGG - Intergenic
1035784751 8:2251867-2251889 CAGAAACAGAATTTTAACACTGG + Intergenic
1035808056 8:2469854-2469876 CAGAAACAGAATTTTAACACTGG - Intergenic
1036057157 8:5268790-5268812 GAGAAACATAATTTTAGACATGG - Intergenic
1036186881 8:6629880-6629902 AAGAAGCAGGATCTTAGGCTGGG + Intronic
1036219258 8:6907433-6907455 AAGAAAGTGGCTTTTAGGCCAGG - Intergenic
1036474866 8:9084086-9084108 AAAAAAAAAAATTTTAGGCTGGG - Intronic
1036593975 8:10195534-10195556 AAGAGATAGAAAATTAGGCCAGG - Intronic
1036917524 8:12818892-12818914 AAGGAACAGAATATTGAGCCAGG - Intergenic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037750321 8:21677666-21677688 TAGAAACAGAACTTCAGGCTGGG - Intergenic
1037771754 8:21805225-21805247 AAGAAACAGAATTGTAGACTAGG - Intronic
1037839754 8:22235802-22235824 AAGAAAAAGTATTTTATGGCTGG + Intergenic
1039158603 8:34591549-34591571 AAGAAACAGACATATAGGCCAGG - Intergenic
1039695628 8:39907796-39907818 AAGAAATAATATTTAAGGCCGGG + Intronic
1039719688 8:40150119-40150141 ATGATACAGTATTTTAGGCTGGG + Intergenic
1039978516 8:42387161-42387183 TAGAATCAGAATTTTAGAGCTGG - Intergenic
1040047861 8:42981346-42981368 AAGAAACACTATTTTTGGCTGGG - Intronic
1040446025 8:47494281-47494303 AAAAAAAAAAATTCTAGGCCAGG - Intronic
1041168089 8:55111321-55111343 CAGAATCAGAACTTTAGACCTGG - Intronic
1041171557 8:55147613-55147635 AAGAGACAGATTTAGAGGCCTGG - Intronic
1041205764 8:55496418-55496440 CAGAATCAGAATTTAAGCCCAGG - Intronic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1041696806 8:60744555-60744577 AAAAAAAAGTATTTTAGGCCAGG + Intronic
1042239085 8:66644800-66644822 AAAAAAAAAAATTTTAGGCCAGG + Intronic
1042414008 8:68498646-68498668 AAGAACTAGAATTTTTGGCATGG + Intronic
1042548402 8:69971538-69971560 TAAAAACAAAATTTTTGGCCAGG - Intergenic
1042787321 8:72563274-72563296 AAATAAAAGAATTTTAGGCATGG + Intronic
1042828974 8:73006723-73006745 AAGAAACATAATTTTACTCAAGG + Intergenic
1042831427 8:73033432-73033454 AAGAAAAGGAAATGTAGGCCAGG + Intronic
1042848608 8:73192916-73192938 AAGTAAAAGAATGATAGGCCAGG + Intergenic
1043450409 8:80360762-80360784 AAGAAACATGATTTAAGGGCTGG + Intergenic
1043458960 8:80440132-80440154 AAGAGAAAAAATTTTAGGCCAGG - Intergenic
1043531461 8:81156072-81156094 AAGAAACAGATTTAGAGGGCTGG + Intergenic
1043842609 8:85126259-85126281 CAGTAACATAATTTTTGGCCCGG + Intronic
1044418609 8:91965350-91965372 AAGAAAGAGAATTTTAGTAGGGG - Intronic
1044696783 8:94931677-94931699 AAGAAAATTATTTTTAGGCCAGG + Intronic
1044778394 8:95718266-95718288 AAGAAAGAGAACATTCGGCCGGG + Intergenic
1044819622 8:96146818-96146840 GAGAAAAAGAAATTTAGGACAGG + Intronic
1044980971 8:97716393-97716415 AAGAAAAAAAAAGTTAGGCCGGG + Intronic
1045001341 8:97880876-97880898 AAGAATAAGATTTTCAGGCCGGG - Intronic
