ID: 1103147320

View in Genome Browser
Species Human (GRCh38)
Location 12:118606860-118606882
Sequence GGGATTCCTGCAATCATTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103147315_1103147320 7 Left 1103147315 12:118606830-118606852 CCTAGATGCAGTTGGAAAAGAGA No data
Right 1103147320 12:118606860-118606882 GGGATTCCTGCAATCATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103147320 Original CRISPR GGGATTCCTGCAATCATTTC GGG Intergenic
No off target data available for this crispr