ID: 1103140437

View in Genome Browser
Species Human (GRCh38)
Location 12:118543393-118543415
Sequence CTGAAAAACAAATCATAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140433_1103140437 -1 Left 1103140433 12:118543371-118543393 CCAAACAACCTTCCTGGTACACC No data
Right 1103140437 12:118543393-118543415 CTGAAAAACAAATCATAATGTGG No data
1103140434_1103140437 -9 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140437 12:118543393-118543415 CTGAAAAACAAATCATAATGTGG No data
1103140431_1103140437 23 Left 1103140431 12:118543347-118543369 CCTTCTGCTTCTTACTACTTTCA No data
Right 1103140437 12:118543393-118543415 CTGAAAAACAAATCATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140437 Original CRISPR CTGAAAAACAAATCATAATG TGG Intergenic
No off target data available for this crispr