ID: 1103140436

View in Genome Browser
Species Human (GRCh38)
Location 12:118543392-118543414
Sequence CACATTATGATTTGTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140436_1103140440 8 Left 1103140436 12:118543392-118543414 CCTGAAAAACAAATCATAATGTG No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data
1103140436_1103140441 19 Left 1103140436 12:118543392-118543414 CCTGAAAAACAAATCATAATGTG No data
Right 1103140441 12:118543434-118543456 TAAAACTTCAGGAATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140436 Original CRISPR CACATTATGATTTGTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr