ID: 1103140434

View in Genome Browser
Species Human (GRCh38)
Location 12:118543379-118543401
Sequence GTTTTTCAGGTGTACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140434_1103140439 -2 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data
1103140434_1103140440 21 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data
1103140434_1103140438 -8 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140438 12:118543394-118543416 TGAAAAACAAATCATAATGTGGG No data
1103140434_1103140437 -9 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140437 12:118543393-118543415 CTGAAAAACAAATCATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140434 Original CRISPR GTTTTTCAGGTGTACCAGGA AGG (reversed) Intergenic
No off target data available for this crispr