ID: 1103140440

View in Genome Browser
Species Human (GRCh38)
Location 12:118543423-118543445
Sequence AAAAATATATTTAAAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103140434_1103140440 21 Left 1103140434 12:118543379-118543401 CCTTCCTGGTACACCTGAAAAAC No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data
1103140436_1103140440 8 Left 1103140436 12:118543392-118543414 CCTGAAAAACAAATCATAATGTG No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data
1103140435_1103140440 17 Left 1103140435 12:118543383-118543405 CCTGGTACACCTGAAAAACAAAT No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data
1103140433_1103140440 29 Left 1103140433 12:118543371-118543393 CCAAACAACCTTCCTGGTACACC No data
Right 1103140440 12:118543423-118543445 AAAAATATATTTAAAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103140440 Original CRISPR AAAAATATATTTAAAACTTC AGG Intergenic
No off target data available for this crispr