ID: 1103133107

View in Genome Browser
Species Human (GRCh38)
Location 12:118485695-118485717
Sequence ACCAGATGGCTCCTATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103133107_1103133116 22 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133116 12:118485740-118485762 TATTGTGGGGAGAATGCATGGGG No data
1103133107_1103133112 8 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133112 12:118485726-118485748 TGGGAGAATAGTAGTATTGTGGG No data
1103133107_1103133113 9 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133113 12:118485727-118485749 GGGAGAATAGTAGTATTGTGGGG No data
1103133107_1103133114 20 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133114 12:118485738-118485760 AGTATTGTGGGGAGAATGCATGG No data
1103133107_1103133115 21 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133115 12:118485739-118485761 GTATTGTGGGGAGAATGCATGGG No data
1103133107_1103133111 7 Left 1103133107 12:118485695-118485717 CCAGTCTATAGGAGCCATCTGGT No data
Right 1103133111 12:118485725-118485747 CTGGGAGAATAGTAGTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103133107 Original CRISPR ACCAGATGGCTCCTATAGAC TGG (reversed) Intergenic