1045075908 8:98567760-98567782 AAAAATTATAATTTTAGGCCAGG + Intronic
1045094822 8:98786249-98786271 AAAAGAAAGAATTTCAGGCCAGG + Intronic
1045151149 8:99409581-99409603 AATAATCAAATTTTTAGGCCTGG + Intronic
1045466595 8:102476090-102476112 AAGAAATAGATTCTCAGGCCAGG - Intergenic
1045745952 8:105422140-105422162 AAGAAAAGTATTTTTAGGCCGGG + Intronic
1045839967 8:106568081-106568103 AAGTCACAGAATTTTAGATCAGG - Intronic
1045842911 8:106600360-106600382 AAGAAACTGTAGTCTAGGCCGGG - Intronic
1045863704 8:106841095-106841117 AAAAAACAACATTATAGGCCAGG - Intergenic
1046299966 8:112275250-112275272 AAGAAAAAGAGGTTTAGGCTGGG + Intronic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1046520132 8:115314066-115314088 AGGAGACAGAAATTAAGGCCTGG + Intergenic
1046758777 8:117998581-117998603 AAAATGCAGAATTTTAGGCTGGG - Intronic
1047281708 8:123451632-123451654 AGAAAACAGACTTTTAGACCAGG - Intronic
1047449830 8:124955292-124955314 ATGAAAAAGAAATATAGGCCAGG + Intergenic
1047494587 8:125400474-125400496 AAAAAAAAAAATTCTAGGCCAGG + Intergenic
1048248035 8:132830824-132830846 AAGAAACAGAAGTTTAGAAGAGG - Intronic
1048470868 8:134702964-134702986 AAGAAAAAGAGGTTTAGGCTGGG - Intronic
1048921686 8:139237223-139237245 AAAAAAAAGAATTATAGGCCAGG - Intergenic
1048944633 8:139433060-139433082 AACAAAGAGGATTTTAAGCCAGG + Intergenic
1049146965 8:141007472-141007494 AAGAAAGGGAATTTTAGGCTGGG - Intergenic
1049690252 8:143955179-143955201 TTAAAACAGAATTTCAGGCCGGG + Intronic
1049818149 8:144618075-144618097 TGAAAATAGAATTTTAGGCCAGG - Intergenic
1050064797 9:1748394-1748416 TAGAACCAGAATTCTAGCCCTGG + Intergenic
1050252274 9:3757495-3757517 AAGAAGGAGTATTCTAGGCCAGG + Intergenic
1050655013 9:7818443-7818465 AAGAAATAAAATTGTCGGCCGGG - Intronic
1050737697 9:8782889-8782911 ATGAAAAAGAAGTGTAGGCCAGG - Intronic
1050747381 9:8892085-8892107 AAGAAACAGAATTCCACTCCGGG + Intronic
1050801271 9:9617775-9617797 AAGAAATATGATTTTGGGCCCGG + Intronic
1050843194 9:10179209-10179231 AAGAAAAAGAACTTTGAGCCAGG + Intronic
1050928798 9:11299421-11299443 AAGAAAATAAATTTTAGGCCAGG + Intergenic
1051191019 9:14513332-14513354 ATGAAACAGAAATGAAGGCCGGG + Intergenic
1051432016 9:16988865-16988887 AAGAAACAAGATTTGAAGCCAGG - Intergenic
1051537871 9:18180236-18180258 ATAAAACAGACTTTAAGGCCGGG + Intergenic
1051638330 9:19201704-19201726 CAGATACAGAATTTTAGCTCTGG + Intergenic
1051702871 9:19843203-19843225 AAAAAAAATAATTTTGGGCCAGG + Intergenic
1051975906 9:22948420-22948442 AACATACAGAACTTTAGTCCCGG + Intergenic
1052007290 9:23363558-23363580 TAGAAACTGTATTTGAGGCCGGG + Intergenic
1052096136 9:24386739-24386761 AATTAACAGTCTTTTAGGCCAGG + Intergenic
1052238266 9:26239606-26239628 AAATGTCAGAATTTTAGGCCTGG - Intergenic
