ID: 1103134774

View in Genome Browser
Species Human (GRCh38)
Location 12:118498028-118498050
Sequence GAGGAATCCATGGGTCCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103134760_1103134774 20 Left 1103134760 12:118497985-118498007 CCCCACTCTGGCTCCCCTCTGGC No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134761_1103134774 19 Left 1103134761 12:118497986-118498008 CCCACTCTGGCTCCCCTCTGGCC No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134764_1103134774 6 Left 1103134764 12:118497999-118498021 CCCTCTGGCCACACTCTTCCTCA No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134763_1103134774 7 Left 1103134763 12:118497998-118498020 CCCCTCTGGCCACACTCTTCCTC No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134762_1103134774 18 Left 1103134762 12:118497987-118498009 CCACTCTGGCTCCCCTCTGGCCA No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134765_1103134774 5 Left 1103134765 12:118498000-118498022 CCTCTGGCCACACTCTTCCTCAC No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data
1103134768_1103134774 -2 Left 1103134768 12:118498007-118498029 CCACACTCTTCCTCACAGGGAGA No data
Right 1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103134774 Original CRISPR GAGGAATCCATGGGTCCAAT GGG Intergenic
No off target data available for this crispr