ID: 1103140435

View in Genome Browser
Species Human (GRCh38)
Location 12:118543383-118543405
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140435_1103140439 -6 Left 1103140435 12:118543383-118543405 CCTGGTACACCTGAAAAACAAAT No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data
1103140435_1103140441 28 Left 1103140435 12:118543383-118543405 CCTGGTACACCTGAAAAACAAAT No data
Right 1103140441 12:118543434-118543456 TAAAACTTCAGGAATGAGACAGG No data
1103140435_1103140440 17 Left 1103140435 12:118543383-118543405 CCTGGTACACCTGAAAAACAAAT No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140435 Original CRISPR ATTTGTTTTTCAGGTGTACC AGG (reversed) Intergenic