1052613568 9:30808856-30808878 AACAAACAGTATTTTAGGCCAGG + Intergenic
1052636092 9:31106544-31106566 AGAAAACAGTATTTTAGGCTGGG + Intergenic
1052718383 9:32145882-32145904 AAGGAACAGAATTTTATGGATGG + Intergenic
1052910187 9:33873940-33873962 AAAAAAAAAAAATTTAGGCCAGG - Intronic
1052979900 9:34440553-34440575 AAAAAAAACAATTTTTGGCCAGG + Intronic
1053079079 9:35159667-35159689 AAGAATCCTAATTCTAGGCCAGG - Intergenic
1053136479 9:35653667-35653689 AAGAAAGAAAAATTTGGGCCAGG + Intergenic
1053201992 9:36158767-36158789 AAGAAATAAGAATTTAGGCCAGG + Intronic
1053211332 9:36230954-36230976 TAGAAACAGAATTTTTAGCCAGG + Intronic
1053410087 9:37910340-37910362 GAGAAACTGAAGTTCAGGCCTGG - Intronic
1053586396 9:39463570-39463592 ATAAATCAGAATTTTTGGCCAGG - Intergenic
1053844129 9:42219139-42219161 AAAATACACAAATTTAGGCCGGG + Intergenic
1054353146 9:64037464-64037486 AAGAAATAGAACTTAAGGGCTGG + Intergenic
1054579908 9:66901647-66901669 ATAAATCAGAATTTTTGGCCAGG + Intronic
1054585150 9:66957012-66957034 AAAATACACAAATTTAGGCCGGG - Intergenic
1054788546 9:69233475-69233497 AAGATACAGAACTATGGGCCAGG + Intronic
1054999867 9:71436596-71436618 AAGAAAAAGAGGTTTAGGCCGGG - Intronic
1055159257 9:73105091-73105113 AAGAATTAGAAGGTTAGGCCTGG - Intergenic
1055382382 9:75722952-75722974 AAGAAACAGAGTTTTAGGAATGG + Intergenic
1055495382 9:76849528-76849550 AAAAACTATAATTTTAGGCCAGG + Intronic
1055578445 9:77683116-77683138 AAGAAAAAGAGGTTTAGGCTGGG + Intergenic
1055596120 9:77866180-77866202 AAAAAACAAAAATTTAGGCCGGG + Intronic
1055822746 9:80287027-80287049 TAGAAACAGACTTTTAGGGCCGG - Intergenic
1055873393 9:80913602-80913624 AAGAAACAAAATTTTTGGTCCGG - Intergenic
1056106699 9:83354219-83354241 ATAAGACAGAATTTTTGGCCAGG - Intronic
1056117324 9:83453149-83453171 AGGTAATAAAATTTTAGGCCAGG - Intronic
1056146645 9:83737703-83737725 AAAATACAGGATTTTAGGCCAGG - Intergenic
1056443965 9:86646755-86646777 AAAAAAGAAAACTTTAGGCCAGG + Intergenic
1056871072 9:90279731-90279753 AAGAAAAATAATTTTAGTCCGGG + Intergenic
1057014148 9:91635631-91635653 AAGAAATATAATTTTGGGCCAGG + Intronic
1057101431 9:92364326-92364348 TAAAAGCAGAATATTAGGCCAGG - Intronic
1057587983 9:96346839-96346861 AAAAAAAAGGATTTTTGGCCAGG + Intronic
1057947632 9:99343626-99343648 AAGAGTCAGAATATGAGGCCGGG + Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058783677 9:108364984-108365006 AAGAAAAAGAAGTTTAGGCCGGG + Intergenic
1058787281 9:108402135-108402157 AAAAAACTGAACTTAAGGCCAGG - Intergenic
1058853351 9:109034859-109034881 TAAAGACAGTATTTTAGGCCGGG + Intronic
1059051405 9:110930630-110930652 AAGAAAGTGAATATTGGGCCGGG + Intronic
1059174906 9:112160886-112160908 ACAAAACAGAATTTTACGACCGG + Intronic
