ID: 1103140439

View in Genome Browser
Species Human (GRCh38)
Location 12:118543400-118543422
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140434_1103140439 -2 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data
1103140435_1103140439 -6 Left 1103140435 12:118543383-118543405 CCTGGTACACCTGAAAAACAAAT No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data
1103140431_1103140439 30 Left 1103140431 12:118543347-118543369 CCTTCTGCTTCTTACTACTTTCA No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data
1103140433_1103140439 6 Left 1103140433 12:118543371-118543393 CCAAACAACCTTCCTGGTACACC No data
Right 1103140439 12:118543400-118543422 ACAAATCATAATGTGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140439 Original CRISPR ACAAATCATAATGTGGGTTT TGG Intergenic
No off target data available for this crispr