ID: 1103133232

View in Genome Browser
Species Human (GRCh38)
Location 12:118486488-118486510
Sequence CCGTGTCCCCAAAGGCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103133228_1103133232 -1 Left 1103133228 12:118486466-118486488 CCTGTTGGGGGCAGTCCATTTTC No data
Right 1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG No data
1103133227_1103133232 0 Left 1103133227 12:118486465-118486487 CCCTGTTGGGGGCAGTCCATTTT No data
Right 1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG No data
1103133222_1103133232 17 Left 1103133222 12:118486448-118486470 CCAAATGGGGAAGGTGTCCCTGT No data
Right 1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103133232 Original CRISPR CCGTGTCCCCAAAGGCAAGT TGG Intergenic
No off target data available for this crispr