1059583548 9:115579342-115579364 TAGATACAGGATTTTGGGCCAGG + Intergenic
1059628564 9:116094281-116094303 TAGAAACAGAATTTTGACCCAGG + Intergenic
1059782468 9:117544162-117544184 AAGAAATACATTTTTGGGCCAGG + Intergenic
1059981042 9:119772395-119772417 AAAACACATAATTTTAGGCAGGG + Intergenic
1060171321 9:121463682-121463704 ACAAAACAGAATTTGAGGCCAGG - Intergenic
1060510267 9:124227111-124227133 AAGAAATACATGTTTAGGCCAGG + Intergenic
1060627629 9:125128011-125128033 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1060628502 9:125135354-125135376 AAAAATCATAATTTTAGGCCAGG + Intronic
1060673469 9:125491146-125491168 AAAAAAAAAAAATTTAGGCCAGG + Intronic
1060805807 9:126575644-126575666 AAGGAACAGAATTTTAAGGATGG - Intergenic
1060922579 9:127432443-127432465 TAAAAAATGAATTTTAGGCCGGG - Intronic
1061041196 9:128141742-128141764 AAGAAACAGACTCTGAGGCCGGG - Intergenic
1061197987 9:129118668-129118690 AAAAAAAAAAATTTTAGGCGGGG - Intronic
1061344806 9:130014545-130014567 AAGAAATAGAACATTAGGCTGGG - Intronic
1061356726 9:130111168-130111190 AAGAATCTCACTTTTAGGCCAGG + Intronic
1061428875 9:130518593-130518615 AAGAAATATATTTATAGGCCGGG + Intergenic
1061487857 9:130929340-130929362 AAGAAACAGGATTTGAATCCTGG + Intronic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1062755477 9:138284468-138284490 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1203741483 Un_GL000218v1:6570-6592 AAGAAATAGAATTTAAGGGCTGG + Intergenic
1203701669 Un_KI270742v1:1152-1174 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1203553742 Un_KI270743v1:188188-188210 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1203579392 Un_KI270745v1:28640-28662 AAAAAACAAAACTTGAGGCCTGG - Intergenic
1185783718 X:2871391-2871413 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1185993200 X:4914819-4914841 AAGAAAAAGAAATTGAGTCCGGG + Intergenic
1186141868 X:6583994-6584016 AAAAAAAAGAATTTTAGTCCTGG - Intergenic
1186175828 X:6925017-6925039 AATAAATACAATTTAAGGCCGGG + Intergenic
1186712620 X:12216042-12216064 CAGAAACTGTATTCTAGGCCAGG - Intronic
1186924379 X:14316681-14316703 AATACACAGAAATTTAGGCTGGG + Intergenic
1186993544 X:15095161-15095183 TAGAAACATATTTTTAGCCCTGG + Intergenic
1187126720 X:16461197-16461219 AAAAAACATAATTTGAGGCCAGG - Intergenic
1187466189 X:19529945-19529967 AAAAAAAAAAAGTTTAGGCCGGG - Intergenic
1187599172 X:20807545-20807567 AATAAAGAGATGTTTAGGCCAGG - Intergenic
1187897607 X:23997440-23997462 AAAAAATAAAATTTTTGGCCAGG + Intronic
1188222851 X:27561277-27561299 AAGTAACAGAATTAAAAGCCAGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189157156 X:38770136-38770158 AAAATATAGATTTTTAGGCCAGG - Intergenic
1189177045 X:38968042-38968064 TTGAAACAGAATTTTAGGGTTGG - Intergenic
1189419126 X:40840829-40840851 AAAAAAAAAAACTTTAGGCCAGG + Intergenic
1189947861 X:46198142-46198164 AATAAAAATAATTTTTGGCCGGG + Intergenic
1190313852 X:49136907-49136929 AAGAAAAACAAATTTAGGCCAGG + Intergenic
1190484163 X:50908081-50908103 AAGAAAATGATTTTAAGGCCAGG - Intergenic
1190552753 X:51601779-51601801 TAGAAATAGAATTTGAGGGCAGG + Intergenic
1190821692 X:53979083-53979105 AAAAAATAAAATTTCAGGCCAGG + Intronic
1190870552 X:54421417-54421439 AAACAATAGAAATTTAGGCCGGG + Intergenic
1191857265 X:65637105-65637127 AAAGAAAAGAATATTAGGCCGGG + Intronic
1192245838 X:69370765-69370787 TAGAATAAGAAATTTAGGCCGGG - Intergenic
1192298122 X:69871240-69871262 GAGAAACAGAATATTAAGCATGG - Intronic
1192572127 X:72214689-72214711 ACAAAACAAAAGTTTAGGCCAGG + Intronic
1192819176 X:74625696-74625718 AAAATACAGAATGTTTGGCCTGG + Intergenic
1193109827 X:77717419-77717441 AAGAAAACGAATTTTAGGCCAGG + Intronic
1193121963 X:77832533-77832555 AAGAAAATCAATTTTCGGCCGGG + Intronic
1193272153 X:79541993-79542015 TAGAAACAGCATTTTGGACCTGG - Intergenic
1193882714 X:86943849-86943871 AAGAAACAGCACTTTTGGTCAGG + Intergenic
1194050908 X:89067888-89067910 AAGAATATAAATTTTAGGCCAGG + Intergenic
1194111910 X:89844330-89844352 AAAAAAAAAAATTTTAGTCCTGG - Intergenic
1195028721 X:100905128-100905150 AAGAGCCAGAATTTAAGCCCTGG - Intergenic
1195149877 X:102056107-102056129 AAAAAAAAGAATTCTATGCCAGG - Intergenic
1195237221 X:102912308-102912330 AGAAAAAAGAATTTTAGGCTGGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1196107118 X:111908674-111908696 AAGATCAACAATTTTAGGCCTGG - Intronic
1196589690 X:117472121-117472143 AACAAAAAGTATATTAGGCCGGG + Intergenic
1196826191 X:119742102-119742124 AAGAAAAAGATGTTTAGGCCAGG - Intergenic
1196914011 X:120513323-120513345 AAGAAACTGTATTCTTGGCCAGG - Intergenic
1197380340 X:125730800-125730822 AAGAAACAGAATATTAAGAATGG - Intergenic
1197380455 X:125731822-125731844 TAAAAAAAGCATTTTAGGCCAGG - Intergenic
1197964053 X:132037715-132037737 CAGAAACAGAATTCAATGCCTGG - Intergenic
1198031847 X:132760832-132760854 AAAAAAAGGAATTTGAGGCCCGG + Intronic
1198150385 X:133902947-133902969 TAAAAACACCATTTTAGGCCGGG + Intronic
1198185264 X:134248456-134248478 TGAAAACAGAATTATAGGCCGGG - Intergenic
1199178686 X:144825444-144825466 AAAAAATAGACATTTAGGCCGGG + Intergenic
1199534306 X:148884887-148884909 AAGAAAGAGATTTCTAGCCCTGG + Intronic
1200157796 X:153986633-153986655 AACAAAAATAGTTTTAGGCCAGG + Intergenic
1200309653 X:155065255-155065277 AAGAAACAGAAGTTTAGCAAGGG - Exonic
1200947458 Y:8859987-8860009 TAAAAACAGACTTTTTGGCCAGG + Intergenic
1201155011 Y:11124023-11124045 AAGAAATAGAATTTAAGGGCTGG + Intergenic
1201513121 Y:14787319-14787341 AAGATACACAATTTAAGGCCAGG - Intronic